Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

The miRNA-192
⁄
194 cluster regulates the Period gene
family and the circadian clock
Remco Nagel
1
, Linda Clijsters
1
and Reuven Agami
1,2
1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands
2 Center for Biomedical Genetics, The Netherlands
Introduction
Daily oscillations of physiological and behavioural
processes can be observed in diverse organisms, rang-
ing from the filamentous fungus Neurospora crassa to
humans. The oscillating rhythms are driven by an
internal timing mechanism called the circadian clock.
In mammals, the circadian system is organized as a
hierarchical network of molecular clocks that operate
in different tissues, with the master clock residing in
the suprachiasmatic nucleus (SCN) in the hypothala-
mus. The master clock itself is synchronized by means
of external cues from the daily light ⁄ dark cycles, and
transmits information regarding its phase to multiple
tissue-specific clocks [1]. The molecular machinery
underlying the circadian rhythm, which is present in
each individual cell, is thought to be composed of self-
sustaining transcriptional feedback loops. The core of
the molecular pathway regulating circadian oscillations
is the CLOCK ⁄ BMAL1 complex [2,3]. This hetero-

dimeric complex functions as a transcription factor
that is able to induce the expression of circadian out-
put genes, also called clock-controlled genes (CCGs),
via E-box enhancer elements in their promoters [4].
Amongst the CCGs are also the negative regulators of
CLOCK ⁄ BMAL1, the family of Period genes (Per1,
Per2 and Per3), the Cryptochromes (Cry1 and Cry2)
and Rev-Erb a [3,5,6]. Rev-Erba binds the BMAL1
promoter directly to inhibit BMAL1 transcription,
resulting in reduced CLOCK ⁄ BMAL1 levels and
decreased CCG expression [7]. This mode of repression
leads to the cycling of BMAL1 mRNA levels in an
anti-phase fashion to that of the CCGs. When the
other negative regulators of BMAL1, the Per and Cry
proteins, are at their peak levels in the nucleus, they
function in complexes to suppress E-box-dependent
gene activation [5]. In this way, the molecular circa-
dian clock is reset and a new cycle can be started.
In addition to transcriptional regulation, several
studies have shown that post-transcriptional processes
Keywords
circadian clock; miRNA-192; miRNA-194;
Period gene family
Correspondence
R. Agami, Division of Gene Regulation, The
Netherlands Cancer Institute, Plesmanlaan
121, 1066CX, Amsterdam, The Netherlands
Fax: +31(0)20 512 1999
Tel: +31(0)20 512 2079
E-mail:

(Received 17 June 2009, revised 15 July
2009, accepted 22 July 2009)
doi:10.1111/j.1742-4658.2009.07229.x
Several biological functions in mammals are regulated in a circadian fash-
ion. The molecular mechanisms orchestrating these circadian rhythms have
been unravelled. The biological clock, with its core transcriptional unit
Bmal1 ⁄ CLOCK, is composed of several self-sustaining feedback loops. In
this study, we describe another mechanism impinging on the core compo-
nents of the circadian clock. Using a forward genetic screen, we identified
the miR-192 ⁄ 194 cluster as a potent inhibitor of the entire Period gene
family. In accordance, the exogenous expression of miR-192 ⁄ 194 leads to
an altered circadian rhythm. Thus, our results have uncovered a new mech-
anism for the control of the circadian clock at the post-transcriptional
level.
Abbreviations
CCG, clock-controlled gene; Cry, Cryptochrome; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein;
miRNA, microRNA; Per, Period; SCN, suprachiasmatic nucleus.
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5447
are of major importance in the control of the circadian
clock. The phosphorylation and degradation of Per
proteins have been suggested to control timing of the
mammalian clock [8]. Moreover, BMAL1 and Cry
proteins are subject to phosphorylation, SUMOylation
and proteasomal degradation, thereby controlling their
activity at the post-transcriptional level [9–11].
Recently, a new class of post-transcriptional regula-
tors, called microRNAs (miRNAs), has been shown to
possess regulatory functions towards the circadian
clock. miRNAs are single-stranded, nonprotein-coding
RNA molecules, approximately 19–25 nucleotides in

