Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx

The alr2505 (osiS) gene from Anabaena sp. strain PCC7120
encodes a cysteine desulfurase induced by oxidative stress
Marion Ruiz, Azzeddine Bettache, Annick Janicki, Daniel Vinella, Cheng-Cai Zhang and Amel Latifi
Aix-Marseille Universite
´
and Laboratoire de Chimie Bacte
´
rienne, IBSM-CNRS, Marseille, France
Introduction
Sulfur is present in a wide range of biomolecules with
various chemical features, including enzymes catalyzing
many important chemical reactions. During the last
decade, considerable progress has been made towards
understanding sulfur-trafficking processes in various
organisms, with particular attention being paid to the
enzymes that catalyze the reactions involved. Pyridoxal
5¢-phosphate (PLP)-dependent cysteine desulfurases
have been found to provide the sulfur required for a
wide range of cellular processes, such as the synthesis
of molybdopterin [1–3], thiamin [4,5], the thionucleo-
tides in tRNA [6–9] and the assembly of Fe-S clusters
[10–15]. The first cysteine desulfurase to be discovered
was the NifS protein, which is involved in the forma-
tion of the nitrogenase Fe-S cluster in Azotobac-
ter vinnelandii [15]. Subsequently, cysteine desulfurases
have been identified in many organisms and classified
on the basis of sequence similarities into two groups:
I and II [16]. Group I contains the NifS proteins
themselves and other subsets of cysteine desulfurases that
are not restricted to diaztrophic organisms, namely the
ISC and NFS proteins. All the members of this group

have the consensus sequence SSSGSAC(T ⁄ S)S in com-
mon. The members of group II, which includes the
enzymes SufS, CsdA and CpNifS, have the consensus
sequence -RXGHHCA- [16]. The cysteine desulfurases
in both groups are homodimers that use PLP to cata-
lyze the elimination of sulfur from l-cysteine, yielding
alanine and either sulfane (S°) or sulfide (S
=
), in the
presence of a reducing agent. This reaction involves
the formation of a persulfide intermediate (R-S-SH)
that is bound to an essential cysteine residue close to
the C-terminus of the enzyme. The existence of this
intermediate was first established in NifS from A. vinn-
elandii and, subsequently, based on structural studies,
in SufS from Escherichia coli [17,18]. The persulfide
cleavage is the rate-limiting step in the processes of
catalysis. A new catalytic cycle can only occur once
Keywords
Anabaena; cysteine desulfurase; Fe-S
clusters; oxidative stress; sulfur transfer
Correspondence
A. Latifi. Laboratoire de Chimie Bacte
´
rienne,
IBSM-CNRS, 31 Chemin Joseph Aiguier,
13402 Marseille, Cedex 20, France
Fax: +33 4 91 71 89 14
Tel: +33 4 91 16 41 88
E-mail: latifi@ifr88.cnrs-mrs.fr

(Received 22 May 2010, revised 27 June
2010, accepted 12 July 2010)
doi:10.1111/j.1742-4658.2010.07772.x
NifS-like cysteine desulfurases are widespread enzymes involved in the mobi-
lization of sulfur from cysteine. The genome of the filamentous diazotrophic
cyanobacterium Anabaena PCC 7120 contains four open reading frames
potentially encoding NifS-like proteins. One of them, alr2505, belongs to the
pkn22 operon, which enables Anabaena to cope with oxidative stress. The
Alr2505 protein was purified and found to share all the features characteris-
tic of cysteine desufurases. This is the first NifS-like enzyme to be function-
ally characterized in this bacterium. On the basis of the transcriptional
profiling of all nifS-like genes in Anabaena, it is concluded that alr2505 is the
only cysteine desulfurase-encoding gene induced by oxidative stress. The
function of Alr2505, which was termed OsiS, is discussed.
Structured digital abstract
l
MINT-7966515: osis (uniprotkb:Q8YU51) and osiS (uniprotkb:Q8YU51) physically interact
(
MI:0915)bytwo hybrid (MI:0018)
Abbreviations
PLP, pyridoxal-5¢-phosphate.
FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3715
the sulfur atom is released from the persulfide and the
active site of the enzyme (i.e. the cysteine residue)
becomes accessible [17]. In vitro, this step can be
achieved by decomposing the persulfide into sulfide in
the presence of thiols, whereas, in vivo, it involves the
transfer of the persulfide-sulfur sulfane to a cysteine
residue of a sulfur acceptor protein. In E. coli, these
transpersulfuration reactions take the form of sulfur

being transferred from the cysteine desulfurases SufS
and CsdA to their sulfur acceptors, SufE and CsdE,
respectively [19,20].
In cyanobacteria, cysteine desulfurases have been
characterized in functional terms only in the case of
Synechocystis PCC 6803. This unicellular nondiazo-
trophic cyanobacterium possesses four ORFs, in which
the corresponding proteins show sequence similarities
with NifS (Slr0387, Sll0704, Slr5022 and Slr0077).
Slr0387, Slr5022 and Sll0704 belong to the group I cys-
teine desulfurases, whereas Slr0077 belongs to group
II. The cysteine desulfurase activities of Slr0387 and
Sll0704 have been characterized in vitro [21–23]. Both
proteins were found to be able to deliver sulfur to
apoferredoxin, and the finding that slr0387 and sll0704
mutants were obtained suggested that none of them
was essential for the viability of this cyanobacterium
[24]. The cellular targets to which these proteins trans-
fer sulfur remain unknown.
Slr0077 (SufS) appears to be the essential cysteine
desulfurase of Synechocystis PCC6803 because
attempts to obtain a fully-segregated mutant of this
gene have proved unsuccessful [24]. Structural charac-
terization of this critical cysteine desulfurase suggested
that, similar to SufS and CsdA of E. coli, it might
require an accessory sulfur acceptor protein [25]. The
Slr0077 protein has been found to catalyse cysteine
desulfuration, as well as the conversion of cystine into
pyruvate, via a cystine lyase reaction that does not
require the conserved cysteine residue C372 [25,26].

