Tài liệu Báo cáo khoa học: The Pseudomonas aeruginosa nirE gene encodes the S-adenosyl-L-methionine-dependent uroporphyrinogen III methyltransferase required for heme d1 biosynthesis doc

The Pseudomonas aeruginosa nirE gene encodes the
S-adenosyl-
L-methionine-dependent uroporphyrinogen III
methyltransferase required for heme d
1
biosynthesis
Sonja Storbeck
1
, Johannes Walther
1
, Judith Mu
¨
ller
1
, Vina Parmar
2
, Hans Martin Schiebel
3
,
Dorit Kemken
4
, Thomas Du
¨
lcks
4
, Martin J. Warren
2
and Gunhild Layer
1
1 Institute of Microbiology, Technische Universita
¨

t Braunschweig, Germany
2 Department of Biosciences, University of Kent, Canterbury, UK
3 Institute of Organic Chemistry, Technische Universita
¨
t Braunschweig, Germany
4 Institute of Organic Chemistry, University of Bremen, Germany
Introduction
Some bacteria, such as Pseudomonas aeruginosa, use
denitrification as an alternative form of respiration
under conditions of low oxygen tension in the presence
of nitrogen oxides (e.g. nitrate or nitrite) [1]. During
denitrification, the dissimilatory nitrite reductase cata-
lyzes the reduction of nitrite to nitric oxide. In denitri-
Keywords
heme d
1
biosynthesis; precorrin-2;
Pseudomonas aeruginosa; SAM-dependent
uroporphyrinogen III methyltransferase;
uroporphyrinogen III
Correspondence
G. Layer, Institute of Microbiology,
Technische Universita
¨
t, Braunschweig,
Spielmannstr. 7, 38106 Braunschweig,
Germany
Fax: +49 531 391 5854
Tel: +49 531 391 5813
E-mail:

Website: />ifm
(Received 23 June 2009, revised 10 August
2009, accepted 14 August 2009)
doi:10.1111/j.1742-4658.2009.07306.x
Biosynthesis of heme d
1
, the essential prosthetic group of the dissimilatory
nitrite reductase cytochrome cd
1
, requires the methylation of the tetrapyr-
role precursor uroporphyrinogen III at positions C-2 and C-7. We pro-
duced Pseudomonas aeruginosa NirE, a putative S-adenosyl-l-methionine
(SAM)-dependent uroporphyrinogen III methyltransferase, as a recombi-
nant protein in Escherichia coli and purified it to apparent homogeneity by
metal chelate and gel filtration chromatography. Analytical gel filtration of
purified NirE indicated that the recombinant protein is a homodimer. NirE
was shown to be a SAM-dependent uroporphyrinogen III methyltransfer-
ase that catalyzes the conversion of uroporphyrinogen III into precorrin-2
in vivo and in vitro. A specific activity of 316.8 nmol of precorrin-
2h
)1
Æmg
)1
of NirE was found for the conversion of uroporphyrinogen III
to precorrin-2. At high enzyme concentrations NirE catalyzed an overme-
thylation of uroporphyrinogen III, resulting in the formation of
trimethylpyrrocorphin. Substrate inhibition was observed at uroporphyri-
nogen III concentrations above 17 lm. The protein did bind SAM,
although not with the same avidity as reported for other SAM-dependent
uroporphyrinogen III methyltransferases involved in siroheme and cobala-

min biosynthesis. A P. aeruginosa nirE transposon mutant was not comple-
mented by native cobA encoding the SAM-dependent uroporphyrinogen III
methyltransferase involved in cobalamin formation. However, bacterial
growth of the nirE mutant was observed when cobA was constitutively
expressed by a complementing plasmid, underscoring the special require-
ment of NirE for heme d
1
biosynthesis.
Abbreviations
HR-ESI-MS, high-resolution electrospray mass spectrometry; NirS, cytochrome cd
1
nitrite reductase; SAH, S-adenosyl-L-homocysteine; SAM,
S-adenosyl-
L-methionine; SUMT, SAM-dependent uroporphyrinogen III methyltransferase; Trx, thioredoxin.
FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS 5973
fying bacteria there are two different types of dissimi-
latory nitrite reductases. One is a copper-containing
enzyme (NirK) and the other is the tetrapyrrole-
containing cytochrome cd
1
nitrite reductase (NirS) [2].
P. aeruginosa possesses the latter enzyme [3]. NirS con-
tains the tetrapyrroles heme c and heme d
1
as essential
prosthetic groups [4]. Heme d
1
is a dioxo-isobacterio-
chlorin, which is structurally related to siroheme and
cofactor F

430
and is not a real heme [5]. The unique
structural features of heme d
1
are the oxo groups on
C-3 and C-8, the acrylate substituent on C-17 and the
combination of acetate groups and methyl groups on
C-2 and C-7, leading to partially saturated pyrrole
rings A and B (Fig. 1A).
The multistep biosynthesis of heme d
1
is not under-
stood. All cyclic tetrapyrroles share the common
precursor uroporphyrinogen III, which is converted
into either hemes and (bacterio)chlorophylls via proto-
porphyrin IX, or into siroheme, cofactor F
430
and
cobalamin via precorrin-2 [6]. For the biosynthesis of
heme d
1
, a pathway via precorrin-2 was suggested
because the formation of heme d
1
requires methylation
of tetrapyrrole rings A and B at positions C-2 and
C-7. Indeed, it was found that the heme d
1
methyl
groups attached to C-2 and C-7 are derived from

