Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Enhanced thermostability of methyl parathion hydrolase
from Ochrobactrum sp. M231 by rational engineering of a
glycine to proline mutation
Jian Tian, Ping Wang, Shan Gao, Xiaoyu Chu, Ningfeng Wu and Yunliu Fan
Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing, China
Introduction
Methyl parathion is an organophosphate pesticide that
has been used extensively in agriculture [1–7]. It is an
acetylcholinesterase inhibitor – a neurotoxin that can
cause wide-scale environmental pollution [1,4,8,9].
Methyl parathion hydrolase (MPH; EC 3.1.8.1), iso-
lated from the soil bacterium Ochrobactrum sp. M231
(Ochr-MPH), is a 33-kDa organophosphate hydrolase.
Although it degrades methyl parathion efficiently, it
has poor thermostability, which can affect the applica-
tion of the enzyme [7]. Having previously cloned the
mph gene from Ochrobactrum sp. M231 [7], we sought
to increase the thermostability of this MPH using pro-
tein engineering.
The two main protein-engineering strategies that can
be used to increase protein thermostability are rational
design and random mutagenesis [10–12]. Of these two
Keywords
methyl parathion hydrolase; molecular
dynamics; proline theory; thermostability
Correspondence
Ningfeng Wu, Biotechnology Research
Institute, Chinese Academy of Agricultural
Sciences, 12 Zhongguancun South Street,
Beijing 100081, China
Fax: +86 10 821 09844

Tel.: +86 10 821 09844
E-mail:
(Received 13 September 2010, revised 25
September 2010, accepted 27 September
2010)
doi:10.1111/j.1742-4658.2010.07895.x
Protein thermostability can be increased by some glycine to proline muta-
tions in a target protein. However, not all glycine to proline mutations can
improve protein thermostability, and this method is suitable only at care-
fully selected mutation sites that can accommodate structural stabilization.
In this study, homology modeling and molecular dynamics simulations
were used to select appropriate glycine to proline mutations to improve
protein thermostability, and the effect of the selected mutations was proved
by the experiments. The structure of methyl parathion hydrolase (MPH)
from Ochrobactrum sp. M231 (Ochr-MPH) was constructed by homology
modeling, and molecular dynamics simulations were performed on the
modeled structure. A profile of the root mean square fluctuations of Ochr-
MPH was calculated at the nanosecond timescale, and an eight-amino acid
loop region (residues 186–193) was identified as having high conforma-
tional fluctuation. The two glycines nearest to this region were selected as
mutation targets that might affect protein flexibility in the vicinity. The
structures and conformational fluctuations of two single mutants (G194P
and G198P) and one double mutant (G194P ⁄ G198P) were modeled and
analyzed using molecular dynamics simulations. The results predicted that
the mutant G194P had the decreased conformational fluctuation in the
loop region and might increase the thermostability of Ochr-MPH. The
thermostability and kinetic behavior of the wild-type and three mutant
enzymes were measured. The results were consistent with the computa-
tional predictions, and the mutant G194P was found to have higher ther-
mostability than the wild-type enzyme.

Abbreviations
3D, three dimensional; MDS, molecular dynamics simulations; MPH, methyl parathion hydrolase; Ochr-MPH, methyl parathion hydrolase
from Ochrobactrum sp. M231; rmsd, root mean square deviation; rmsf, root mean square fluctuation; T
50
, the temperature at which the
enzyme lost 50% of its activity; T
m
, the unfolding temperature measured using CD; WT, wild type.
FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4901
methods, computer-assisted rational design is an inex-
pensive and straightforward route to engineer
improved protein thermostability, because site-directed
mutagenesis techniques have been well developed
[10,11,13,14]. However, many factors affect protein
thermostability, and no clear-cut guarantees of success
exist [11,12,15–17].
Glycine, the only amino acid that lacks a b-carbon,
has the highest conformational entropy [18], while pro-
line can adopt only a few configurations and has the
lowest conformational entropy [19,20]. A glycine to
proline mutation could therefore decrease the confor-
mational entropy of a protein and lead to stabilization
[21–25]. This ‘proline theory’ was proposed by Suzuki
et al. [22,23] and has been used successfully to improve
the thermostability of many enzymes [25–27]. How-
ever, not all glycine to proline mutations can improve
protein thermostability, and this method is suitable
only at carefully selected mutation sites that can
provide structural stabilization [13,19,25,27].
Using molecular dynamics simulations (MDS), pro-