length. By binding to the complementary sites in the
3¢UTRs of their target genes, they can induce transla-
tional inhibition or mRNA decay. miRNAs have been
shown to be involved in many cellular processes,
including the control of the circadian clock [12]. In a
comprehensive study, Cheng et al. [12] showed that
miR-132 and miR-219 are expressed rhythmically in
the SCN and are bona fide CCGs. Interestingly, miR-
219 was shown to fine tune the length of the circadian
period in mice, whereas miR-132 was suggested to be a
negative regulator of the light-dependent resetting of
the clock itself.
In this study, we have uncovered a role for a cluster
of miRNAs in the control of core components of the
circadian clock. Using a forward genetic screen to dis-
cover miRNAs with regulatory capacities towards the
3¢UTRs of all the Per family members (Per1, Per2 and
Per3), we identified an miRNA cluster containing
miR-192 and miR-194 (miR-192 ⁄ 194) as powerful reg-
ulators. The strong expression level of this cluster
potently inhibits the synthesis of all three Per mem-
bers, resulting in an altered circadian rhythm.
Results
miR-192 and miR-194 target all three Per genes
In order to identify miRNA regulators of the Per gene
family members, Per1, Per2 and Per3, we cloned their
respective 3¢UTRs downstream of a green fluorescent
protein (GFP) coding sequence in a sensor vector
described previously [13,14]. The constructed vectors
were delivered retrovirally to HeLa cells, after which

single clones with a defined level of GFP expression
were isolated. The constructed cell lines were subse-
quently transduced with a microRNA expression
library (miR-Lib; [13]) in a single-well format, drug
selected and pooled. To identify possible regulatory
miRNAs towards the inserted 3¢UTRs, the three pools
of cells containing one unique GFP reporter were fluo-
rescence-activated cell sorted on their GFP expression
levels. The relative abundance of miRNA inserts
between the low-GFP-expressing population and the
total population was measured by a barcode-type anal-
ysis using our miRNA arrays. We observed in the
resulting M–A plots that only a few miRNAs were
reproducibly enriched in the low-GFP-expressing pop-
ulation (Fig. 1A–C). The most striking observation
was that the most highly enriched miRNA expression
vector (miR-Vec) for all three individual 3¢UTRs
was the vector encoding the miR-192 ⁄ 194 cluster
(Fig. 1A–F).
To confirm that the obtained hits from the GFP
UTR screens indeed have regulatory capacities against
the 3¢UTR of the Per genes, we retested their effects
on the original HeLa cell line expressing the GFP sen-
sor constructs. We observed that miR-192 ⁄ 194 inhib-
ited GFP expression of all the sensor constructs,
whereas all the other obtained hits could not signifi-
cantly downregulate any of the GFP-Per sensors
(Fig. 2A–C and data not shown). To exclude the possi-
bility that miR-192 ⁄ 194 regulates a common sequence
in the GFP sensor construct, we subcloned the 3¢UTR

of Per1–3 into a luciferase vector. In addition, these
vectors were reduced by about 30% in comparison
with the control, indicating that the sequences regu-
lated by miR-192 ⁄ 194 indeed reside in the 3¢UTRs of
the Per1–3 genes (Fig. 2D).
A close examination of the 3¢UTR of the Per genes
by TargetScanHuman 5.0 [15] revealed that all of these
sequences harbour putative target sites for miR-192 or
miR-194. Whereas the Per1 3¢UTR contains one
predicted target site for miR-194, Per2 has a site for
miR-192 as well as miR-194, and Per3 harbours one
putative site for miR-192 and two for miR-194
(Fig. 3A). As predicted, all of these target sites are well
conserved between mammalian species, implying a pos-
sible common regulatory mechanism. To show that the
miR-192 ⁄ 194 cluster indeed regulates the 3¢UTRs of
the Per genes via these predicted target sites, we
mutated all of these sequences. In transient transfec-
tion experiments, these mutated 3¢UTRs were com-
pletely refractory to regulation by the miR-192 ⁄ 194
cluster, indicating the direct suppression of Per1, 2 and
3 by these miRNAs (Fig. 3B–D). Together, these data
indicate that the miR-192 ⁄ 194 cluster is a potent and
direct regulator of the Per gene family.
Endogenously expressed miR-192
⁄
194 represses
Per
As it has been reported previously that miR-192 ⁄ 194 is
highly expressed in colorectal cancer cell lines and