The genome sequence of the filamentous cyanobacte-
rium Anabaena PCC7120 contains four ORFs, the
products of which (all1457, alr2495, alr3088 and
alr2505) show significant similarities to cysteine desul-
furases [27]. The all1457 (nifS) gene has been reported
to be part of the nif operon, which is devoted to nitro-
gen fixation in this cyanobacterium [28], although, to
date, none of the cysteine desulfurase enzymes have
been characterized functionally. In the present study,
which focused on the activity of Alr2505, it is estab-
lished that this enzyme effectively shows features typi-
cal of cysteine desulfurase. The alr2505 gene is part of
the pkn22 operon, which also encodes the serine ⁄ threo-
nine kinase Pkn22 and the peroxiredoxine PrxQ-A. In
a previous study, it was demonstrated that this operon
contributes importantly to the resistance of Anabaena
to oxidative stress [29,30]. Because alr2505 is the only
cysteine desulfurase-encoding gene induced in res-
ponse to oxidative stress, we named the corresponding
protein oxidative stress-induced cysteine desulfurase
(OsiS).
Results
Alr2505 belongs to the NifS-like protein family
In a previous study, we began to investigate the contri-
bution of the pkn22 operon to the response of Anabae-
na to oxidative stress. The pkn transcriptional unit is
composed of four ORFs: Alr2502, Alr2503, Asr2504
and Alr2505, the expression of which is specifically
induced when Anabaena is exposed to oxidative condi-
tions [30]. We established that Alr2502 (Pkn22) is a

serine ⁄ -threonine kinase that regulates the CP43 ¢ (IsiA)
protein [29], and that Alr2503 (PrxQ-A) is a proxire-
doxin involved in defence against the oxidative stress
by reducing reactive oxygen species [30]. The present
study aimed to establish the function of the Alr2505
protein encoded by the last gene of this operon, which
has been annotated as a putative aminotransferase in
Cyanobase ( />index.html). To further investigate this prediction,
sequence alignment was performed on this protein,
and the results obtained showed that Alr2505 demon-
strates high levels of similarity with group I cysteine
desulfurases, according to the classification of Mihara
and Esaki [16]. Not only the conserved amino acid ele-
ments characteristic of this family of proteins (i.e. the
His-Lys motif required for PLP-cofactor binding and
an essential Cys residue at the active site) [15] are pres-
ent in Alr2505, but also the consensus sequence
around the active site (SSSGSACSS) is of the NifS-
type (Fig. 1B). The 3D structure of OsiS was predicted
using the phyre server [31]. The crystal structure of
IscS [32] was consistently selected as a top candidate,
with an e-value of 2.78 · 10
)43
. The superposition of
OsiS and IscS predicts an overall structure of OsiS
monomer that is highly similar to that of IscS
(Fig. 1A), with a two-domain organization and the
presence of both a-helices and b-strands. On the basis
of these data and the fact that alr2505-expression is
specifically induced under oxidative stress, we nemed

this protein OsiS.
Spectrophotometric properties of OsiS
To confirm the activity of OsiS predicted from the
sequence-alignment data presented above, the osiS
OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al.
3716 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works
gene was overexpressed in the heterologous host
E. coli. Purification of the OsiS protein was difficult
because it tended to aggregate into inclusion bodies.
Because the histidine-tag can influence the solubility
and the folding of the protein in some cases, we also
purified the OsiS protein without any tag, using a
mono-Q purification column. This method of purifica-
tion did not improve the solubility of the protein or
affect its activity; therefore, we continued our investi-
gation using the His-tagged protein. Among the vari-
ous experimental approaches tested, solubilization by
urea was found to be the most efficient method of
purification, and this method was used to obtain the
enzyme followed by removal of urea and refolding.
Pure OsiS showed the characteristic yellow colour
observed in the case of other PLP-containing enzymes,
including all the NifS-like proteins studied to date. UV
visible spectra showed an optimum for A
390
(Fig. 2A),
which is consistent with the presence of PLP associated
with the protein moiety. The addition of 0.1 mm cyste-
ine to the protein sample induced a shift in the major
peak in the range 390–420 nm, which indicates that

some interaction occurred with the cysteine substrate
(Fig. 2A). These spectral changes were not observed
when 0.1 mml-cystine was added instead of l-cyste-
ine. Therefore, tt is unlikely that l-cystine serves as a
substrate of OsiS (data not shown).
OsiS–OsiS interactions
Because all NifS-like proteins are homodimers, we
aimed to assess whether OsiS also shows this feature.
The interactions between OsiS monomers were ana-
lyzed using a bacterial two-hybrid system originally
described by Karimova et al. [33]. This system exploits
the fact that the catalytic domain of adenylate cyclase
C-term
N-term
A
B
A
lr2505 Ana VSSGSACSSTKTAPSHVLTA 342
Slr0387 Syn LSSGSACSSYRTEASHVLYA 339
IscS A.Vin VSSGSACTSASLEPSYVLRA 34
1
IscS E.coli VSSGSACTSASLEPSYVLRA 34
1
IscS V.fis VSSGSACTSASLEPSYVLRA 356
A
tNfsl Ara VSSGSACTSASLEPSYVLRA 262
N
ifs Ana ASSGSACTSGSLEPSHVLRA 337
******:* .*:** *
Fig. 1. Sequence analysis. (A) Prediction of the tertiary structure of

OsiS was performed using the
PHYRE server (.
ac.uk/phyre/) and the results were analyzed and visualized using
UCSF
CHIMERA software ( />html) [53]. The tertiary structure of IscS monomer was predicted
using the
PHYRE server. The two structures were then superposed.
The IscS monomer is shown in red and the OsiS monomer in yellow.
(B) Proteins similar to Anabaena OsiS (alr2505) were aligned using
CLUSTAL W. Alr2505, Anabaena OsiS; Slr0387, Synechocystis PCC6803
(accession number NC_000911.1); IscS, Azotobacter vinelandii
(accession number AAC24472) IscS, E. coli str. K-12 (accession
number AAT48142); IscS Vibrio fischeri (accession number
YP_002155374.1) AtNFSI, Arabidopsis thaliana (accession number
NP_001078802); NifS Anabaena (accession number AAA22006).
Only the region surrounding the catalytic cysteine is shown.
0.21
0.22
0.16
0.17
0.18
0.19
0.2
0.12
0.13
0.14
0.15
Wavelength per nm
300 350 400 450 500
180