tein conformational changes can be studied over small
time increments (in the ps range) [28]. By calculating
the root mean square deviation (rmsd) and root mean
square fluctuation (rmsf) values for backbone atoms,
thermally sensitive or conformationally flexible regions
of a protein can be identified [29].
In this study, the structure of Ochr-MPH was con-
structed through homology modeling. MDS were per-
formed on the modeled structure to examine the
region with the greatest conformational fluctuation.
The only two glycines near this region, G194 and
G198, were selected as mutation targets. Structures of
the hypothetical mutants, namely G194P, G198P and
G194P ⁄ G198P, were modeled and analyzed using
MDS to test the effect of the mutations; the mutant
G194P was predicted to have increased thermostabil-
ity. This prediction was also supported by experimen-
tal data on the thermostability the wild-type (WT) and
mutant proteins expressed in Escherichia coli.
Results and Discussion
Three-dimensional model of Ochr-MPH
The three-dimensional (3D) structure of Ochr-MPH
was modeled using the crystal structure of MPH (PDB
ID: 1P9E) obtained from Pseudomonas sp. WBC3 as
the template [6]. The resulting model for Ochr-MPH is
shown in Fig. 1; it can be described as an ab ⁄ ba sand-
wich typical of the metallo-hydrolase ⁄ oxidoreductase
fold [6]. The final model of Ochr-MPH, as determined
using discovery studio 2.5.5 software, possessed good
stereochemical quality with only one residue (Asp112)

located out of the generously allowed regions in the
Ramachandran plot.
MDS to predict the effect of mutations on protein
stability
MDS were performed on the modeled structure of
Ochr-MPH using gromacs
4.05 [30]. The rmsd values
of the backbone atoms for Ochr-MPH are shown in
Fig. 2, for which the reference structure was the struc-
ture obtained from the equilibration step performed
immediately before the MDS run. The conformation
of Ochr-MPH became stable during the MDS after
3000 ps (Fig. 2).
rmsf values reflect fluctuation at individual residues
– a higher rmsf value indicates less stability [31–33]. As
shown in Fig. 3, residues 186-193 of Ochr-MPH gave
the highest rmsf values. These residues are located at
the protein surface, in a loop region, between a
b-strand and a-helix (shown in Fig. 1). Two glycine
residues, G194 and G198, lie just beyond the C-terminal
end of this region. G194 and G198 were therefore cho-
sen as target sites for the glycine to proline mutation.
The 3D models of the three mutants (G194P,
G194P ⁄ G198P and G198P) were constructed using the
standard mutation protocol of the discovery studio
Fig. 1. Ribbon plot of the three-dimensional structure of Ochr-
MPH, using Pseud-MPH (PDB ID: 1P9E) as the template. Key resi-
dues in the active site are shown in green, and the two Zn ions are
shown in silver. Gly194 is shown in red, and Gly198 is shown in
yellow. The region (residues 186–193) with greatest conformational

fluctuation is shown in purple.
Enhanced thermostability of methyl parathion hydrolase J. Tian et al.
4902 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS
software. MDS were executed for 5 ns on the three
modeled structures (G194P, G194P ⁄ G198P and
G198P) using Gromacs 4.05 [30]. The calculated rmsd
and rmsf values are shown in Figs 2 and 3, respec-
tively. Similarly to the WT Ochr-MPH, the conforma-
tions of the three mutants became stable during the
MDS after 3000 ps (Fig. 2). The average rmsd values
over the final 2 ns were as follows: 0.43 ± 0.01 nm for
WT Ochr-MPH, 0.31 ± 0.02 nm for the G194P
mutant, 0.44 ± 0.03 nm for the G194P ⁄ G198P
mutant, and 0.42 ± 0.02 nm for the G198P mutant.
During the simulation, rmsf values of residues 186-193
for the mutant G194P were lowest among the WT and
three mutants (Fig. 3), indicating that a more stable
conformation was achieved for these residues.
Kinetic characterization of WT and mutant
enzymes
The genes encoding the WT and mutant enzymes were
cloned and expressed in E. coli. After purification, each
of the expressed proteins migrated as a single band, of
33 kDa apparent molecular mass, on SDS ⁄ PAGE
(Fig. 4). Kinetic parameters of WT and mutant enzymes
were measured as described in the Materials and meth-
ods, and the results are shown in Table 1. All mutants
had methyl parathion hydrolase activity, but the mutant
G194P had a higher overall catalytic efficiency (k
cat