methionine, probably via S-adenosyl-l-methionine
(SAM) [7]. During the biosyntheses of siroheme and
cobalamin, SAM-dependent uroporphyrinogen III
methyltransferases (SUMTs) catalyze the methylation
of uroporphyrinogen III to precorrin-2 (Fig. 1B).
Several SUMTs from diverse organisms involved
in siroheme (CysG, SirA, UPM1) and cobalamin
(CobA) biosynthesis have been purified and bio-
chemically characterized [8–13]. Most SUMTs are
homodimeric proteins, except for the enzyme from
Bacillus megaterium that was shown to be a monomer
[9]. Some SUMTs show inhibition by the substrate
uroporphyrinogen III and by the product S-adenosyl-
A B
C
Fig. 1. Structure of heme d
1
(A), SAM-dependent methylation of uroporphyrinogen III (B) and amino acid sequence alignment of NirE, CysG
and CobA from Pseudomonas aeruginosa (C). (A) The unique structural features of heme d
1
are the methyl-group ⁄ acetate-group combina-
tions and the oxo-groups on rings A and B and the acrylate side chain on ring D. (B) SUMT proteins catalyze the SAM-dependent methyla-
tion of uroporphyrinogen III, at positions C-2 and C-7, to precorrin-2. (C) Amino acid sequence alignment of P. aeruginosa NirE with
P. aeruginosa CysG (SUMT domain = amino acid residues 219-461) and CobA shows that NirE exhibits 30% identity and 47% homology
with the two other SUMTs. Identical residues are highlighted with black boxes.
Uroporphyrinogen III methyltransferase NirE S. Storbeck et al.
5974 FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS
l-homocysteine (SAH) [9,12]. Based on amino acid
sequence analysis, two different types of SUMT have
been found to exist. Members of the first type are usu-

ally proteins of around 30 kDa and possess SUMT
activity only (SirA, CobA). By contrast, members of
the second type are usually proteins of larger size and
possess, in addition to their SUMT activity, other cat-
alytic activities such as siroheme synthase activity
(CysG) or uroporphyrinogen III synthase activity
(CobA+HemD) [14–16]. Some of the SUMTs show
an overmethylation activity that catalyzes a third
methyl transfer at position C-12, which results in the
formation of trimethylpyrrocorphin [10,11,17–19].
Crystal structures are available for the monofunctional
SUMT CobA and the multifunctional SUMT CysG
[20,21].
So far, there are no reports about the enzyme which
catalyzes the methylation of tetrapyrrole C-atoms C-2
and C-7 during heme d
1
biosynthesis. However, in the
late 1990s a gene cluster was identified in P. aeruginosa
(the so-called nir operon), of which several genes
encode proteins potentially involved in heme d
1
bio-
synthesis [22]. Based on amino acid sequence analysis,
one of these genes, nirE, was proposed to encode a
SUMT. NirE shares around 30% amino acid sequence
identity and 47% homology with the two other
SUMTs from P. aeruginosa (CysG, CobA; Fig. 1C)
that are involved in siroheme and cobalamin bio-
synthesis. Therefore, it was proposed that the NirE

protein could be the SUMT required for heme d
1
formation [22]. However, so far, this has not been
demonstrated experimentally. Here we report the pro-
duction, purification and characterization of recombi-
nant NirE from P. aeruginosa. We show that NirE is
indeed a SUMT which catalyzes the methylation of
uroporphyrinogen III to precorrin-2 in vivo and in vitro.
Results and Discussion
Production of recombinant P. aeruginosa NirE
The recombinant P. aeruginosa NirE protein was pro-
duced either as a fusion protein carrying a C-terminal
His-tag (NirE-His) or as a fusion protein carrying both
N-terminal thioredoxin (Trx)- and S-tags and a C-ter-
minal His-tag (Trx-S-NirE-His). In both cases the
recombinant protein was purified to apparent homoge-
neity in a single chromatographic step on Ni Sepha-
rose
TM
6 Fast Flow (Fig. 2A). Initial experiments were
performed using NirE-His; however, this protein
showed a tendency to precipitate at concentrations
above 3 mgÆmL
)1
. By contrast, the Trx-S-NirE-His
protein was soluble at high enzyme concentrations.
A
B
C
Fig. 2. Production and purification of recombinant NirE from Pseu-

domonas aeruginosa and characterization of in vivo accumulated
tetrapyrroles. (A) SDS ⁄ PAGE analysis of the production and purifi-
cation of recombinant NirE. Lane 1, proteins within a cell-free
extract prepared from Escherichia coli BL21(DE3) carrying pET32a-
nirE-Trx after induction with isopropyl thio-b-
D-galactoside (IPTG);
lane 2, recombinant Trx-S-NirE-His after chromatography on Ni
Sepharose
TM
Fast Flow; lane 3, S-NirE-His after thrombin cleavage
and gel filtration chromatography; lane 4, purified recombinant NirE-
His; lanes M, marker proteins with M
r
values indicated. (B) Tetra-
pyrroles accumulated during NirE production in E. coli were
extracted from the soluble protein fraction using C
18
reversed-
phase material and were characterized using UV-visible absorption
spectroscopy and mass spectrometry. The UV-visible absorption
spectrum of the extracted tetrapyrroles is characteristic of tri-
methylpyrrocorphin [10,11,17–19]. (C) HR-ESI-MS results; the
experimental mass and isotopic pattern of the [M-H]
)
ion of
compound 872 are shown. HR-ESI-MS revealed an exact mass of
871.2687 for the [M-H]
)
ion, which corresponds to the chemical
formula C