80
100
120
140
160
0
20
40
60
T18/T25 OsiS/OsiS
β-Gal activities (MU)
A
B
Fig. 2. Physical characteristics of OsiS. (A) Absorption spectra of
OsiS were recorded before (bold line) and after (discontinued line)
adding 0.1 m
M of L-cysteine. (B) Protein–protein interactions
between OsiS monomers. OsiS–OsiS interactions were detected
using an E. coli two-hybrid approach. OsiS was fused to the T18
and T25 fragments. The T18 ⁄ T25 combination was used as the
negative control. b-Galactosidase activities are expressed in Miller
units (MU). Values shown are the means of three independent
experiments.
M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase
FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3717
of Bordetella pertussis consists of two complementary
fragments, T25 and T18. These fragments are not
active when physically separated. However, if these
fragments are fused to interacting proteins, homo- or
heterodimerization of the resultant hybrid proteins

reconstitutes an active adenylate cyclase. The cAMP–
catabolite activator protein complex can than activate
the transcription of target genes (e.g. those of the lac
operon). Thereby, b-galactosidase activities obtained
during two hybrid reconstitution reflect the dimeriza-
tion of the proteins fused to the T25 and T18 frag-
ments [33]. Two-hybrid reconstitution systems have
been used to assess the dimerization of SufS and CsdA
cysteine desulfurases from E. coli [20,34], as well as
NifS from Rhodobacter capsulatus [3]. The fact that the
b-galactosidase activities, obtained with T15-OsiS and
T28-OsiS, were significantly higher than those of the
negative controls confirmed the specificity of the OsiS–
OsiS interactions (Fig. 2B), strongly suggesting that
OsiS is able to form homodimers.
Cysteine desulfurase activity of OsiS
To determine whether OsiS displays cysteine desulfur-
ase enzymatic activity, its ability to catalyze the
production of alanine from cysteine was tested.
Apparent kinetic parameters were obtained, and the
enzyme showed Michaelis–Menten behaviour (Fig. 3).
The K
m
value was estimated to be approximately
0.057 ± 3.54 mm, and V
max
was 190 ± 5.6 nmol ala-
nineÆmin
)1
Æmg protein

)1
, which is consistent with the
kinetic parameters of SufS-type cysteine desulfurases,
rather than those of IscS [25,35]. When the cysteine
desulfurase activity of OsiS was monitored in the pres-
ence of apoferredoxin and iron, 2.5-fold more alanine
was produced (Table 1). The stimulation of OsiS activ-
ity in the presence of apoferredoxin suggests that OsiS
is able to transfer sulfur to apoferredoxin in vitro.
The three cysteine desulfurases from E. coli have
been found to catalyze abortive transamination reac-
tions, which convert the l-cysteine into pyruvate and
the PLP into pyridoxamine 5¢-phosphate, thus inacti-
vating the enzyme [35]. The production of pyruvate
from cysteine by OsiS was measured and found to be
approximately 32 nmol pyruvateÆmin
)1
Æmg OsiS
)1
.
Pyruvate can also be produced from cysteine by cyste-
ine lyase enzymes via a b-elimination reaction [26].
We therefore wanted to establish whether pyruvate
production by OsiS resulted from a lyase-type reaction.
Accordingly, pyruvate formation catalyzed by OsiS
was measured in the presence of b-chloroalanine,
which is known to inhibit only the desulfurase reac-
tion. Because no pyruvate was produced under these
conditions, it was concluded that OsiS is able to cata-
lyze abortive transamination processes.

Cys329 residue is likely the catalytic residue in
OsiS
The sequence alignment data obtained indicate that
the Cys329 residue is strictly conserved in all NifS-like
proteins. We therefore constructed a mutant of the
OsiS protein (OsiS329S) in which the Cys329 residue
was replaced by a serine residue. This mutant protein
was subsequently purified from E. coli using the same
procedure as that employed for OsiS. OsiSC329S
proved to be unable to sustain any cysteine desulfurase
activity (Table 1), which strongly suggests that Cys329
would be the catalytic residue. The replacement of this
cysteinyl residue with a serine neither affected the spec-
troscopic properties of OsiS, nor abolished its ability
to form dimers (data not shown).
C
y
steine (
µ
M)
Velocity (nmole alanine·min
–1
·mg
–1
OsiS)
160
140
120
100
80

60
40
20
0
0 20 40 60 80 100 120 140 160 180
Fig. 3. Cysteine desulfurase activities of OsiS. Graph showing the
rate-dependency of the reaction on substrate concentrations.
Assays were performed at 37 °Cin25m
M Tris-HCl (pH 7.5),
50 m
M NaCl, 10 mM dithiothreitol in the presence of 1 lM OsiS
and
L-cysteine as the substrate. The production of alanine was
determined as described in the Experimental procedures. The line
gives the best fits generated with
ORIGIN 6.1 software (OriginLab
Corporation Northhampton, MA, USA), based on the equation
V = V
max
[S] ⁄ (K
m
+[S]).
Table 1. Cysteine desulfurase activity of OsiS and OsiS C329S.
Enzyme
Cysteine desulfurase activity (nmol
alanineÆmin
)1
Æmg protein
)1
)

)Apoferredoxin +Apoferredoxin
a
OsiS 123 ± 04 308 ± 06
OsiS C329S 0 Not determined
a
Additional details are provided in the text.
OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al.
3718 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works
Expression and genomic organization of cysteine
desulfurase-encoding genes
In addition to osiS, analysis of the genome of Anabae-
na PCC 7120 [27] reveals the presence of three other
putative nifS-like genes (alr3088, alr1457 and alr2495).
The transcript levels of these four genes in Anabaena
were investigated under either standard growth condi-
tions or oxidative stress. The latter was obtained by
treating the cyanobacterial culture with methyl violo-
gen. As a positive control, we also investigated the
level of expression of the isiA transcript, which was
previously found to be up-regulated under oxidative
stress conditions [36,37]. The transcription of all these
genes was assessed using the semi-quantitative
RT-PCR approach, as described in the Experimental
procedures. The increase observed in the level of isiA
transcript confirmed the establishment of oxidative
stress conditions in the cells under the present experi-
mental conditions (Fig. 4A). In response to methyl
viologen treatment, only alr2505 (osiS) expression was
induced, whereas the weak expression of alr2495 was
constitutive. The all3088 gene encoding a putative

group I cysteine desulfurase was not expressed under
our experimental conditions. Lastly, as expected, the
all1457 (nifS) gene was not expressed under either of
the two conditions tested (Fig. 4A). The nifS gene has
been reported to be part of the nifB operon, the
expression of which occurs only after a DNA-arrange-
ment event induced during heterocyst differentiation
[28]. It has been suggested that the nifB, nifS and nifU
genes, in view of their similarity with the correspond-
ing genes from other diazotrophs, may be involved in
the maturation of nitrogenase [28].
Group 1
all1457
nifS
all1516
fdxN
all1517
nifB
all1456
nifU
alr2505asr2504
alr2495
alr2505
Group 2
alr3088
alr3088
alr2495
sufS
alr2494
sufD