⁄ K
m
)
than the other mutants and the WT enzyme. The overall
catalytic efficiency (k
cat
⁄ K
m
) of the mutant G198P was
lower than that of the WT enzyme. The overall catalytic
efficiency (k
cat
⁄ K
m
) of the double point mutant
(G194P ⁄ G198P) was similar to that of the WT enzyme
and between those of G194P and G198P.
Thermostability of WT and mutant enzymes
The thermostability of the WT and mutant enzymes
was determined by measuring residual activity after
incubation for 10 min at various temperatures (Fig. 5).
The temperature at which the G194P mutant lost 50%
of its activity (T
50
) was approximately 67 °C, which is
higher than that for the WT enzyme (62 °C), and for
the G194P⁄ G198P (61 °C) and G198P (54 °C)
mutants, as shown in Table 1, whereas the T
50
of

G198P was lower than that of the WT enzyme. The
T
50
of the double point mutant (G194P ⁄ G198P) was
similar to that of the WT enzyme and between those
of G194P and G198P.
To further investigate the thermostability of the WT
and mutant enzymes, the unfolding temperature (T
m
)
was measured using CD spectroscopy. The CD spectra
Fig. 2. rmsd values during a 5.0-ns MDS for WT MPH and mutant
enzymes (G194P, G194P ⁄ G198P and G198P).
Fig. 3. rmsf values calculated over the last 2 ns time window for
WT MPH and mutant enzymes (G194P, G194P ⁄ G198P and G198P).
Fig. 4. SDS ⁄ PAGE analysis of the purified WT MPH and mutant
enzymes (G194P, G194P ⁄ G198P and G198P). Lane 1, purified WT
MPH; lane 2, purified G194P; lane 3, purified G194P ⁄ G198P; lane
4, purified G198P; and lane 5, protein marker. The positions of the
molecular mass markers are shown on the right side of the picture.
J. Tian et al. Enhanced thermostability of methyl parathion hydrolase
FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4903
of the WT and mutant enzymes at 25 °C were measured
from 190 to 240 nm at pH 7.4 and found to be identical.
Then, the enzyme samples were heated from 20 to 86 °C
and the CD signals of the enzyme were read at 222 nm
using the MOS-450 (Bio-Logic, Grenoble, France). The
T
m
values, as shown in Table 1, were determined at the

unfolding curves (Fig. 6). The mutants of G194P and
G194P ⁄ G198P showed T
m
values that were 3.3 °C and
0.6 °C higher, respectively, than that of the WT enzyme
(Table 1). The T
m
of mutant G198P was 1.0 °C lower
than that of the WT enzyme.
These experimental results indicate that replacing
G194 with proline enhances the thermal stability of
Ochr-MPH; however, replacing G198 of Ochr-MPH
with proline did not improve the thermostability.
The thermostability of the double point mutant
(G194P ⁄ G198P) was similar to that of the WT enzyme
and between those of G194P and G198P. These experi-
mental results are in agreement with the MDS results.
The results suggest that determining regions of higher
conformational fluctuation using MDS is a powerful
method to guide selective mutation of glycine to pro-
line to decrease conformational fluctuation, thereby
increasing thermostability.
Structure energy of WT and mutant enzymes
The structure energies of WT and mutant enzymes were
also calculated with the CHARMm force field [34] using
the software discovery studio
2.5.5. The potential
energy of the G194P mutant was 33.7 kcalÆmol
)1
lower