43
H
44
N
4
O
16
, in accordance with the mass and chemical
formula of trimethylpyrrocorphin in its trilactone form.
S. Storbeck et al. Uroporphyrinogen III methyltransferase NirE
FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS 5975
After thrombin cleavage and removal of the Trx-tag
by gel filtration, the remaining S-NirE-His could be
concentrated up to 20 mgÆmL
)1
. Both NirE constructs
(NirE-His and S-NirE-His) exhibited a slight reddish
colour after concentration of the protein. UV-visible
absorption spectroscopy indicated the presence of
trimethylpyrrocorphin (data not shown), the NirE
reaction product produced during protein production
in Escherichia coli (see below). NirE thus seems to bind
this overmethylation reaction product rather tightly
because it remained bound to the protein, at least
partially, during protein purification. This tight binding
of trimethylpyrrocorphin seems to be a feature unique
to NirE because it has not been reported for other
SUMT proteins. However, a physiological role of this
binding phenomenon can be excluded because tri-
methylpyrrocorphin does not represent a physiological

intermediate during heme d
1
biosynthesis.
The native molecular mass of NirE was determined
by gel filtration chromatography of NirE-His. A native
relative molecular mass of 60 000 ± 3000 was deduced
from this experiment, suggesting a dimeric structure
for the NirE protein (with a subunit molecular mass of
30 kDa). Other SUMT proteins involved in siroheme
(CysG) and cobalamin (CobA) biosynthesis were also
reported to be dimeric proteins [20,21].
NirE carries SUMT activity in vivo
During the production of both NirE-His and Trx-S-
NirE-His in E. coli a red compound accumulated in
the cells. This compound was extracted from the solu-
ble protein fraction using C
18
-reversed phase material
and analysed by UV-visible absorption spectroscopy
and mass spectrometry. In both cases (NirE-His and
Trx-S-NirE-His production) the UV-visible absorption
spectrum of the extracted compound exhibited an
absorption maximum at 354 nm and was very similar
to the previously reported absorption spectrum of
trimethylpyrrocorphin, the overmethylation product of
SUMT proteins (Fig. 2B) [10,11,17–19]. Analysis of
the extracted compound by high-resolution electro-
spray mass spectrometry (HR-ESI-MS) in the negative
ion mode revealed an exact mass of 871.2687 for the
[M-H]

)
ion, which corresponds to an elemental com-
position of C
43
H
44
N
4
O
16
with a deviation of 0.8 p.p.m.
This elemental composition is in accordance with the
mass and chemical formula of trimethylpyrrocorphin
in its trilactone form (Fig. 2C). Isolation of lactone
derivatives of isobacteriochlorins has been reported
previously [23,24] and lactone formation probably
occurs during the tetrapyrrole extraction procedure.
However, our results showed that the production of
recombinant NirE in E. coli leads to the accumulation
of trimethylpyrrocorphin in vivo, an observation that
has been reported for most of the known SUMT
proteins [10,11,17–19].
NirE carries SUMT activity in vitro
Next, we tested the NirE protein for SUMT activity
in vitro. The standard NirE activity assay was per-
formed as described in the Materials and methods sec-
tion with enzymatically produced uroporphyrinogen
III. The formation of the NirE reaction product, pre-
corrin-2, was followed using UV-visible absorption
spectroscopy. Figure 3 shows the absorption spectra

obtained from enzyme reactions after overnight incu-
bation. The spectrum obtained from a reaction mix-
ture containing the uroporphyrinogen III producing
enzymes HemB, HemC and HemD did not show any
characteristic features in the 300–700 nm region, as
was expected for a solution containing colourless uro-
porphyrinogen III under anaerobic conditions. Upon
the addition of recombinant purified NirE and SAM
to the reaction mixture, an absorption spectrum was
observed that exhibited very broad absorption features
(between 500–400 nm and 400–350 nm), in agreement
with the yellow colour of the corresponding reaction
mixture. This spectrum is characteristic for precorrin-2
[17,25]. When the precorrin-2 dehydrogenase SirC and
NAD
+
were also included in the above reaction
Fig. 3. UV-visible absorption spectra of NirE activity assays. The
substrate uroporphyrinogen III (urogen III in the figure) was pro-
duced from 5-aminolevulinic acid by an enzyme cocktail containing
purified, recombinant Pseudomonas aeruginosa HemB and Bacil-
lus megaterium HemC and HemD (dashed line). Precorrin-2 forma-
tion was observed (dotted line) upon the addition of purified NirE
and SAM. Precorrin-2 formed by NirE was converted into sirohydro-
chlorin by SirC in the presence of NAD
+
(solid line).
Uroporphyrinogen III methyltransferase NirE S. Storbeck et al.
5976 FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS
mixture, the solution turned red instead of yellow,

indicating the conversion of precorrin-2 (produced by
NirE) into sirohydrochlorin. The UV-visible absorp-
tion spectrum obtained from such a reaction mixture
corresponds indeed to the typical absorption spectrum
of sirohydrochlorin (Fig. 3) [25]. When SAM was
omitted from the NirE activity assay no precorrin-2
formation was observed (data not shown). These
results clearly show that NirE is able to catalyze the
two SAM-dependent methylation reactions to convert
uroporphyrinogen III into precorrin-2 in vitro.
Initially we performed enzyme assays with all three
NirE proteins – NirE-His, Trx-S-NirE-His and S-NirE-
His – and compared their catalytic activities. We
observed that Trx-S-NirE-His and S-NirE-His showed
similar activities. By contrast, NirE-His showed only
half of the activity of the other two proteins. Therefore,
S-NirE-His was used for all subsequent enzyme assays
and experiments. We observed the highest catalytic rates
with chemically produced substrate uroporphyrinogen
III at a concentration of 17 lm, a SAM concentration
of 200 lm and at NirE concentrations of 1.5 lm. Under
these assay conditions a specific activity of 316.8 nmol
of precorrin-2 h
)1
Æmg
)1
of NirE was observed.
Previously, it was reported that SUMT proteins
catalyze a third methylation of uroporphyrinogen III
to generate a trimethylpyrrocorphin, not only in vivo