alr2493
sufC
alr2492
sufB
all1457
SufE-likeSufA-likeNifU-like
isiA
rnpB
all1431
alr2385
alr3513
asr1309
alr0692
all4341
030 60
pkn22
prxQ-A
AB
C
Cysteine desulfurase
Ferredoxin
NifB:FeMoco core assembly
Scaffold Energy producing system
A-type carriers
Sulfur acceptor protein
Fig. 4. Expression and genomic organization of cysteine desulfurase-encoding genes. (A) RT-PCR analysis of cysteine desulfurases and
cyst(e)ine lyase genes. RNA was collected from cells grown in BG11 medium (line 0) or in BG11 incubated for 30 min (line 30), or 1 h (line
60) with 50 l
M of methyl viologen. One microgram of RNA was used in each experiment. Samples were collected at the exponential phase
of the PCR. All RT-PCR experiments were repeated twice, and similar results were obtained consistently. Expression of the rnpB gene was

used as the control assay. All the primers used in the experiment were initially checked in PCR reactions with Anabaena genomic DNA as
the template, at the same annealing temperatures as those used in the RT-PCR experiments. (B) Organization of cysteine desulfurase-
encoding genes in Anabaena genome. The classification of the corresponding enzymes is indicated. The ORFs surrounding these genes are
indicated. (C) Anabaena genome search for ORFs relevant to the Fe-S cluster assembly.
M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase
FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3719
In addition to the Nif system, which is specifically
devoted to nitrogenase maturation, two other Fe-S
assembly systems exist in bacteria. The role of these
mechanisms has emerged mainly from studies on
E. coli [38,39]. The ISC system (Fe-S cluster forma-
tion) comprises the housekeeping Fe-S assembly sys-
tem, whereas the SUF (sulfur mobilization) system
appears to be required under oxidative stress or iron
starvation conditions. The three systems (NIF, ISC
and SUF) have in common the involvement of a cyste-
ine desulfurase, a scaffold protein that serves as a con-
struction site for Fe-S clusters before their transfer to
the apoproteins, and an A-type scaffold protein that
serves as a Fe-S cluster carrier [40]. In addition, the
ISC and SUF systems include ATP-hydrolyzing pro-
teins such as the SufBCD complex. This ATPase com-
plex in the SUF system has been shown to have a
scaffold function in E. coli [41].
Among the four cysteine desulfurase genes from
Anabaena, only two are co-localized with genes involved
in sulfur transfer processes: the nifS gene, as explained
above, and the alr2495 (sufS) gene (Fig. 4B). In addi-
tion to the sufS gene, the former cluster includes ORFs
which are similar to the SufBCD proteins. Furthermore,

our bioinformatic analysis on the Anabaena genome
demonstrated the presence of ORFs showing similarities
with the NifU scaffold, the A-type scaffold SufA and
the sulfur acceptor SufE (Fig. 4C). The relevance of this
analysis in terms of OsiS function is discussed below.
IscR maturation in an iscS sufS mutant of E. coli
expressing osiS
To assess whether OsiS could be involved in the bio-
genesis of Fe-S clusters, we investigated whether it
could compensate for the lack of cysteine desulfurase
in E. coli. We used the DV1247 strain (iscS sufS)
mutant that also harbours an iscR::lacZ fusion [42].
IscR is a Fe ⁄ S protein encoded by the first gene of the
isc operon, and it is involved in the transcriptional
regulation of both the isc and the suf operons. In its
holoform, IscR represses the isc operon transcription,
whereas, in its apoform, it acts as an activator of the
suf operon [43,44]. In the iscS mutant, the IscR regula-
tor is not maturated [43] and can hence activate the
suf operon transcription. To avoid a possible effect of
SufS over-expression as a result of the iscS mutation,
we used the double mutant iscS sufS rather than a
simple iscS mutant. The activity of the iscR::lacZ
fusion was assessed in the genetic backgrounds
reported in Fig. 5. As expected, in the absence of the
IscS and SufS cysteine desulfurases, the activity of the
iscR::lacZ fusion was de-repressed compared to
the wild-type context (MG1655 strain). However, when
the expression of the osiS gene was induced from the
pBAD promoter, the fusion showed the same activity

as in the wild-type background. This result suggests
that, when osiS is over-expressed, the maturation of
the IscR repressor occurred sufficiently to allow it to
fulfil its function. Furthermore, the observation that
the effect of OsiS was strictly dependent upon the pres-
ence of arabinose strongly confirms the above conclu-
sion. Because the maturation of IscR might need a
supply of sulfur specifically from IscS (D. Vinella,
unpublished results), we conclude that, in the DV1247
strain, OsiS over-production compensates for the
absence of IscS with respect to IscR maturation.
Discussion
In the present study, the first functional characterization
of a cysteine desulfurase in Anabaena 7120 is presented.
OsiS is encoded by the last gene of the pkn22 operon,
which contributes to the response to oxidative stress, as
previously described [29,30]. OsiS shows all the proper-
ties and features typical of NifS-enzymes: (a) its amino
acid sequence includes the consensus sequence of the
group I cysteine desulfurases; (b) OsiS is a homodimer
and binds to a PLP cofactor; and (c) it catalyzes the
formation of alanine and sulfide, using l-cysteine as a
substrate. The results of site-directed mutagenesis
A
β
β
-Gal activities (MU)
BCD
1400
1200