tumours [16], we attempted to exploit these cells to
Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al.
5448 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS
determine the endogenous role of miR-192 ⁄ 194. The
examination of 12 colorectal cell lines indicated a het-
erogeneous level of miR-192 ⁄ 194, ranging from very
low in HCT116, Colo320 and SW48 cells, to high in
LOVO, HT29 and LS174T cells (Fig. S1, see Support-
ing information). We made use of the different Per
luciferase 3¢UTR constructs to detect miR-192 ⁄ 194
activity. In transient transfection assays with these con-
structs containing wild-type and mutant Per 3¢UTRs,
we observed reduced expression of all three wild-type
3¢UTRs only in cell lines with strong expression of
endogenous miR-192 ⁄ 194 (LOVO, HT29, Fig. 4A). In
HCT116 cells, which do not express miR-192 ⁄ 194, no
such difference between wild-type and mutant 3¢UTRs
was observed. This result indicates that miR-192 ⁄ 194
expression is a prominent determinant for Per 3¢UTR
regulation in these cells. To explore this further, we
transfected anti-miR RNA oligos targeting miR-
192 ⁄ 194 or a control miRNA, miRNA-372. Whereas
the transfection of anti-miR-192 ⁄ 194 completely abol-
ished the miR-192 ⁄ 194-dependent regulation of Per1
3¢UTR in HT29 cells, transfection of the control anti-
miR left it intact (Fig. 4B). Together, these results
show that endogenously expressed miR-192 ⁄ 194 also
suppresses the synthesis of Per proteins.
miR-192
⁄

194 overexpression alters the circadian
rhythm
Deregulation of Per genes in mice has been shown to
reduce the length of the circadian period. As the
downregulation of all three Per genes by miR-192 ⁄ 194
could potentially have a similar effect on period
length, we overexpressed the miR-192 ⁄ 194 cluster in
NIH3T3 cells to identify its effect on the circadian
cycle. In NIH3T3 cells, miR-192 and miR-194 are
almost undetectable (Fig. 5A). As expected, the intro-
duction of miR-Vec-192 ⁄ 194 in these cells resulted in a
strong expression level of both miRNAs (Fig. 5A).
This level of expression, however, was comparable
with endogenous miR-192 ⁄ 194 observed in human
colorectal cell lines (Fig. 5B).
AD
BE
CF
Fig. 1. Identification of miR192 ⁄ 194 regula-
tory capacities towards the Per gene family
using a forward genetic screen. (A–C)
Representative M–A plots of the Per1, Per2
and Per3 screens, respectively. Each graph
shows the relative abundance of each indi-
vidual miRNA insert in the low and total
GFP populations. The top outlier (miR-Vec-
192–194 cluster) is encircled. (D–F) Tables
showing the top five miRNA outliers, which
are more abundant in the low-GFP popula-
tion from a duplicate screen on the Per1,

Per2 and Per3 3¢UTRs, respectively.
R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5449
Subsequently, we made use of the engineered
NIH3T3 cells expressing miR-192 ⁄ 194 to determine
the effects on the circadian cycle by monitoring
BMAL1 mRNA levels. As described previously, levels
of BMAL1 mRNA oscillate in a circadian fashion in
time following serum shock. Examination of BMAL1
mRNA oscillation over a time course of 64 h revealed
A
B
C
D
*
*
*
Fig. 2. Validation of the effect of miR-192 ⁄ 4 on the Per 3¢UTRs.
(A–C) Verification of the effect of miR-192 ⁄ 194 on GFP expression in
HeLa-GFP-UTR constructs of Per1, Per2 and Per3 3¢UTRs, res-
pectively. Graphs depicting the GFP expression of the control and
miR-Vec-192 ⁄ 4 are shown in different colours. (D) Luciferase assay
showing the effect of miR-192 ⁄ 194 expression on luciferase con-
structs coupled to the Per 3¢UTRs. Values represent a triplicate
assay, in which the data are represented as the standardized
mean ± standard error of the mean (SEM). *Significant difference
when compared with the control (P < 0.01), as determined by a two-
tailed t-test. All experiments are representative of a triplicate repeat.
*
*