but also in vitro at high enzyme concentrations in the
assay [17,18]. As the production of recombinant NirE
in E. coli leads to the accumulation of trimethylpyrro-
corphin in vivo, we tested if high concentrations of
NirE in our enzyme assay also formed this compound
in vitro. We observed the formation of trimethylpyrro-
corphin in our activity assays at NirE concentrations
above 10 lm in the presence of 500 lm SAM (data not
shown). Thus, NirE is indeed a SUMT that shows the
same catalytic behaviour in vivo and in vitro as the
SUMTs for siroheme and cobalamin biosynthesis.
NirE exhibits substrate inhibition by
uroporphyrinogen III and product inhibition
by SAH
SUMT proteins were reported to exhibit inhibition by
their substrate uroporphyrinogen III, as well as by the
reaction by-product SAH. Therefore, we tested NirE
for such inhibition phenomena. In our enzyme assay
using chemically produced uroporphyrinogen III we
observed substrate inhibition at uroporphyrinogen III
concentrations above 17 lm, as shown in Figure 4A.
In order to test NirE for inhibition by SAH we added
increasing amounts of SAH to our activity assay. We
observed inhibition of the NirE reaction at SAH
concentrations above 2 lm (Fig. 4B). NirE thus
displays the same inhibition phenomena as those
previously reported for other SUMT proteins [9,12].
However, the question of whether these substrate and
product-inhibition characteristics are physiologically
relevant, or if they only represent in vitro assay

artefacts, requires further investigation.
SAM binding
In previous studies, rapid SAM-binding assays were
performed in order to characterize SUMT proteins
[10,26,27]. Therefore, we also tested the NirE protein
for its ability to bind SAM. After incubation of NirE
with radioactively labelled SAM, the mixture was
A
B
Precorrin-2 (pmol)·min
–1
× NirE (nmol)
Precorrin-2 (pmol)·min
–1
× NirE (nmol)
Fig. 4. Inhibition of NirE activity by the substrate uroporphyrinogen
III and by the product SAH. (A) NirE activity assays (1.5 l
M NirE,
200 l
M SAM) were performed with increasing amounts of chemi-
cally synthesized uroporphyrinogen III. Initial rates of precorrin-2
formation were plotted against the uroporphyrinogen III concentra-
tion. (B) Increasing amounts of S-adenosyl-
L-homocysteine (SAH)
were added to the NirE activity assay (1.5 l
M NirE, 200 lM SAM,
17 l
M uroporphyrinogen III). Initial rates of precorrin-2 formation
were plotted against the SAH concentration.
S. Storbeck et al. Uroporphyrinogen III methyltransferase NirE

FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS 5977
passed over a desalting column and the elution frac-
tions were analyzed for radioactivity using a liquid
scintillation counter. As a control, the same experiment
was carried out with BSA. In the BSA control experi-
ment all radioactivity eluted in the small-molecules
fractions. By contrast, when SAM was mixed with
NirE, the label was found to co-elute with the protein-
containing fractions (data not shown). We also tested
whether SAM remained bound to NirE during dena-
turing electrophoresis, as observed for other SUMT
proteins [10,26,27]. After incubation of NirE with
radioactively labelled SAM, the protein was subjected
to SDS ⁄ PAGE and fluorography. No radioactivity was
found to be associated with the protein after denatur-
ing electrophoresis (data not shown). These experi-
ments show that NirE binds SAM; however, the
binding seems to be weaker than for other SUMT
proteins because SAM did not remain bound to the
protein under denaturing conditions.
P. aeruginosa cobA is able to complement a
P. aeruginosa nirE mutant
We have unambiguously shown, from the results
described in the previous section, that the NirE protein
is a SAM-dependent uroporphyrinogen III methyl-
transferase. Although P. aeruginosa also possesses the
genes encoding the SUMTs involved in cobalamin
(cobA) and siroheme (cysG) biosynthesis, the nirE gene
product was found to be essential for heme d
1

biosyn-
thesis. A P. aeruginosa nirE knockout mutant was
unable to synthesize heme d
1
and produced only heme
d
1
-lacking, inactive cytochrome cd
1
[22]. This absolute
requirement for NirE during heme d
1
biosynthesis is
surprising considering the identical catalytic abilities of
NirE and CobA. CobA catalyzes the SAM-dependent
methylation of uroporphyrinogen III to form precor-
rin-2 during cobalamin biosynthesis. The third SUMT
in P. aeruginosa, the trifunctional siroheme synthase
CysG, probably does not release precorrin-2 during
siroheme formation and therefore cannot provide this
precursor for heme d
1
biosynthesis in the absence of
NirE. The observation that CobA is apparently not
able to replace NirE during heme d
1
formation may
have several explanations. One possibility could be
that specific protein–protein interactions between NirE
and the subsequent heme d

1
biosynthesis protein are
required to allow substrate channelling of the highly
labile precorrin-2. Another explanation may be that
CobA, although probably present under anaerobic
denitrifying conditions in order to sustain cobalamin
biosynthesis for cobalamin-dependent enzymes,
such as class II ribonucleotide reductase [28], is
produced in amounts too low to sustain efficient heme
d
1
biosynthesis.
In order to investigate these possibilities, we tested
whether P. aeruginosa cobA, when constitutively
expressed from a plasmid, was able to complement a
P. aeruginosa PAO1 nirE transposon mutant (strain
PAO1 ID35553). For these experiments, wild-type
P. aeruginosa PAO1 and P. aeruginosa PAO1 ID35553
carrying diverse complementation plasmids were grown
as described in the Materials and methods. When
anaerobic growth conditions were reached (after about
4 h), strain PAO1 ID35553 as well as this strain carry-
ing the basic plasmid pUCP20T showed greatly
impaired growth when compared with the wild-type
strain (Fig. 5). By contrast, strain PAO1 ID35553, car-
rying the complementation plasmid pUCP20T-nirE,
grew almost as well as the wild-type strain, as
expected. Interestingly, strain PAO1 ID35553, carrying
plasmid pUCP20T-cobA, showed growth behaviour
similar to that of the wild-type strain and the same