than that of the WT enzyme, which indicated that the
structure of G194P was more stable than that of the
WT enzyme, as shown in Table 2. The structural stabil-
ity induced by the G194P mutant was mainly a result
of the enhanced electrostatic interaction and van der
Waals interactions, as the electrostatic and van der
Waals energies of the G194P were lower than those of
the WT enzyme (Table 2). As the structure of the
G194P mutant become more stable than that of the WT
enzyme, the rmsf values (calculated by the MDS) of the
residues would be reduced, which is demonstrated in
Fig. 3. As a result, the G194P mutant exhibited better
thermostability than the WT enzyme.
Table 1. Comparison of properties of the WT (Ochr-MPH) and mutant (G194P, G198P and G194P ⁄ G198P) enzymes. K
m
and k
cat
values
were calculated by nonlinear regression analysis using
GRAPHPAD PRISM. All values are expressed as mean ± SD, based on three separate
experiments.
Enzyme k
cat
(min
)1
) K
m
(lM) k
cat
⁄ K

m
(lM
)1
Æmin
)1
) T
m
(°C) T
50
(°C)
Ochr-MPH 252.8 ± 12.64 76.25 ± 4.10 3.32 ± 0.34 67.0 62
G194P 454.70 ± 20.89 64.48 ± 3.41 7.05 ± 0.70 70.3 67
G198P 153.70 ± 6.30 92.70 ± 4.55 1.66 ± 0.15 66.0 54
G194P ⁄ G198P 288.80 ± 10.96 82.73 ± 4.16 3.49 ± 0.31 67.6 61
Fig. 5. Thermostability of WT and mutant (G194P, G194P ⁄ G198P
and G198P) enzymes. The thermal stability of the enzymes was
determined by monitoring residual enzymatic activity after incuba-
tion for 10 min at various temperatures. Enzymatic activity was
then assayed using the standard enzyme assay. Data points corre-
spond to the mean values of three independent experiments.
Fig. 6. Temperature-induced unfolding measured using CD spec-
troscopy for WT MPH and mutant enzymes (G194P, G194P ⁄ G198P
and G198P).
Enhanced thermostability of methyl parathion hydrolase J. Tian et al.
4904 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS
Materials and methods
Bacterial strains, plasmids, restriction enzymes
and chemicals
The bacterium Ochrobactrum sp. M231 was isolated from
the soil at a pesticide factory in Tianjin, China, and

stored in our laboratory [7]. The E. coli strains JM109
(Promega, Madison, WI, USA) and BL21 (DE3) (Nov-
agen, Darmstadt, Germany) were used for recombinant
plasmid amplification and protein expression, respectively.
The vector pET-30a(+) (Novagen), which introduces a
His6-tag (His-tagÔ; Novagen) at the N-terminus, was
used for gene expression. All restriction enzymes were
obtained from TaKaRa (Otsu, Japan). Isopropyl thio-b-d-
galactoside, kanamycin and imidazole were purchased
from Ameresco (Tully, NY, USA). All chemicals were of
analytical grade.
Construction of WT Ochr-MPH and mutants
Genomic DNA of Ochrobactrum sp. M231 was extracted
using a bacterial DNA extraction kit (Tiangen Biotech,
Beijing, China) according to the manufacturer’s instruc-
tions. The gene encoding MPH (GenBank accession no.:
EU596456) was amplified from the genomic DNA using the
PCR; the primers used in this PCR are shown in Table 3.
The PCR product of the WT Ochr-MPH sequence was
purified using a gel-extraction kit (Tiangen Biotech),
digested with EcoRI and NotI, then ligated to the
pET-30a(+) vector. Site-directed mutagenesis was per-
formed using the overlap-extension PCR method [35] to
generate the corresponding fragments for the following
mutants: G194P, G198P and G194P ⁄ G198P. The primers
used to construct mutant MPHs using the overlap-exten-
sion method are shown in Table 3. PCR products of the
mutants were also digested with EcoRI and NotI, and then
cloned into pET-30a(+). DNA sequencing was performed
to validate the insert genes at the State Key Laboratory of