*
A
B
C
D
Fig. 3. Mutational analysis of Per 3¢UTRs shows direct regulation
by miR-192 ⁄ 194. (A) Schematic representation of the 3¢UTR of the
Per genes. The different target sites for miR-192 ⁄ 194 are indicated.
(B–D) Dual luciferase assay showing the effect of miR-192 ⁄ 194 on
the 3¢UTRs of Per1, 2 and 3, respectively, in both the wild-type and
mutated form. Values represent a triplicate assay, in which the data
are represented as the standardized mean ± standard error of the
mean (SEM). *Significant difference when compared with the
control (P < 0.01), as determined by a two-tailed t-test.
Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al.
5450 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS
a reproducible alteration of the circadian rhythm in
cells expressing miR-192 ⁄ 194 compared with control
cells. (Figs 5C, S2, see Supporting information). These
data suggest that the expression of miR-192 ⁄ 194 short-
ens the length of the circadian period in a cellular
system through the simultaneous inhibition of all
Per genes.
Discussion
Using a target-based screening technique, we have
uncovered a new method of regulation of core compo-
nents of the circadian clock. We identified the miR-
192 ⁄ 194 cluster as a potent regulator of the entire Per
gene family, which consists of Per1, Per2 and Per3.
This finding depicts a direct regulation of core compo-

nents of the circadian clock. Strikingly, exogenous
overexpression of miR-192 ⁄ 194 leads to an altered
circadian cycle.
miRNAs and the circadian clock
Since the discovery of the molecular mechanism regu-
lating circadian rhythms, it has been recognized that
tight transcriptional control is essential for correct cir-
cadian cycling [17]. Recently, post-transcriptional
events have also been implicated in the control of the
circadian clock [8–11]. Not surprisingly, miRNAs have
also been shown to possess regulatory capacities on
the circadian rhythm [12]. It has been suggested that
miR-219 and miR-132 are capable of shortening the
circadian period and negatively regulating the light-
dependent resetting of the clock, respectively [12].
However, amongst the target genes suggested for these
two miRNAs, which are regulated in a circadian fash-
ion, no core components of the circadian clock were
found. This suggests that these miRNAs affect the cir-
cadian clock via indirect mechanisms. The identifica-
tion of the miR-192 ⁄ 194 cluster as a potent regulator
of the Per gene family, however, shows that the core
clock proteins are also under post-transcriptional
control exerted by miRNAs.
miRNAs and the circadian cycle
miR-219 is capable of shortening the circadian period
by 10–20 min [12]. The exact mechanism by which
this miRNA is able to alter the circadian period,
however, still remains to be examined. In addition to
this, the data presented here show that miR-192 ⁄ 194

expression also affects the circadian cycle, potentially
through the downregulation of the entire Per gene
family. Additional quantitative experiments on the
observed alteration of the circadian rhythm need to
show whether this effect is caused by a shortening
of the circadian period length or by a phase shift
phenotype.
At present, we cannot exclude the possibility that
miR-192 ⁄ 194 has additional targets other than the Per
genes that assist in the regulation of the circadian
clock. However, the alteration of the circadian rhythm
seems to be in good agreement with the effects of
knockout studies of the individual Per family members
in mice. Knockout of Per1, Per2 and Per3 in mice
leads to a shortening in circadian period of about 1,
1.5 and 0.5 h, respectively [18–20]. Our results suggest
that partial inhibition of all Per genes by miR-192 ⁄ 194
may achieve a similar effect on the circadian clock as
the complete loss of individual Per genes.
P < 0.01
A
B
Fig. 4. The effect of endogenously expressed miR-192 ⁄ 194 on Per
genes. (A) Luciferase assay showing the relative expression of
luciferase genes coupled to the Per 3¢UTRs in different cell lines.
Values represent a triplicate assay, in which the data are repre-
sented as the standardized mean ± standard error of the mean
(SEM). HCT116 cells express low levels of miR-192 ⁄ 194, whereas
LOVO and HT29 cells express high levels of this miRNA cluster.
(B) Dual luciferase assay showing the effect of inhibition of miR-