growth behaviour as the nirE-complemented strain
PAO1 ID35553 (Fig. 5). Therefore, cobA was able to
complement the P. aeruginosa nirE mutant strain when
constitutively expressed from a complementation plas-
mid. By contrast, the concentration of native CobA
produced under anaerobic denitrifying growth condi-
tions was apparently not sufficient to restore efficient
heme d
1
biosynthesis in the nirE
)
background. Indeed,
cobA transcript levels were found to be absent in
Affymetrix microarray analyses of anaerobically grown
Fig. 5. Growth curves of wild-type Pseudomonas aeruginosa PAO1
and of P. aeruginosa strain PAO1 ID35553. P. aeruginosa was
grown under anaerobic growth conditions in the presence of
nitrate, as described in the Materials and methods. Strain PAO1
ID35553 (D) and this strain carrying plasmid pUCP20T (.) showed
impaired growth under these growth conditions compared with the
wild-type strain (
). Bacterial growth of strain PAO1 ID35553 was
restored by plasmids pUCP20T-nirE (
•
) and pUCP20T-cobA (s).
Uroporphyrinogen III methyltransferase NirE S. Storbeck et al.
5978 FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS
P. aeruginosa (M. Schobert, personal communication).
These results are in agreement with the fact that the
genes for nitrite reductase NirS and the proposed heme

d
1
biosynthesis proteins, including NirE, are organized
in one large operon [22]. The transcription of the nir
operon genes was found to be highly up-regulated
in P. aeruginosa under anaerobic conditions in the
presence of nitrate [28]. Under such conditions the
co-transcription of heme d
1
biosynthesis genes and
the co-production of both NirE and the other heme
d
1
biosynthesis proteins, in high amounts ensures the
efficient and highly concerted action of the proteins. In
order to cope with the high demand for heme d
1
under
denitrifying conditions, such a concerted action of
heme d
1
biosynthesis proteins is required and therefore
native cobA, which is not co-transcribed with the nir
genes, is not able to replace nirE. Thus, the NirE
protein is a SAM-dependent uroporphyrinogen III
methyltransferase which is specifically required for
heme d
1
biosynthesis.
Materials and methods

Chemicals
Unless stated otherwise, all chemicals, reagents and antibi-
otics were obtained from Sigma-Aldrich (Taufkirchen,
Germany) or Merck (Darmstadt, Germany). DNA
polymerase, restriction endonucleases and PCR requisites
were purchased from New England Biolabs (Frankfurt
a.M., Germany). Oligonucleotide primers were purchased
from metabion international AG (Martinsried, Germany).
Kits for PCR purification and gel extraction were pur-
chased from Qiagen GmbH (Hilden, Germany). Ni Sepha-
rose
TM
6 Fast Flow was purchased from GE Healthcare
(Mu
¨
nchen, Germany). [Methyl-
14
C]-S-adenosyl-l-methio-
nine was obtained from Hartmann Analytic (Braunschweig,
Germany). Uroporphyrin III was obtained from Frontier
Scientific Europe (Carnforth, UK).
Plasmids, bacteria and growth conditions
The E. coli strain DH10B was used as the host for cloning,
and E. coli BL21(DE3) was used as the host for protein
production. For complementation studies a P. aeruginosa
PAO1 mutant was used, which carries a transposon inser-
tion in the nirE gene (strain PAO1 ID35553) [29]. This
mutant was transformed with plasmids pUCP20T-nirE,
pUCP20T-cobA or pUCP20T. For anaerobic growth condi-
tions [30], LB (Luria–Bertani) medium was supplemented

with 50 mm nitrate and carbenicillin at a final concentra-
tion of 250 lgÆmL
)1
. P. aeruginosa precultures were grown
aerobically overnight and the anaerobic cultures (140-mL
bottles filled with 135 mL of LB medium) were inoculated
with appropriate volumes of these precultures to obtain
a final A of 0.05 at 578 nm. Culture was carried out at
37 °C.
The plasmids used for the production of recombinant
P. aeruginosa NirE were pET32a-nirE-Trx and pET22b-
nirE (see below). The plasmids used for the production of
recombinant P. aeruginosa HemB [31] and B. megaterium
HemC, HemD and SirC [32] were described previously.
For the production of recombinant proteins, E. coli
BL21(DE3) cells, carrying the respective plasmid, were
grown at 37 °C in 500 mL of LB medium supplemented
with ampicillin at a final concentration of 100 lgÆ mL
)1
.
At a A of 0.6 at 578 nm, protein production was induced
by the addition of 50 lm isopropyl thio-b-d-galactoside
(IPTG). The cells were then cultured further at 17 °C. After
18 h of culture the cells were harvested by centrifugation
and stored at )20 °C until required.
Construction of vectors
For the construction of nirE expression vectors, the nirE
gene from P. aeruginosa PAO1 was PCR amplified using
the primers nirE_Pa_BamHI_for (GCCG
GGATCCAT

GAACACTACCGTGATTC) and nirE_Pa_XhoI_rev
(GA
CTCGAGGGCGCATGCGAC) containing BamHI
and XhoI restriction sites (underlined), respectively, for
cloning the nirE gene into pET32a (Novagen, Darmstadt,
Germany). For cloning the nirE gene into pET22b (Nov-
agen), the PCR primers NirE_NdeI (GT
CATATGACA
CTACCGTGATTCC) and NirE_HindIII (GT
AAGCTT
GCATGCGACGGCCTCG), containing NdeI and HindIII
restriction sites (underlined), respectively, were used. The
plasmid pHAE2 [22], containing a fragment of the P. aeru-
ginosa PAO1 nir operon, was used as the DNA template.
The resulting PCR fragments were digested with BamHI
and XhoI, or with NdeI and HindIII, and ligated into the
appropriately digested vectors pET32a or pET22b to gener-
ate pET32a-nirE-Trx and pET22b-nirE, respectively.
For construction of complementation vectors the nirE
gene and the cobA gene, including a 50-bp upstream region
bearing the ribosome-binding sites, were PCR amplified
using the primers NirE_Compl_for (GA
GAATTCGGA
AATCGGCCTCG) and NirE_Compl_rev (CT
AAGCTTT
CAGGCGCATGCG) for the nirE gene and CobA_
Compl_for (GA
GAATTCACTGCTGGCGGCC) and
CobA_Compl_rev (CT
AAGCTTTCAGGCGCTCAGGG)