Crop Genetic Improvement, Chinese Academy of Agricul-
tural Sciences (Beijing, China). The correct plasmids for the
WT and mutant enzymes were then transformed into
E. coli BL21 (DE3) for expression [36].
Purification and quantification of recombinant
WT Ochr-MPH and mutants
The N-terminus of each resulting recombinant protein was
fused to a His6-tag that enabled purification using a Ni-ni-
trilotriacetic acid His-bindÔ resin column (Novagen),
according to the manufacturer’s instructions. As the
obtained protein exhibited high concentrations of imidaz-
ole, the protein was desalted with 50 mm Tris buffer (pH
8.0) to determine the kinetic parameters and with 10 mm
NaCl ⁄ P
i
(pH 7.4) to determine the protein thermostability.
The purified proteins were stored at )20 °C in aliquots
until use. The purity of the proteins was analyzed by
SDS ⁄ PAGE followed by staining with Coomassie Brilliant
Blue (R250; Amersham Pharmacia Biotech, St Albans,
UK) [36]. The concentrations of the purified proteins were
determined using the Bio-Rad Protein Assay Kit (Bio-Rad,
Hercules, CA, USA).
Standard enzyme assay
MPH activity was determined by measuring the release of
the product, p-nitrophenol, from the substrate, methyl
parathion [5,8]. The assay mixture (150 lL) contained 2 lL
of 2 mgÆmL
)1
methyl parathion, 50 lL of purified protein

Table 2. The potential energy, van der Waals energy and electrostatic energy of the WT (Ochr-MPH) and mutant (G194P, G198P and
G194P ⁄ G198P) enzymes. Calculation is based on the force field CHARMm. Values are in kcalÆmol
)1
.
Potential energy van der Waals energy Electrostatic energy
Value
a
Difference
b
Value Difference Value Difference
Ochr-MPH )16509.5 0.0 )2367.7 0.0 )11126.0 0.0
G194P )16543.2 )33.7 )2381.6 )13.9 )11388.9 )262.9
G194P ⁄ G198P )16477.8 31.7 )2394.3 )26.6 )11448.0 )322.0
G198P )16419.9 89.6 )2362.8 4.9 )11303.7 )177.7
a
The corresponding energy value;
b
The energy difference between the protein and the WT MPH.
Table 3. PCR primers for the wild-type (Ochr-MPH) and mutant
(G194P, G198P and G194P ⁄ G198P) enzymes.
Enzyme Primer sequence
Wild-type MPH
a
Forward: 5¢-TAGAATTCGCTGCTCCACAA
GTTAGAACT-3¢
Reverse: 5¢-TA
GCGGCCGCTTACTTTGGGTTA
ACGACGGA-3¢
Mutant MPH
b

G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢
G198P 5¢-AAAGGTTTCTTCAAG
CCGGCCATGGCTTCCCTT-3¢
G194P ⁄
G198P
5¢-CCTGACGATTCTAAA
CCGTTCTTCAAGCCGG
CCATGGCTTCCCTT-3¢
a
The restriction sites EcoRI and NotI, introduced in the forward
and reverse primers, respectively, are underlined.
b
The oligonu-
cleotide sequence for the forward primer only is shown, and muta-
tion sites are indicated by underlined sequences.
J. Tian et al. Enhanced thermostability of methyl parathion hydrolase
FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4905
(40 lgÆmL
)1
) and 98 lLof50mm Tris buffer, pH 8.0. The
reactions were incubated at 37 °C for 6 min. The absor-
bance of the liberated p-nitrophenol was measured at
405 nm. One unit of activity was defined as the amount of
enzyme required to liberate 1 lmol of p-nitrophenol per
minute at 37 °C.
Determination of kinetic parameters
Purified enzymes were diluted with 50 mm Tris buffer, pH
8.0, to a final concentration of 12 lgÆmL
)1
. The MPH assay

was performed at 37 °C using nine different concentrations of
methyl parathion, ranging from 1 to 160 lm. Each test was
carried out with at least three replicates. The K
m
and k
cat
val-
ues were calculated by nonlinear regression using graphpad
prism 5.0 (GraphPad Software Inc., La Jolla, CA, USA).
Thermostability assay of WT and mutant
enzymes
All of the purified enzymes were diluted to 120 lgÆmL
)1
with 50 mm Tris buffer (pH 8.0). The diluted enzymes were
incubated at various temperatures, from 45 to 75 °C, for
10 min. Immediately after heating, the enzymes were placed
on ice for 30 min. The residual MPH activity was measured
using the assay described above, and at least three samples
were run in parallel.
CD spectrometry
CD measurements of the WT and mutant enzymes were
performed using a MOS-450 CD spectrometer (Bio-Logic,
France) equipped with a TCU-250 Peltier-type temperature-
control system. Spectra were recorded from 190 to 240 nm
using a 1-mm cell and a bandwidth of 1 nm. The unfolding
curves were measured at 222 nm, from 20 to 86 °C, using
the temperature scan mode with a gradient of 1 °CÆmin
)1
.
The measurements were performed in 10 mm NaCl ⁄ P