192 ⁄ 194 in cells endogenously expressing this miRNA cluster
(HT29) in comparison with control cells. Values represent a tripli-
cate assay, in which the data are represented as the standardized
mean ± SEM.
R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5451
Regulation of the miR-192
⁄
194 cluster
It has been reported that miRNA-192 and miR-194
can be induced by several factors, such as hepatocyte
nuclear factor-1a and p53 [21–23]. This suggests that
different cellular processes might affect the circadian
clock, for example genotoxic stresses that activate p53.
It has been proposed that the expression of most
CCGs peaks just before dawn and appears to prepare
for the stress caused by daily sun exposure [24]. Specu-
lating on this, the induction of miR-192 ⁄ 194 by acti-
vated p53 might be a means for cells to adjust the
circadian time to the level of radiation they encounter.
The observation that miR-192 and miR-194 are both
highly expressed in liver and kidney implies that these
miRNAs play a role in both of these tissues [25,26].
Interestingly, both of these tissues have been suggested
to be the only ones that are able to maintain circadian
rhythms of clock gene expression in the absence of a
functional SCN [27]. Therefore, it would be interesting
to determine the exact role of miR-192 ⁄ 194 in these
tissues. Together, the identification of inhibitory
miRNAs for the Per genes adds more complexity to

the mode of regulation of core components of the
circadian clock and the clock itself.
Experimental procedures
Cell culture
HeLa, NIH3T3, CaCo2, Colo205, Colo320, DLD1,
HCT116, HCT15, HT29, LOVO, LS174T, SW48, SW480,
WiDr and EcoPack cells were cultured in Dulbecco’s modi-
fied Eagle’s medium supplemented with 10% fetal bovine
serum and antibiotics. The serum shock to induce circadian
cycling of NIH3T3 cells was carried out as described previ-
ously [28]. In short, approximately 5 · 10
5
cells were plated
in a six-well plate, which was left for 3 days in normal med-
ium. Subsequently, the medium was replaced with medium
containing 1% serum for 2 days. At time 0, the medium
A
B
C
Fig. 5. The effect of altered miR-192 ⁄ 194 expression on the circadian cycle. (A) Relative expression of miR-192 ⁄ 194 in NIH3T3 cells stably
transduced with miR-Vec-192 ⁄ 4, as determined by quantitative PCR. (B) Comparison of the miRNA levels in a set of colorectal cell lines and
NIH3T3 cells overexpressing miR-192 ⁄ 194. NIH3T3) is the control cell line and NIH3T3+ indicates the cells overexpressing miR-192 ⁄ 194.
(C) Graph showing the periodicity of Bmal1 mRNA levels in NIH3T3 cells with high levels of miR-192 ⁄ 194 and control cells, as determined
by quantitative PCR. All data here represent triplicate PCRs, in which the data are represented as the standardized mean. The graph shown
is a representative experiment from a duplicate repeat.
Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al.
5452 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS
was exchanged for medium containing 50% horse serum.
After 2 h, this medium was replaced with serum-free
medium and the cells were harvested at the indicated time

points.
Constructs
GFP-Per1-3¢UTR, GFP-Per2-3¢UTR and GFP-Per3-3¢UTR
were constructed by cloning the 3¢UTR of the respective
Per genes between Eco RI and BamHI restriction sites of
the GFP sensor vector, as described in [13]. The 3¢UTRs of
Per1, 2 and 3 were amplified from genomic DNA using the
following primers: Per1 forw, GAATTCTTAAACTCC
ATTCTGGGACCATCTCC; Per1 rev, AGATCTGGCGT
TTTTATCTTTTTGTATT; Per2 forw, GAATTCTTAAC
AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GGA
TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw,
GAATTCTTAAGTGACTGTGAGGATGAACCTTC; Per3
rev, GGATCCTCACGTTTTACATGTACAGAGTTTA.
Luc-Per1-3¢UTR, Luc-Per2-3¢UTR and Luc-Per3-3¢UTR
were produced by subcloning of the 3¢UTR of Per into the
pGL3 vector (Promega) downstream of the luciferase gene
by means of PCR. The primers used for this PCR were as
follows: Per1 forw, GCGACGTCTTAAACTCCATTC
TGGGACCATCTCC; Per1 rev, GCACCGGTGGCGTTT
TTATCTTTTTGTATT; Per2 forw, GCGACGTCTTAAC
AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GCAC
CGGTGGCAAACAGGTCATAAAAAGACAC; Per3 fo-
rw, GCGACGTCTTAAGTGACTGTGAGGATGAAC
CTTC; Per3 rev, GCACCGGTTCACGTTTTACATGTA
CAGAGTTTA. Mutants of the Per 3¢UTR luciferase
reporters were constructed using the QuickChangeÒ Multi
Site-Directed Mutagenesis Kit (Stratagene), according to
the manufacturer’s protocol. Luc-Per1-3¢UTR-Mut was cre-
ated using the following primer: GGCGTTTTTATCT