1000
800
600
400
200
0
Fig. 5. b-galactosidase activities of the IscR::lacZ fusion. The
MG1655 (iscR::lacZ) or the DV1247 strain and its recombinant
derivatives were grown overnight in LB medium as explained in the
Experimental procedures. Cultures were used to inoculate fresh LB
medium supplemented (or not) with arabinose. The b -galactosidase
activities were measured as described in the main text. The data
are the means of values obtained from three independent clones.
The experiment was repeated twice. A, MG1655 (iscR::lacZ);
B, DV1247 ⁄ pBAD24; C, DV1247 ⁄ pBAD24:osiS plus arabinose;
D, DV1247 ⁄ pBAD24:osiS minus arabinose.
OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al.
3720 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works
showed that the cysteine residue C329 is the binding site
of the persulfide intermediate.
The kinetic properties of OsiS indicate that it has a
weak cysteine desulfurase activity. Similar activities
have been reported in the case of cysteine desulfurases
from other organisms. In some cases, it was concluded
that this inefficiency reflects the involvement of an
accessory factor that accepts the sulfur from the
enzyme, and thus enhances its activity. This was found
to be the case, for example, with SufS of E. coli, which
is stimulated by the SufE protein [25,34,35,45]; sufS
and sufE genes belonging to the same operon. The

pkn22 operon lacks a sufE-like gene (Fig. 4B). How-
ever, the Anabaena genome contains a putative ORF
(Alr3513) encoding a protein showing 31% identity
with SufE (Fig. 4C). Whether this SufE-like protein
may act as a sulfur acceptor for OsiS will be the sub-
ject of future studies. The stimulation of the OsiS
activity by the presence of apoferredoxin is consistent
with the suggestion that sulfur transfer to an acceptor
protein may facilitate the turnover of OsiS and
enhance its activity (Table 1).
It is likely that the in vitro catalysis of holoferredox-
in reconstitution in the presence of iron is ability com-
mon to most cysteine desulfurases. This property has
often been considered to reflect the involvement of
these enzymes in the biogenesis of Fe-S clusters.
Indeed, such a conclusion can only be made with great
caution because this in vitro finding simply means that
these enzymes are able to deliver sulfur, and does not
necessarily reveal the nature of the targets to which
the sulfur is transferred. The question remains con-
cerning the role of OsiS in vivo. Because the level of
expression of the osiS gene is undetectable under stan-
dard growth conditions, it can be concluded that OsiS
is not required for housekeeping purposes. The most
likely hypothesis appears to be that this protein con-
tributes to cell defence against oxidative stress. It has
been established that some reactive oxygen species can
react with Fe-S clusters and thus induce their oxida-
tion [46]. The repair and ⁄ or synthesis of damaged Fe-S
clusters under oxidant conditions therefore represents

an important challenge. It is tempting to speculate that
OsiS may contribute to these processes by providing
sulfur, when Anabaena is exposed to an oxidative
threat. The fact that the over-expression of OsiS com-
plements the iscS mutation for the maturation of IscR
confirms this hypothesis. However, OsiS could not res-
cue the auxotrophy of the iscS mutant for thiamine
(data not shown). Whether this result would mean that
OsiS could deliver sulfur only to Fe-S biogenesis path-
ways or also to other sulfur-using biosynthetic path-
ways in Anabaena remains unanswered.
On the basis of the data obtained for the Anabaena
genome presented in Fig. 4, it is tempting to speculate
that the SUF system [alr2492(SufB), alr2493(SufC),
alr2494(SufD), alr2495(SufS)] might be the housekeep-
ing Fe-S assembly system in this cyanobacterium.
Indeed, Anabaena lacks a counterpart of the ISC sys-
tem, and a group 2 cysteine desulfurase was found to
be the essential cysteine desulfurase in Synechcoystis
PCC6803 [25]. Because the alr3088 gene is not
expressed under normal growth conditions (Fig. 4A), it
is likely that its product (a group 1 cysteine desulfur-
ase) may be required under stress or starvation condi-
tions that still remain to be identified. The
characterization of OsiS constitutes the starting point
for the study of the basic mechanisms involving sulfur
transfer in Anabaena, as well as other cyanobacteria in
general because little is known so far about these
mechanisms.
Experimental procedures

Bacterial strains, plasmids and growth conditions
Anabaena sp. PCC 7120 was grown in BG11 medium at 30 °C
in the air under continuous illumination (40 lEÆm
)2
Æs
)1
).
Cyanobacterial growth was monitored by measuring A
750
.
E. coli BL21(DE3) (Novagen, Madison, WI, USA) cells
grown in the LB medium were used to express the cysteine
desulfurase OsiS and its mutant derivative OsiS C329S. The
BHT101 E. coli [33] strain was used for the two-hybrid
analyses. The E. coli DV1247 strain (DlacZ P
iscR
::lacZ Discs
DsufS::kan zdj-925::Tn10 MVA+) [42] was grown in LB
medium supplemented with mevalonate (1 mm), chloramphe-
nicol (25 lgÆmL
)1
) and tetracycline (25 lgÆmL
)1
). Arabinose
(0.2%) and ampicilline (100 lgÆmL
)1
) were added when
required.
The expression of the osiS gene in E. coli strains was per-
formed as following: a DNA fragment corresponding to the

entire coding region of alr2505 was amplified by PCR using
the Osi top primer 5¢-
GAATTCATGTCTAATCGTCCTA-
TATATC-3¢ (EcoRI site underlined) and the Osi bottom
primer 5¢-
GTCGACTACCAAAGTTGCTTGTT-3¢ (SalI
site underlined). The PCR product was cloned into the
pBAD24 plasmid [47]. After DNA sequencing analysis,
recombinant plasmids were introduced in E. coli strains.
osiS expression was induced using arabinose.
Expression and purification of recombinant
proteins
A DNA fragment corresponding to the entire coding region
of alr2505 was amplified by PCR using the Osi forward
primer 5¢-
GAATTCATGTCTAATCGTCCTATATATC-3¢
M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase
FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3721
(EcoRI site underlined) and the Osi reverse primer 5¢-CTC
GAGTACCAAAGTTGCTTGTT-3¢ (XhoI site underlined).
The PCR product was cloned into the pET22 vector
(Novagen). A clone confirmed by DNA sequencing was
grown in ampicillin-supplemented medium until A
600
of
0.3–0.4 was reached, and protein expression was induced by
adding 1 mm isopropyl thio-b-d-galactoside for 4 h. After
sonication, OsiS protein aggregated into inclusion bodies.
Urea solubilization was performed using a final urea-con-
centration of 6 m. The extracts were then dialyzed in a