i
(pH
7.4) using a protein concentration of 3 lm.
Homology modeling of Ochr-MPH
The tertiary structures of Ochr-MPH and the mutants
(G194P, G198P and G194P ⁄ G198P) were modeled using
MODELER, a component of the discovery studio soft-
ware suite v2.5.5 (Accelrys Software Inc., San Diego, CA,
USA). The X-ray crystallographic structure of MPH (PDB
ID: 1P9E) obtained from Pseudomonas sp. WBC3 Pseud-
MPH [6] was used as the template, as it had the highest
sequence identity (98%) with the candidate sequence (Ochr-
MPH). To ensure that the modeled structure was realistic,
the values for the w and u angles of their Ramachandran
plots were checked using the discovery studio software
suite.
MDS
MDS were performed using Gromacs v4.0.5 [30], imple-
menting the Gromos 96.1 (53A6) force field [37]. The ini-
tial structure was solvated with a simple point-charge
model of water in a box with a volume of
90 · 90 · 90 A
˚
3
. A sufficient number of Cl
)
ions were
added to neutralize the positive charges in the system. The
system was then subjected to a steepest descent energy
minimization, and the 30-ps MDS was performed at

300 K, with the heavy atoms and Ca atoms fixed. Finally,
a 5-ns MDS was performed on the whole system at 300 K.
All bond lengths were constrained using the LINCS algo-
rithm [38]. The cut-off value for van der Waals interac-
tions was set at 1.0 nm, and electrostatic interactions were
calculated using a particle mesh Ewald algorithm [39]. The
time step of the simulation was set at 2 fs, and the coordi-
nates were saved for analysis every 1 ps. Post-processing
and analysis were performed using standard Gromacs tools
and customized Perl scripts.
Structure energy calculations
The structures of the WT and mutant enzymes were
minimized using the discovery studio
2.5.5 software with
the ‘Minimization protocol’. The minimization
algorithms of the Steepest Descent and Conjugate
Gradient methods were used with a Generalized Born
implicit solvent model [40]. The run steps of each mini-
mization were set at 5000 steps. Then, the potential
energy, van der Waals energy and electrostatic energy
for the structures of the WT and mutant enzymes were
determined with the discovery studio
2.5.5 software
using the calculate energy protocol.
Acknowledgements
This work was supported by grants from National
High Technology Research and Development Program
of China (863 Program, 2007AA100605).
References
1 Yang C, Freudl R, Qiao C & Mulchandani A (2010)

Cotranslocation of methyl parathion hydrolase to the
periplasm and of organophosphorus hydrolase to the
cell surface of Escherichia coli by the Tat pathway and
ice nucleation protein display system. Appl Environ
Microbiol 76, 434–440.
2 Wang X, Wu N, Guo J, Chu X, Tian J, Yao B & Fan
Y (2008) Phytodegradation of organophosphorus com-
pounds by transgenic plants expressing a bacterial orga-
nophosphorus hydrolase. Biochem Biophys Res Commun
365, 453–458.
Enhanced thermostability of methyl parathion hydrolase J. Tian et al.
4906 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS
3 Yu H, Yan X, Shen W, Hong Q, Zhang J, Shen Y
& Li S (2009) Expression of methyl parathion
hydrolase in Pichia pastoris. Curr Microbiol 59, 573–
578.
4 Yang C, Freudl R & Qiao C (2009) Export of methyl
parathion hydrolase to the periplasm by the twin-argi-
nine translocation pathway in Escherichia coli. J Agric
Food Chem 57, 8901–8905.
5 Chu X, Wu N, Deng M, Tian J, Yao B & Fan Y
(2006) Expression of organophosphorus hydrolase
OPHC2 in Pichia pastoris: purification and characteriza-
tion. Protein Expr Purif 49, 9–14.
6 Dong Y, Bartlam M, Sun L, Zhou Y, Zhang Z, Zhang
C, Rao Z & Zhang X (2005) Crystal structure of methyl
parathion hydrolase from Pseudomonas sp. WBC-3.
J Mol Biol 353, 655–663.
7 Xiao W, Chu X, Tian J, Guo J & Wu N (2008)
Cloning of a Methyl Parathion Hydrolase Gene from