TTTTGTATTAAAAAAGTAGGGATCCACACAAATAT
CAAAAACACAA. The two mutations in Luc-Per2-
3¢UTR-Mut were established using the following primers:
GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAA
CAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and
GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTT
GGACACTTGGGGAAAAGTGAGG. Luc-Per3-3¢UTR-
Mut contains three mutated target sites which were gener-
ated using the following primers: GGATGAACCTTCA
TACCCTTTCCAAGACGAAAACAACAGACAGACCTT
TTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCT
CATTTATTTTGTTCAAAACAATAAGTCATTTTCCCC
TTAGAGTGCTTGAAGAA and CATGAATGTTACCC
AAAAAGCTGTGTTTTCTTTGGTCAGCAAAACAAAT
TTATGAAAAACAAAATGCTGTATGAATGGAAATCA.
Luciferase assay
Luciferase assays were performed using HeLa cells, which
were transfected using Fugene (Roche). For Luc-Per-
3¢UTR reporter assays, cells were cultured in 24-well
plates and transfected with 5 ng of Luc-Per-3¢UTR (or
mutant constructs), 5 ng of Renilla and 0.5 lg of miR-
Vec-192 ⁄ 4.
The colorectal cell lines were transfected in the same
manner as described for HeLa cells, except that Lipofecta-
min2000 (Invitrogen) was used as transfection reagent. The
anti-miRs were transfected in an amount of 0.5 lg for a
24-well plate. The anti-miR sequences used were as follows:
control, Chl-CGGUGACGCUCAAAUGUCGCAGCAC
UUUCCACU; anti-miR-192, Chl-GCACUGGCUGU
CAAUUCAUAGGUCAGAGCCC; anti-miR-194, Chl-

GACAGUCCACAUGGAGUUGCUGUUACACUUGA.
For these experiments, 10–20 ng of Luc-Per-3¢UTR (or
mutant constructs) and 2.5 ng of Renilla were used.
Flow cytometry
The separation of low-GFP-expressing miR-Lib-containing
cells was performed by cell sorting using the FACSAria cell
sorter from Becton Dickinson. The validation of miRNA
hits was performed as described previously, using HeLa
cells stably expressing GFP-Per-3¢UTR [13].
Quantitative RT-PCR and real-time TaqMan PCR
Total RNA was extracted from cell lines using TRIzol
reagent, according to the manufacturer’s protocol. The syn-
thesis of cDNA with Superscript III reverse transcriptase
(Invitrogen) was primed with random hexamers. The prim-
ers used for the detection of Bmal1 levels (Fwd,
GGCCGAATGATTGCTGAGGAAATCATGG; Rev,
TTACAGCGGCCATGGCAAGTCACTAAAG) and glyc-
eraldehyde-3-phosphate dehydrogenase (GAPDH) (Fwd,
CATCCACTGGTGCTGCCAAGGCTGT; Rev, ACAACC
TGGTCCTCAGTGTAGCCCA) were designed to amplify
100–200 bp fragments. Analyses were carried out using
SYBR Green PCR Master Mix (Applied Biosystems) and
the ABI Prism 7000 system (Amersham-Pharmacia). The
results were normalized with respect to GAPDH expres-
sion. The mRNA levels were quantified according to the
DDCt method.
TaqManÒ microRNA assays (Applied Biosystems),
which include RT primers and TaqMan probes, were
used to quantify the expression of mature miRNA-192
(AB: 4373108) and miRNA-194 (AB: 4373106). Gene