three-step experiment (3, 1 and 0 m urea) to eliminate urea.
The recombinant proteins were purified using Hitrap
columns in accordance with the manufacturer’s instructions
(Amersham Pharmacia, Piscataway, NJ, USA). Imidazol
was removed from purified proteins using PD10 columns
(Amersham Pharmacia). Proteins were concentrated on
Vivaspin columns (Sartorius, Gottingen, Germany) and
used for subsequent analyses. Proteins were separated by
SDS ⁄ PAGE (12.5% gel) and stained using the SeeBand
procedure (Euromedex, Mundolsheim, France).
Site-directed mutagenesis
The mutation of the cysteine residue at position 329 of OsiS
into a serine residue was performed by PCR using the
megaprimer strategy [48]. The primers used were: forward
mut primer 5¢-
GAATTCATGTCTAATCGTCCTATATA
TCTTGACT-3¢ (EcoRI site underlined), internal mut primer
5¢-TCCGCTTCTTCCTCCA-3¢ and reverse mut primer
5¢-
CTCGAGTACCAAAGTTGCTTGTTT-3¢ ( XhoI site
underlined). The PCR product was cloned into the vector
pET22. Recombinant plasmids were confirmed by DNA
sequencing. The mutant protein was expressed and purified
using the same procedure as for the wild-type protein.
E. coli two-hybrid assays
To fuse the C- and N-terminals of OsiS to adenylate
cyclase, the osiS gene was amplified by PCR using the
primers OsiS-TH forward 5¢-
CTC GAG CTA TAC CAA
AGT TGC TT-3¢ (XhoI site underlined) and OsiS-TH

reverse 5¢-
GAA TTC ATG GTT CAA TTT ATC CCA-3¢
(EcoRI site underlined). The PCR fragments were cloned
into the XhoI and EcoRI sites of vectors pT25-zip and
pT18-zip [33]. BHT101 strain was co-transformed with the
pT18- and pT25-based plasmids and incubated overnight at
30 °C in LB medium supplemented with 1 mm isopropyl
thio-b-d-galactoside. b-galactosidase activity was assayed
and expressed in Miller units [49]. Plasmids pT25 and pT18
were used as negative controls.
Cysteine desulfurase assay
The cysteine desulfurase activity was quantified by deter-
mining the amount of alanine formed from l-cysteine
(Sigma, St Louis, MO, USA). The standard reaction mix-
ture in a final volume of 100 lL was: 25 mm Tris, pH 7.5,
100 mm NaCl, 10 mm dithiothreitol and 100 lm PLP. Final
protein concentrations were 1 lm of OsiS or OsiSC329S.
Reactions were initiated by adding variable concentrations
of l-cysteine (final concentration in the range 0–250 lm)
and allowed to continue for 3 h at 37 °C. Reactions were
stopped by heating the mixtures at 99 °C for 10 min. Dena-
tured proteins were removed by centrifugation, and the
supernatant was analyzed to determine its alanine content
by performing an alanine dehydrogenase assay [50]. The
alanine content of assay mixtures was determined based on
A
340
for NADH (e
340 nm
= 6.2 mm

)1
Æcm
)1
). The cysteine
desulfurase activity is expressed in units corresponding to
nmol alanineÆmin
)1
Æmg protein
)1
.
Pyruvate was measured in 50 mm MOPS ⁄ KOH (pH 8)
using 0.12 lmol NADH and 10 lg of lactate dehydroge-
nase (Sigma) in a final volume of 0.5 mL. Oxidation of
NADH was determined based on the decrease of A
340
.
Apoferredoxin preparation and Fe-S cluster
reconstitution
The Fe-S cluster was incorporated into apoferredoxin using
apoferredoxin from Spinach (Sigma) as substrate. Apoferre-
doxin was obtained from holoferredoxin as described previ-
ously [51]. The reconstitution experiment of the Fe-S
cluster was carried out in 50 mm Tricine–NaOH (pH 7.5)
containing 0.1 mml-cysteine, 2 mm Fe(NH
4
)
2
(SO
4
)

2
,
10 mm dithiothreitol, 0.1 mm PLP, 1 lm apoferredoxin and
1 lm of OsiS cysteine desulfurase. The proteins were han-
dled under anaerobic conditions. Cysteine desulfurase activ-
ity was measured as described above.
Semi-quantitative RT-PCR experiments
RNA was extracted as described previously [29]. One
microgram of RNA was used in each RT-PCR experiment.
Samples were collected at the exponential phase of the
Table 2. Sequences of the primers used in the RT-PCR experiments.
Gene Primers (5¢-to3¢)
rnpB Forward: AGG GAG AGA GTA GGC GTT GC
Reverse: GGT TTA CCG AGC CAG TAC CTC T
isiA Forward: GCC CGC TTC GCC AAT CTC TC
Reverse: CCT GAG TTG TTG CGT CGT TA
alr2495 Forward: AAA ACG GCT GCA GTT CTC A
Reverse: CCC AAT TGC AGG TGT ACC
alr3088 Forward: GTT TTA GTT TCT GTT ATT TAC GGT CAA
Reverse: TTC TCT GTC GCC GGT GGG GAT
alr1457 Forward: AAT ATC GCC GTT AAC TTC GC
Reverse: GCC TTG GTG ACA ATT ATG TA
alr2505 Forward: GTT GCA ACA CAC CAA TTT CG
Reverse: CAA GCA CGG GAA ATT TTA GC
OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al.
3722 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works
PCR. All RT-PCR experiments were repeated three times,
and similar results were obtained consistently. The
sequences of all the primers used in this experiment are
listed in Table 2.

Analytical methods
Protein was assayed as described by Bradford [52], using
BSA as the standard. Absorption spectra were recorded in
a Varian Cary 50 Bio UV-visible spectrophotometer (Var-
ian Inc., Palo Alto, CA, USA). The reaction mixtures con-
tained 5 mgÆmL
)1
OsiS. Equivalent mixtures without OsiS
were used to record the respective baselines.
Acknowledgements
We are grateful to B. Py for valuable discussions. We
thank the members of the Gudicci–Orticoni Labora-
tory for their help with the anaerobic experiments. We
thank Jessica Blanc for revising the English manu-
script. This work was supported by an ‘Environnement
et sante
´
’ grant (AFSSE).
References
1 Heidenreich T, Wollers S, Mendel RR & Bittner F
(2005) Characterization of the NifS-like domain of
ABA3 from Arabidopsis thaliana provides insight into
the mechanism of molybdenum cofactor sulfuration.
J Biol Chem 280, 4213–4218.
2 Marelja Z, Stocklein W, Nimtz M & Leimkuhler S
(2008) A novel role for human Nfs1 in the cytoplasm:
Nfs1 acts as a sulfur donor for MOCS3, a protein
involved in molybdenum cofactor biosynthesis. J Biol
Chem 283, 25178–25185.
3 Neumann M, Stocklein W, Walburger A, Magalon A &