Ochrobactrum sp. J Agric Sci Technol (In Chinese) 10,
99–102.
8 Chu XY, Tian J, Wu NF & Fan YL (2010) An intra-
molecular disulfide bond is required for the thermo-
stability of methyl parathion hydrolase, OPHC2. Appl
Microbiol Biotechnol 88 , 125–131.
9 Yang J, Yang C, Jiang H & Qiao C (2008) Overexpres-
sion of methyl parathion hydrolase and its application
in detoxification of organophosphates. Biodegradation
19, 831–839.
10 Choudhury D, Biswas S, Roy S & Dattagupta JK(2010)
Improving thermostability of papain through structure-
based protein engineering. Protein Eng Des Sel 23,
457–467.
11 Gribenko AV, Patel MM, Liu J, McCallum SA, Wang
C & Makhatadze GI (2009) Rational stabilization of
enzymes by computational redesign of surface charge-
charge interactions. Proc Natl Acad Sci USA 106, 2601–
2606.
12 Tian J, Wu N, Chu X & Fan Y (2010) Predicting changes
in protein thermostability brought about by single- or
multi-site mutations. BMC Bioinformatics 11, 370.
13 Talakad JC, Wilderman PR, Davydov DR, Kumar S &
Halpert JR (2010) Rational engineering of cytochromes
P450 2B6 and 2B11 for enhanced stability: Insights into
structural importance of residue 334. Arch Biochem
Biophys 494, 151–158.
14 Han ZL, Han SY, Zheng SP & Lin Y (2009) Enhancing
thermostability of a Rhizomucor miehei lipase by engi-
neering a disulfide bond and displaying on the yeast cell

surface. Appl Microbiol Biotechnol 85, 117–126.
15 Potapov V, Cohen M & Schreiber G (2009) Assessing
computational methods for predicting protein stability
upon mutation: good on average but not in the details.
Protein Eng Des Sel 22, 553–560.
16 Bae E, Bannen RM & Phillips GN Jr (2008) Bioinfor-
matic method for protein thermal stabilization by
structural entropy optimization. Proc Natl Acad Sci
USA 105, 9594–9597.
17 Lonquety M, Lacroix Z, Papandreou N & Chomilier J
(2009) SPROUTS: a database for the evaluation of pro-
tein stability upon point mutation. Nucleic Acids Res
37, D374–379.
18 Feng Y, Huang S, Zhang W, Zeng Z, Zou X, Zhong L,
Peng J & Jing G (2004) The effects of amino acid
replacements of glycine 20 on conformational stability
and catalysis of staphylococcal nuclease. Biochimie 86,
893–901.
19 Trevino SR, Schaefer S, Scholtz JM & Pace CN (2007)
Increasing protein conformational stability by optimiz-
ing beta-turn sequence. J Mol Biol 373, 211–218.
20 Prajapati RS, Das M, Sreeramulu S, Sirajuddin M,
Srinivasan S, Krishnamurthy V, Ranjani R, Ramakrish-
nan C & Varadarajan R (2007) Thermodynamic effects
of proline introduction on protein stability. Proteins 66,
480–491.
21 Vieille C & Zeikus GJ (2001) Hyperthermophilic
enzymes: sources, uses, and molecular mechanisms for
thermostability. Microbiol Mol Biol Rev 65, 1–43.
22 Watanabe K, Chishiro K, Kitamura K & Suzuki Y