expression was calculated relative to 18S rRNA (AB:
4333760F).
Acknowledgements
This work was supported by the Dutch Cancer Society
(KWF), the European Young Investigator Programme
and the Centre of Biomedical Genetics (CBG).
R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5453
References
1 Schibler U & Sassone-Corsi P (2002) A web of circa-
dian pacemakers. Cell 111, 919–922.
2 Gekakis N, Staknis D, Nguyen HB, Davis FC,
Wilsbacher LD, King DP, Takahashi JS & Weitz CJ
(1998) Role of the CLOCK protein in the mammalian
circadian mechanism. Science 280, 1564–1569.
3 Rutila JE, Suri V, Le M, So WV, Rosbash M & Hall
JC (1998) CYCLE is a second bHLH-PAS clock pro-
tein essential for circadian rhythmicity and transcription
of Drosophila period and timeless. Cell 93, 805–814.
4 Ripperger JA & Schibler U (2006) Rhythmic CLOCK-
BMAL1 binding to multiple E-box motifs drives circa-
dian Dbp transcription and chromatin transitions. Nat
Genet 38, 369–374.
5 Darlington TK, Wager-Smith K, Ceriani MF, Staknis
D, Gekakis N, Steeves TD, Weitz CJ, Takahashi JS &
Kay SA (1998) Closing the circadian loop: CLOCK-
induced transcription of its own inhibitors per and tim.
Science 280, 1599–1603.
6 Zylka MJ, Shearman LP, Weaver DR & Reppert SM
(1998) Three period homologs in mammals: differential

light responses in the suprachiasmatic circadian clock
and oscillating transcripts outside of brain. Neuron 20,
1103–1110.
7 Preitner N, Damiola F, Lopez-Molina L, Zakany J,
Duboule D, Albrecht U & Schibler U (2002) The
orphan nuclear receptor REV-ERBalpha controls
circadian transcription within the positive limb of the
mammalian circadian oscillator. Cell 110, 251–260.
8 Toh KL, Jones CR, He Y, Eide EJ, Hinz WA, Virshup
DM, Ptacek LJ & Fu YH (2001) An hPer2 phosphory-
lation site mutation in familial advanced sleep phase
syndrome. Science 291, 1040–1043.
9 Eide EJ, Vielhaber EL, Hinz WA & Virshup DM
(2002) The circadian regulatory proteins BMAL1 and
cryptochromes are substrates of casein kinase Iepsilon.
J Biol Chem 277, 17248–17254.
10 Siepka SM, Yoo SH, Park J, Song W, Kumar V, Hu
Y, Lee C & Takahashi JS (2007) Circadian mutant
Overtime reveals F-box protein FBXL3 regulation of
cryptochrome and period gene expression. Cell 129,
1011–1023.
11 Cardone L, Hirayama J, Giordano F, Tamaru T,
Palvimo JJ & Sassone-Corsi P (2005) Circadian clock
control by SUMOylation of BMAL1. Science 309,
1390–1394.
12 Cheng HY, Papp JW, Varlamova O, Dziema H, Russell
B, Curfman JP, Nakazawa T, Shimizu K, Okamura H,
Impey S et al. (2007) microRNA modulation of circa-
dian-clock period and entrainment. Neuron 54, 813–829.
13 le Sage C, Nagel R, Egan DA, Schrier M, Mesman E,