for the cobA gene, respectively, containing EcoRI and
HindIII restriction sites (underlined). A colony of
P. aeruginosa PAO1 was used as a template. The resulting
PCR fragments were digested with EcoRI and HindIII and
ligated into the appropriately digested vector pUCP20T to
generate pUCP20T-nirE and pUCP20T-cobA, respectively.
The vectors were transferred into strain PAO1 ID35553 by
diparental mating using E. coli ST18 [33] as a donor. Stan-
dard procedures were used for PCR amplification, agarose
S. Storbeck et al. Uroporphyrinogen III methyltransferase NirE
FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS 5979
gel electrophoresis, dephosphorylation, ligation and trans-
formation of chemocompetent E. coli cells [34]. Restriction
enzymes were used as recommended by the manufacturer.
Purification of enzymes
All protein purification steps were carried out at 4 °C.
Harvested E. coli cells, harbouring recombinantly pro-
duced NirE protein, were resuspended in buffer A [50 mm
Tris ⁄ HCl (pH 7.5), 200 mm KCl, 10% (w ⁄ v) glycerol]
containing 1 mm phenylmethanesulfonyl fluoride. The cells
were disrupted by a single passage through a French press
at 1000 p.s.i. (68947.57 hPa) and then centrifuged for
60 min at 175 000 g. The supernatant was applied to
1 mL of silica gel 100 C
18
-reversed phase material, acti-
vated first with methanol then equilibrated with buffer A,
to extract accumulated tetrapyrroles. The flow-through,
containing the NirE protein, was applied to 1.5 mL of Ni
Sepharose

TM
6 Fast Flow equilibrated with buffer A.
After extensive washing with buffer A, the recombinant
NirE protein was eluted with 2.5 mL of buffer A contain-
ing 200 mm imidazole. After elution of NirE, buffer
exchange was performed in an anaerobic chamber (Coy
Laboratories, Grass Lake, MI, USA) by passing the pro-
tein solution through a NAP-25 column (GE Healthcare)
that had been equilibrated with buffer A containing 5 mm
dithiothreitol. When NirE was produced as a fusion pro-
tein with an N-terminal Trx-tag, the Trx-tag was cleaved
off with thrombin using the Thrombin Cleavage Capture
Kit (Novagen) according to the manufacturer’s instruc-
tions. NirE was separated from the Trx-tag by gel filtra-
tion chromatography on a HiLoad 16 ⁄ 60 Superdex 200
column (GE Healthcare) equilibrated with buffer A con-
taining 5 mm dithiothreitol. Protein solutions were con-
centrated by ultrafiltration (Amicon, Millipore GmbH,
Eschborn, Germany). The purified NirE protein was
stored at )20 °C. The N-terminal amino acid sequences of
the purified proteins were determined by Edman degrada-
tion and were found to be identical to those expected
from the cloning strategy (MNTTVIP for NirE-His and
GSGMKET for S-NirE-His). Recombinant P. aeruginosa
HemB and B. megaterium HemC, HemD and SirC were
purified as previously described [31,32].
Determination of protein concentration
The Bradford Reagent (Sigma-Aldrich) was used to deter-
mine protein concentrations, according to the manufac-
turer’s instructions, using BSA as a standard.

Molecular mass determination
The native molecular mass was estimated from gel filtration
chromatography using a Superdex
TM
200 10 ⁄ 300 GL
column attached to an A
¨
KTA
TM
Purifier system (GE
Healthcare). The column was equilibrated with buffer A
containing 5 mm dithiothreitol. Protein samples of 150 l L
were loaded onto the column and chromatographed at a
flow rate of 0.5 mLÆmin
)1
. Protein elution was monitored
by determining the absorption of the eluate at 280 nm. The
column was calibrated using the protein standards carbonic
anhydrase (29 000 Da), BSA (66 000 Da), conalbumin
(77 000 Da), alcohol dehydrogenase (150 000 Da) and
b-amylase (200 000 Da).
Extraction of tetrapyrrole compounds
In vivo accumulated tetrapyrrole compounds were extracted
from the soluble protein fraction by passing the cell-free
extracts over a 1-mL silica gel 100 C
18
-reversed phase col-
umn, activated first with methanol then equilibrated with
buffer A. The silica gel was washed with water and the
bound tetrapyrroles were eluted with methanol. The solvent

was removed by evaporation and the dried tetrapyrroles
were stored at )20 °C.
UV-visible absorption spectroscopy
UV-visible absorption spectra of extracted tetrapyrroles
were recorded using a V-550 spectrophotometer (Jasco,
Gross-Umstadt, Germany).
NirE activity assay
In vitro NirE activity assays were performed under anaero-
bic conditions in an anaerobic chamber (Coy Laboratories)
in a final volume of 1 mL of thoroughly degassed buffer
containing 50 mm Tris ⁄ HCl (pH 8.0), 100 mm KCl, 5 mm
MgCl
2
and 50 mm NaCl. The final NirE concentration was
1.5 lm. The substrate uroporphyrinogen III was generated
from 1 mm 5-aminolevulinic acid using a coupled assay
system including HemB (0.14 lm), HemC (0.15 lm) and
HemD (0.17 lm). Alternatively, uroporphyrin III was
reduced chemically and used at a final concentration of
8 lm. The reaction was started by the addition of SAM to
a final concentration of 200 lm and was incubated at 37 °C
in the dark. The reaction was monitored using a Lambda 2
spectrophotometer (PerkinElmer Instruments, U
¨
berlingen,
Germany). In order to quantify the precorrin-2, it was
converted to sirohydrochlorin (e
376
= 2.4 · 10
5