(1991) Proline residues responsible for thermostability
occur with high frequency in the loop regions of an
extremely thermostable oligo-1,6-glucosidase from
Bacillus thermoglucosidasius KP1006. J Biol Chem 266,
24287–24294.
23 Suzuki Y, Hatagaki K & Oda H (1991) A hyperthermo-
stable pullulanase produced by an extreme thermophile,
Bacillus flavocaldarius KP 1228, and evidence for the
proline theory of increasing protein thermostability.
Appl Microbiol Biotechnol 34, 707–714.
24 Watanabe K, Kitamura K & Suzuki Y (1996) Analysis
of the critical sites for protein thermostabilization by
proline substitution in oligo-1,6-glucosidase from Bacil-
lus coagulans ATCC 7050 and the evolutionary consid-
eration of proline residues. Appl Environ Microbiol 62,
2066–2073.
25 Schultz DA, Friedman AM, White MA & Fox RO
(2005) The crystal structure of the cis-proline to glycine
variant (P114G) of ribonuclease A. Protein Sci 14,
2862–2870.
26 Goihberg E, Dym O, Tel-Or S, Levin I, Peretz M &
Burstein Y (2007) A single proline substitution is critical
for the thermostabilization of Clostridium beijerinckii
alcohol dehydrogenase. Proteins 66, 196–204.
27 Zhou C, Xue Y & Ma Y (2010) Enhancing the thermo-
stability of a-glucosidase from Thermoanaerobacter
tengcongensis MB4 by single proline substitution.
J Biosci Bioeng 110, 12–17.
28 Purmonen M, Valjakka J, Takkinen K, Laitinen T &
Rouvinen J (2007) Molecular dynamics studies on the

thermostability of family 11 xylanases. Protein Eng Des
Sel 20, 551–559.
J. Tian et al. Enhanced thermostability of methyl parathion hydrolase
FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS 4907
29 Liu J, Yu H & Shen Z (2008) Insights into thermal sta-
bility of thermophilic nitrile hydratases by molecular
dynamics simulation. J Mol Graph Model 27, 529–535.
30 Van Der Spoel D, Lindahl E, Hess B, Groenhof G,
Mark AE & Berendsen HJ (2005) GROMACS: fast,
flexible, and free. J Comput Chem 26, 1701–1718.
31 Fujiwara R, Nakajima M, Yamamoto T, Nagao H &
Yokoi T (2009) In silico and in vitro approaches to elu-
cidate the thermal stability of human UDP-glucurono-
syltransferase (UGT) 1A9. Drug Metab Pharmacokinet
24, 235–244.
32 Yan MC, Sha Y, Wang J, Xiong XQ, Ren JH & Cheng
MS (2008) Molecular dynamics simulations of HIV-1
protease monomer: Assembly of N-terminus and
C-terminus into beta-sheet in water solution. Proteins
70, 731–738.
33 Sun H, Jiang YJ, Yu QS, Luo CC & Zou JW (2008)
Effect of mutation K85R on GSK-3beta: Molecular
dynamics simulation. Biochem Biophys Res Commun
377, 962–965.
34 Brooks BR, Brooks CL III, Mackerell AD Jr, Nilsson
L, Petrella RJ, Roux B, Won Y, Archontis G, Bartels
C, Boresch S et al. (2009) CHARMM: the biomolecular
simulation program. J Comput Chem 30, 1545–1614.
35 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR
(1989) Site-directed mutagenesis by overlap extension

using the polymerase chain reaction. Gene 77, 51–59.
36 Sambrook J & Russell DW (2001) Molecular Cloning: a
Laboratory Manual, 3rd edn. Cold Spring Harbor Lab-
oratory, Cold Spring Harbor.
37 Scott WRP, Hunenberger PH, Tironi IG, Mark AE,
Billeter SR, Fennen J, Torda AE, Huber T, Kruger P &
van Gunsteren WF (1999) The GROMOS Biomolecular
Simulation Program Package. J Phys Chem A 103,
3596–3607.
38 Hess B, Bekker H, Berendsen HJC & Fraaije JGEM
(1997) LINCS: A linear constraint solver for molecular
simulations. J Comput Chem 18, 1463–1472.
39 Essmann U, Perera L, Berkowitz ML, Darden T, Lee
H & Pedersen LG (1995) A smooth particle mesh
Ewald method. J Chem Phys 103, 8577–8593.
40 Chen J, Brooks CL III & Khandogin J (2008) Recent
advances in implicit solvent-based methods for biomo-
lecular simulations. Curr Opin Struct Biol 18, 140–148.
Enhanced thermostability of methyl parathion hydrolase J. Tian et al.
4908 FEBS Journal 277 (2010) 4901–4908 ª 2010 The Authors Journal compilation ª 2010 FEBS