Mangiola A, Anile C, Maira G, Mercatelli N, Ciafre
SA et al. (2007) Regulation of the p27(Kip1) tumor
suppressor by miR-221 and miR-222 promotes cancer
cell proliferation. EMBO J 26, 3699–3708.
14 Nagel R, le Sage C, Diosdado B, van der Waal M,
Oude Vrielink JA, Bolijn A, Meijer GA & Agami R
(2008) Regulation of the adenomatous polyposis coli
gene by the miR-135 family in colorectal cancer. Cancer
Res 68, 5795–5802.
15 Grimson A, Farh KK, Johnston WK, Garrett-Engele P,
Lim LP & Bartel DP (2007) MicroRNA targeting speci-
ficity in mammals: determinants beyond seed pairing.
Mol Cell 27, 91–105.
16 Bandres E, Cubedo E, Agirre X, Malumbres R, Zarate
R, Ramirez N, Abajo A, Navarro A, Moreno I, Monzo
M et al. (2006) Identification by real-time PCR of 13
mature microRNAs differentially expressed in colorectal
cancer and non-tumoral tissues. Mol Cancer 5, 29.
17 Loros JJ & Dunlap JC (1991) Neurospora crassa
clock-
controlled genes are regulated at the level of transcrip-
tion. Mol Cell Biol 11, 558–563.
18 Zheng B, Larkin DW, Albrecht U, Sun ZS, Sage M,
Eichele G, Lee CC & Bradley A (1999) The mPer2 gene
encodes a functional component of the mammalian
circadian clock. Nature 400, 169–173.
19 Zheng B, Albrecht U, Kaasik K, Sage M, Lu W, Vaish-
nav S, Li Q, Sun ZS, Eichele G, Bradley A et al. (2001)
Nonredundant roles of the mPer1 and mPer2 genes in
the mammalian circadian clock. Cell 105, 683–694.

20 Shearman LP, Jin X, Lee C, Reppert SM & Weaver
DR (2000) Targeted disruption of the mPer3 gene: sub-
tle effects on circadian clock function. Mol Cell Biol 20,
6269–6275.
21 Hino K, Tsuchiya K, Fukao T, Kiga K, Okamoto R,
Kanai T & Watanabe M (2008) Inducible expression of
microRNA-194 is regulated by HNF-1alpha during
intestinal epithelial cell differentiation. RNA 14, 1433–
1442.
22 Braun CJ, Zhang X, Savelyeva I, Wolff S, Moll UM,
Schepeler T, Orntoft TF, Andersen CL & Dobbelstein
M (2008) p53-Responsive microRNAs 192 and 215 are
capable of inducing cell cycle arrest. Cancer Res 68,
10094–10104.
23 Georges SA, Biery MC, Kim SY, Schelter JM, Guo J,
Chang AN, Jackson AL, Carleton MO, Linsley PS,
Cleary MA et al. (2008) Coordinated regulation of cell
cycle transcripts by p53-inducible microRNAs, miR-192
and miR-215. Cancer Res 68, 10105–10112.
24 Correa A, Lewis ZA, Greene AV, March IJ, Gomer
RH & Bell-Pedersen D (2003) Multiple oscillators regu-
late circadian gene expression in Neurospora. Proc Natl
Acad Sci USA 100, 13597–13602.
25 Sun Y, Koo S, White N, Peralta E, Esau C, Dean NM
& Perera RJ (2004) Development of a micro-array to
detect human and mouse microRNAs and characteriza-
tion of expression in human organs. Nucleic Acids Res
32, e188.
Regulation of the circadian clock by miR-192 ⁄ 194 R. Nagel et al.
5454 FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS

26 Tang X, Gal J, Zhuang X, Wang W, Zhu H & Tang G
(2007) A simple array platform for microRNA analysis
and its application in mouse tissues. RNA 13, 1803–1822.
27 Guo H, Brewer JM, Champhekar A, Harris RB
& Bittman EL (2005) Differential control of peripheral
circadian rhythms by suprachiasmatic-dependent neural
signals. Proc Natl Acad Sci USA 102, 3111–3116.
28 Balsalobre A, Damiola F & Schibler U (1998) A serum
shock induces circadian gene expression in mammalian
tissue culture cells. Cell 93, 929–937.
Supporting information
The following supplementary material is available:
Fig. S1. Relative expression levels of miR-192 ⁄ 194 in
colorectal cell lines.
Fig. S2. Reproduction of the data shown in Fig. 5C,
revealing the effect of altered miR-192 ⁄ 194 expression
on the circadian cycle.
This supplementary material can be found in the
online article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
R. Nagel et al. Regulation of the circadian clock by miR-192 ⁄ 194
FEBS Journal 276 (2009) 5447–5455 ª 2009 The Authors Journal compilation ª 2009 FEBS 5455