Leimkuhler S (2007) Identification of a Rhodobacter
capsulatus L-cysteine desulfurase that sulfurates the
molybdenum cofactor when bound to XdhC and before
its insertion into xanthine dehydrogenase. Biochemistry
46, 9586–9595.
4 Mihara H, Hidese R, Yamane M, Kurihara T & Esaki
N (2008) The iscS gene deficiency affects the expression
of pyrimidine metabolism genes. Biochem Biophys Res
Commun 372, 407–411.
5 Lauhon CT (2002) Requirement for IscS in biosynthesis
of all thionucleosides in Escherichia coli. J Bacteriol
184, 6820–6829.
6 Leipuviene R, Qian Q & Bjork GR (2004) Formation
of thiolated nucleosides present in tRNA from
Salmonella enterica serovar Typhimurium occurs in two
principally distinct pathways. J Bacteriol 186, 758–766.
7 Mihara H, Kato S, Lacourciere GM, Stadtman TC,
Kennedy RA, Kurihara T, Tokumoto U, Takahashi Y
& Esaki N (2002) The iscS gene is essential for the
biosynthesis of 2-selenouridine in tRNA and the
selenocysteine-containing formate dehydrogenase H.
Proc Natl Acad Sci USA 99, 6679–6683.
8 Muhlenhoff U, Balk J, Richhardt N, Kaiser JT, Sipos
K, Kispal G & Lill R (2004) Functional characteriza-
tion of the eukaryotic cysteine desulfurase Nfs1p from
Saccharomyces cerevisiae. J Biol Chem 279, 36906–
36915.
9 Nakai Y, Umeda N, Suzuki T, Nakai M, Hayashi H,
Watanabe K & Kagamiyama H (2004) Yeast Nfs1p is
involved in thio-modification of both mitochondrial and

cytoplasmic tRNAs. J Biol Chem 279, 12363–12368.
10 Pilon-Smits EA, Garifullina GF, Abdel-Ghany S, Kato
S, Mihara H, Hale KL, Burkhead JL, Esaki N, Kuriha-
ra T & Pilon M (2002) Characterization of a NifS-like
chloroplast protein from Arabidopsis. Implications for
its role in sulfur and selenium metabolism. Plant Physiol
130, 1309–1318.
11 Schwartz CJ, Djaman O, Imlay JA & Kiley PJ (2000)
The cysteine desulfurase, IscS, has a major role in in
vivo Fe-S cluster formation in Escherichia coli. Proc
Natl Acad Sci USA 97, 9009–9014.
12 Tokumoto U & Takahashi Y (2001) Genetic analysis of
the isc operon in Escherichia coli involved in the biogen-
esis of cellular iron-sulfur proteins. J Biochem 130,
63–71.
13 Van Hoewyk D, Abdel-Ghany SE, Cohu CM, Herbert
SK, Kugrens P, Pilon M & Pilon-Smits EA (2007)
Chloroplast iron-sulfur cluster protein maturation
requires the essential cysteine desulfurase CpNifS. Proc
Natl Acad Sci USA
104, 5686–5691.
14 Ye H, Garifullina GF, Abdel-Ghany SE, Zhang L,
Pilon-Smits EA & Pilon M (2005) The chloroplast
NifS-like protein of Arabidopsis thaliana is required for
iron-sulfur cluster formation in ferredoxin. Planta 220,
602–608.
15 Zheng L, White RH, Cash VL, Jack RF & Dean DR
(1993) Cysteine desulfurase activity indicates a role for
NIFS in metallocluster biosynthesis. Proc Natl Acad Sci
USA 90, 2754–2758.

16 Mihara H & Esaki N (2002) Bacterial cysteine desulfu-
rases: their function and mechanisms. Appl Microbiol
Biotechnol 60, 12–23.
17 Zheng L, White RH, Cash VL & Dean DR (1994)
Mechanism for the desulfurization of L-cysteine cata-
lyzed by the nifS gene product. Biochemistry 33, 4714–
4720.
18 Lima CD (2002) Analysis of the E. coli NifS CsdB pro-
tein at 2.0 A reveals the structural basis for perselenide
and persulfide intermediate formation. J Mol Biol 315,
1199–1208.
19 Outten FW, Wood MJ, Munoz FM & Storz G (2003)
The SufE protein and the SufBCD complex enhance
SufS cysteine desulfurase activity as part of a sulfur
M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase
FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3723
transfer pathway for Fe-S cluster assembly in Escheri-
chia coli. J Biol Chem 278, 45713–45719.
20 Loiseau L, Ollagnier-de Choudens S, Lascoux D, Forest
E, Fontecave M & Barras F (2005) Analysis of the
heteromeric CsdA-CsdE cysteine desulfurase, assisting
Fe-S cluster biogenesis in Escherichia coli. J Biol Chem
280, 26760–26769.
21 Jaschkowitz K & Seidler A (2000) Role of a NifS-like
protein from the cyanobacterium Synechocystis PCC
6803 in the maturation of FeS proteins. Biochemistry
39, 3416–3423.
22 Kato S, Mihara H, Kurihara T, Yoshimura T & Esaki
N (2000) Gene cloning, purification, and characteriza-
tion of two cyanobacterial NifS homologs driving iron-

sulfur cluster formation. Biosci Biotechnol Biochem 64,
2412–2419.
23 Behshad E, Parkin SE & Bollinger JM Jr (2004)
Mechanism of cysteine desulfurase Slr0387 from
Synechocystis sp. PCC 6803: kinetic analysis of cleavage
of the persulfide intermediate by chemical reductants.
Biochemistry 43, 12220–12226.
24 Seidler A, Jaschkowitz K & Wollenberg M (2001)
Incorporation of iron-sulphur clusters in membrane-
bound proteins. Biochem Soc Trans 29, 418–421.
25 Tirupati B, Vey JL, Drennan CL & Bollinger JM Jr
(2004) Kinetic and structural characterization of
Slr0077 ⁄ SufS, the essential cysteine desulfurase from
Synechocystis sp. PCC 6803. Biochemistry 43, 12210–
12219.
26 Kessler D (2004) Slr0077 of Synechocystis has cysteine
desulfurase as well as cystine lyase activity. Biochem
Biophys Res Commun 320, 571–577.
27 Kaneko T, Nakamura Y, Wolk CP, Kuritz T,
Sasamoto S, Watanabe A, Iriguchi M, Ishikawa A,
Kawashima K, Kimura T et al. (2001) Complete
genomic sequence of the filamentous nitrogen-fixing
cyanobacterium Anabaena sp. strain PCC 7120. DNA
Res 8, 205–213.
28 Mulligan ME & Haselkorn R (1989) Nitrogen fixation
(nif) genes of the cyanobacterium Anabaena species
strain PCC 7120. The nifB-fdxN-nifS-nifU operon.
J Biol Chem 264, 19200–19207.
29 Xu WL, Jeanjean R, Liu YD & Zhang CC (2003) pkn22
(alr2502) encoding a putative Ser ⁄ Thr kinase in the