m
)1
Æcm
)1
[35]) by the addition of SirC (1.5 lm) and 100 lm NAD
+
.
Preparation of uroporphyrinogen III
Uroporphyrinogen III was prepared by chemical reduction
of uroporphyrin III with 3% sodium amalgam, as described
previously for coproporphyrinogen III [36].
Uroporphyrinogen III methyltransferase NirE S. Storbeck et al.
5980 FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS
SAM-binding assay
The SAM-binding assay was performed as described previ-
ously [26]. Briefly, 100 lm purified NirE protein was incu-
bated with 0.5 l Ci of [methyl-
14
C]-S-adenosyl-l-methionine
in a final volume of 250 lL of buffer A at 25 °C for 1 h.
The protein solution was then passed over a NAP-5 column
(GE Healthcare) and eluted with 3 mL of buffer A.
Fractions of 100 lL were collected and analysed for radio-
activity using a Liquid Scintillation Analyzer Tri-Carb 2900
TR (PerkinElmer Life Sciences). Analysis of SAM binding
by fluorography was performed as described previously
[26].
Mass spectrometry of tetrapyrroles
HR-ESI-MS data were acquired using a Bruker microTOF-
Q II equipped with an Apollo ESI ion source (Bruker

Daltonik, Bremen, Germany). Samples were dissolved in
methanol and introduced, via direct infusion, at a flow rate
of 4 lLÆmin
)1
.
Acknowledgements
We thank Professor H. Arai (University of Tokyo,
Japan) for the gift of plasmid pHAE2, and Professor
S. Ha
¨
ußler (Helmholtz-Centre for Infection Research,
Braunschweig, Germany) for the gift of the P. aerugin-
osa nirE transposon mutant (strain PAO1 ID35553).
We thank Dr Jan Willmann (Bruker Daltonik, Bre-
men, Germany) for HR-ESI-MS measurements. We
also thank Prof. D. Jahn and Drs J. Moser and M.
Schobert for helpful discussions. This work was sup-
ported by the Emmy-Noether-Program of the Deut-
sche Forschungsgemeinschaft and by funds from the
Fonds der Chemischen Industrie to G.L.
References
1 Zumft WG (1997) Cell biology and molecular basis of
denitrification. Microbiol Mol Biol Rev 61, 533–616.
2 Tavares P, Pereira AS, Moura JJ & Moura I (2006)
Metalloenzymes of the denitrification pathway. J Inorg
Biochem 100, 2087–2100.
3 Philippot L (2002) Denitrifying genes in bacterial
and archaeal genomes. Biochim Biophys Acta 1577,
355–376.
4 Cutruzzola F, Rinaldo S, Centola F & Brunori M

(2003) NO production by Pseudomonas aeruginosa cd
1
nitrite reductase. IUBMB Life 55, 617–621.
5 Chang CK (1994) Haem d
1
and other haem cofactors
from bacteria. Ciba Found Symp 180, 228–238.
6 Battersby AR (2000) Tetrapyrroles: the pigments of life.
Nat Prod Rep 17, 507–526.
7 Yap-Bondoc F, Bondoc LL, Timkovich R, Baker DC
& Hebbler A (1990) C-methylation occurs during the
biosynthesis of heme d
1
. J Biol Chem 265, 13498–13500.
8 Warren MJ, Roessner CA, Santander PJ & Scott AI
(1990) The Escherichia coli cysG gene encodes S-adeno-
sylmethionine-dependent uroporphyrinogen III methyl-
ase. Biochem J 265, 725–729.
9 Robin C, Blanche F, Cauchois L, Cameron B, Couder
M & Crouzet J (1991) Primary structure, expression in
Escherichia coli, and properties of S-adenosyl-L-methio-
nine:uroporphyrinogen III methyltransferase from
Bacillus megaterium. J Bacteriol 173, 4893–4896.
10 Leustek T, Smith M, Murillo M, Singh DP, Smith AG,
Woodcock SC, Awan SJ & Warren MJ (1997) Siroheme
biosynthesis in higher plants. Analysis of an S-adenosyl-
L-methionine-dependent uroporphyrinogen III methyl-
transferase from Arabidopsis thaliana. J Biol Chem 272,
2744–2752.
11 Fan J, Wang D, Liang Z, Guo M, Teng M & Niu L

(2006) Maize uroporphyrinogen III methyltransferase:
overexpression of the functional gene fragments in
Escherichia coli and one-step purification. Protein Expr
Purif 46, 40–46.
12 Blanche F, Debussche L, Thibaut D, Crouzet J &
Cameron B (1989) Purification and characterization of
S-adenosyl-L-methionine:uroporphyrinogen III methyl-
transferase from Pseudomonas denitrificans. J Bacteriol
171, 4222–4231.
13 Blanche F, Robin C, Couder M, Faucher D, Cauchois
L, Cameron B & Crouzet J (1991) Purification, charac-
terization, and molecular cloning of S-adenosyl-L-
methionine:uroporphyrinogen III methyltransferase
from Methanobacterium ivanovii. J Bacteriol 173, 4637–
4645.
14 Warren MJ, Bolt EL, Roessner CA, Scott AI, Spencer
JB & Woodcock SC (1994) Gene dissection demon-
strates that the Escherichia coli cysG gene encodes a
multifunctional protein. Biochem J 302, 837–844.
15 Anderson PJ, Entsch B & McKay DB (2001) A gene,
cobA+hemD, from Selenomonas ruminantium encodes a
bifunctional enzyme involved in the synthesis of vitamin
B
12
. Gene 281, 63–70.
16 Lobo SA, Brindley A, Warren MJ & Saraiva LM
(2009) Functional characterization of the early steps of
tetrapyrrole biosynthesis and modification in Desulfovib-
rio vulgaris Hildenborough. Biochem J 420, 317–325.
17 Warren MJ, Stolowich NJ, Santander PJ, Roessner CA,