cyanobacterium Anabaena sp. PCC 7120 is induced by
both iron starvation and oxidative stress and regulates
the expression of isiA. FEBS Lett 553, 179–182.
30 Latifi A, Ruiz M, Jeanjean R & Zhang CC (2007)
PrxQ-A, a member of the peroxiredoxin Q family, plays
a major role in defense against oxidative stress in the
cyanobacterium Anabaena sp. strain PCC7120. Free
Radic Biol Med 42, 424–431.
31 Kelley LA & Sternberg MJ (2009) Protein structure pre-
diction on the Web: a case study using the Phyre server.
Nat Protoc 4, 363–371.
32 Cupp-Vickery JR, Urbina H & Vickery LE (2003) Crys-
tal structure of IscS, a cysteine desulfurase from Escher-
ichia coli. J Mol Biol 330, 1049–1059.
33 Karimova G, Ullmann A & Ladant D (2000) A bacte-
rial two-hybrid system that exploits a cAMP signaling
cascade in Escherichia coli. Methods Enzymol 328,
59–73.
34 Loiseau L, Ollagnier-de-Choudens S, Nachin L, Fonte-
cave M & Barras F (2003) Biogenesis of Fe-S cluster by
the bacterial Suf system: SufS and SufE form a new
type of cysteine desulfurase. J Biol Chem 278, 38352–
38359.
35 Mihara H, Kurihara T, Yoshimura T & Esaki N (2000)
Kinetic and mutational studies of three NifS homologs
from Escherichia coli: mechanistic difference between
L-cysteine desulfurase and L-selenocysteine lyase
reactions. J Biochem 127, 559–567.
36 Michel KP & Pistorius EK (2004) Adaptation of the
photosynthetic electron transport chain in cyanobacteria

to iron deficiency: the function of IdiA and IsiA.
Physiol Plant 120, 36–50.
37 Latifi A, Jeanjean R, Lemeille S, Havaux M & Zhang
CC (2005) Iron starvation leads to oxidative stress in
Anabaena sp. strain PCC 7120. J Bacteriol 187, 6596–
6598.
38 Fontecave M, Choudens SO, Py B & Barras F (2005)
Mechanisms of iron-sulfur cluster assembly: the SUF
machinery. J Biol Inorg Chem 10, 713–721.
39 Fontecave M & Ollagnier-de-Choudens S (2008)
Iron-sulfur cluster biosynthesis in bacteria: mechanisms
of cluster assembly and transfer. Arch Biochem Biophys
474, 226–237.
40 Vinella D, Brochier-Armanet C, Loiseau L, Talla E &
Barras F (2009) Iron-sulfur (Fe ⁄ S) protein biogenesis:
phylogenomic and genetic studies of A-type carriers.
PLoS Genet 5, e1000497.
41 Layer G, Gaddam SA, Ayala-Castro CN, Ollagnier-de
Choudens S, Lascoux D, Fontecave M & Outten FW
(2007) SufE transfers sulfur from SufS to SufB for
iron-sulfur cluster assembly. J Biol Chem 282, 13342–
13350.
42 Trotter V, Vinella D, Loiseau L, Ollagnier de Choudens
S, Fontecave M & Barras F (2009) The CsdA cysteine
desulphurase promotes Fe ⁄ S biogenesis by recruiting
Suf components and participates to a new sulphur
transfer pathway by recruiting CsdL (ex-YgdL),
a ubiquitin-modifying-like protein. Mol Microbiol 74,
1527–1542.
43 Schwartz CJ, Giel JL, Patschkowski T, Luther C,

Ruzicka FJ, Beinert H & Kiley PJ (2001) IscR, an Fe-S
cluster-containing transcription factor, represses expression
of Escherichia coli genes encoding Fe-S cluster assembly
proteins. Proc Natl Acad Sci USA 98, 14895–14900.
44 Yeo WS, Lee JH, Lee KC & Roe JH (2006) IscR acts
as an activator in response to oxidative stress for the
OsiS: oxidative stress-induced cysteine desulfurase M. Ruiz et al.
3724 FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works
suf operon encoding Fe-S assembly proteins. Mol
Microbiol 61, 206–218.
45 Mihara H, Kurihara T, Yoshimura T, Soda K & Esaki
N (1997) Cysteine sulfinate desulfinase, a NIFS-like
protein of Escherichia coli with selenocysteine lyase and
cysteine desulfurase activities. Gene cloning, purifica-
tion, and characterization of a novel pyridoxal enzyme.
J Biol Chem 272, 22417–22424.
46 Imlay JA (2003) Pathways of oxidative damage. Annu
Rev Microbiol 57, 395–418.
47 Guzman LM, Belin D, Carson MJ & Beckwith J (1995)
Tight regulation, modulation, and high-level expression
by vectors containing the arabinose PBAD promoter. J
Bacteriol 177, 4121–4130.
48 Wu W, Jia Z, Liu P, Xie Z & Wei Q (2005) A novel
PCR strategy for high-efficiency, automated site-direc-
ted mutagenesis. Nucleic Acids Res 33, e110.
49 Miller JH (1972) Experiments in Molecular Genetics.
Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
50 Yoshida A & Freese E (1975) Lactate dehydrogenase
from Bacillus subtilis. Methods Enzymol 41, 304–309.

51 Moulis JM & Meyer J (1982) Characterization of the
selenium-substituted 2 [4Fe-4Se] ferredoxin from
Clostridium pasteurianum. Biochemistry 21, 4762–4771.
52 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein uti-
lizing the principle of protein-dye binding. Anal Bio-
chem 72, 248–254.
53 Pettersen EF, Goddard TD, Huang CC, Couch GS,
Greenblatt DM, Meng EC & Ferrin TE (2004) UCSF
Chimera – a visualization system for exploratory
research and analysis. J Comput Chem 25, 1605–1612.
M. Ruiz et al. OsiS: oxidative stress-induced cysteine desulfurase
FEBS Journal 277 (2010) 3715–3725 Journal compilation ª 2010 FEBS. No claim to original French government works 3725