Sowa BA & Scott AI (1990) Enzymatic synthesis of
dihydrosirohydrochlorin (precorrin-2) and of a novel
pyrrocorphin by uroporphyrinogen III methylase. FEBS
Lett 261, 76–80.
18 Sattler I, Roessner CA, Stolowich NJ, Hardin SH, Har-
ris-Haller LW, Yokubaitis NT, Murooka Y, Hashimoto
Y & Scott AI (1995) Cloning, sequencing, and expres-
S. Storbeck et al. Uroporphyrinogen III methyltransferase NirE
FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS 5981
sion of the uroporphyrinogen III methyltransferase
cobA gene of Propionibacterium freudenreichii (sherma-
nii). J Bacteriol 177, 1564–1569.
19 Roessner CA & Scott AI (1995) Fluorescence-based
method for selection of recombinant plasmids. BioTech-
niques 19, 760–764.
20 Vevodova J, Graham RM, Raux E, Schubert HL,
Roper DI, Brindley AA, Ian Scott A, Roessner CA,
Stamford NP, Elizabeth Stroupe M et al. (2004) Struc-
ture ⁄ function studies on a S-adenosyl-l-methionine-
dependent uroporphyrinogen III C methyltransferase
(SUMT), a key regulatory enzyme of tetrapyrrole
biosynthesis. J Mol Biol 344, 419–433.
21 Stroupe ME, Leech HK, Daniels DS, Warren MJ &
Getzoff ED (2003) CysG structure reveals tetrapyrrole-
binding features and novel regulation of siroheme
biosynthesis. Nat Struct Biol 10, 1064–1073.
22 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)
Gene cluster for dissimilatory nitrite reductase (nir)
from Pseudomonas aeruginosa: sequencing and identifi-
cation of a locus for heme d

1
biosynthesis. J Bacteriol
179, 235–242.
23 Battersby AR, Jones K, McDonald E, Robinson JA &
Morris HR (1977) The structures and chemistry of
isobacteriochlorins from Desulfovibrio gigas. Tetrahe-
dron Lett 25, 2213–2216.
24 Battersby AR, McDonald E, Morris HR, Thompson M
& Williams DC (1977) Biosynthesis of vitamin B
12
:
structural studies on the corriphyrins from Propionibac-
terium shermanii and the link with sirohydrochlorin.
Tetrahedron Letters 25, 2217–2220.
25 Schubert HL, Raux E, Brindley AA, Leech HK, Wilson
KS, Hill CP & Warren MJ (2002) The structure of
Saccharomyces cerevisiae Met8p, a bifunctional dehy-
drogenase and ferrochelatase. EMBO J 21, 2068–2075.
26 Woodcock SC & Warren MJ (1996) Evidence for a
covalent intermediate in the S-adenosyl-l-methionine-
dependent transmethylation reaction catalysed by
sirohaem synthase. Biochem J 313, 415–421.
27 Woodcock SC, Raux E, Levillayer F, Thermes C,
Rambach A & Warren MJ (1998) Effect of mutations
in the transmethylase and dehydrogenase ⁄ chelatase
domains of sirohaem synthase (CysG) on sirohaem and
cobalamin biosynthesis. Biochem J 330, 121–129.
28 Platt MD, Schurr MJ, Sauer K, Vazquez G, Kukavica-
Ibrulj I, Potvin E, Levesque RC, Fedynak A, Brinkman
FS, Schurr J et al. (2008) Proteomic, microarray, and

signature-tagged mutagenesis analyses of anaerobic
Pseudomonas aeruginosa at pH 6.5, likely representing
chronic, late-stage cystic fibrosis airway conditions.
J Bacteriol 190, 2739–2758.
29 Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D,
Haugen E, Ernst S, Will O, Kaul R, Raymond C, Levy
R et al. (2003) Comprehensive transposon mutant
library of Pseudomonas aeruginosa. Proc Natl Acad Sci
USA100, 14339–14344.
30 Eschbach M, Schreiber K, Trunk K, Buer J, Jahn D &
Schobert M (2004) Long-term anaerobic survival of the
opportunistic pathogen Pseudomonas aeruginosa via
pyruvate fermentation. J Bacteriol 186, 4596–4604.
31 Frankenberg N, Kittel T, Hungerer C, Ro
¨
mling U &
Jahn D (1998) Cloning, mapping and functional charac-
terization of the hemB gene of Pseudomonas aeruginosa,
which encodes a magnesium-dependent 5-aminolevulinic
acid dehydratase. Mol Gen Genet 257, 485–489.
32 Raux E, Leech HK, Beck R, Schubert HL, Santander
PJ, Roessner CA, Scott AI, Martens JH, Jahn D,
Thermes C et al. (2003) Identification and functional
analysis of enzymes required for precorrin-2 dehydroge-
nation and metal ion insertion in the biosynthesis
of sirohaem and cobalamin in Bacillus megaterium.
Biochem J 370, 505–516.
33 Thoma S & Schobert M (2009) An improved Escheri-
chia coli donor strain for diparental mating. FEMS
Microbiol Lett 294, 127–132.

34 Sambrock J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: A Laboratory Manual, 2nd edn. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
35 Leech HK, Raux E, McLean KJ, Munro AW, Robin-
son NJ, Borrelly GP, Malten M, Jahn D, Rigby SE,
Heathcote P et al. (2003) Characterization of the cobalt-
ochelatase CbiXL: evidence for a 4Fe-4S center housed
within an MXCXXC motif. J Biol Chem 278, 41900–
41907.
36 Layer G, Verfu
¨
rth K, Mahlitz E & Jahn D (2002)
Oxygen-independent coproporphyrinogen-III oxidase
HemN from Escherichia coli. J Biol Chem 277,
34136–34142.
Uroporphyrinogen III methyltransferase NirE S. Storbeck et al.
5982 FEBS Journal 276 (2009) 5973–5982 ª 2009 The Authors Journal compilation ª 2009 FEBS