Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Functional characterization of an orphan cupin
protein from Burkholderia xenovorans reveals a
mononuclear nonheme Fe
2+
-dependent oxygenase
that cleaves b-diketones
Stefan Leitgeb, Grit D. Straganz and Bernd Nidetzky
Institute of Biotechnology and Biochemical Engineering, Graz University of Technology, Austria
Introduction
In terms of their physiological functions, which include
enzymatic catalysis, ligand binding, and the role of
storage proteins, the cupins constitute one of the most
diverse superfamilies of proteins known. They have
been described from all three domains of life [1,2], and
usually occur as metalloproteins. Regardless of their
Keywords
cupin; nonheme iron; oxygenase; X-ray
absorption spectroscopy; b-diketone
cleavage
Correspondence
Bernd Nidetzky, Institute of Biotechnology
and Biochemical Engineering, Graz
University of Technology, Petersgasse 12 ⁄ I,
A-8010 Graz, Austria
Fax: +43 316 873 8434
Tel: +43 316 873 8400
E-mail:
(Received 15 October 2008, revised 31 July
2009, accepted 17 August 2009)
doi:10.1111/j.1742-4658.2009.07308.x
Cupins constitute a large and widespread superfamily of b-barrel proteins

in which a mononuclear metal site is both a conserved feature of the struc-
ture and a source of functional diversity. Metal-binding residues are con-
tributed from two core motifs that provide the signature for the
superfamily. On the basis of conservation of this two-motif structure, we
have identified an ORF in the genome of Burkholderia xenovorans that
encodes a novel cupin protein (Bxe_A2876) of unknown function. Recom-
binant Bxe_A2876, as isolated from Escherichia coli cell extract, was a
homotetramer in solution, and showed mixed fractional occupancy of its
16.1 kDa subunit with metal ligands (0.06 copper; 0.11 iron; 0.17 zinc).
Our quest for possible catalytic functions of Bxe_A2876 focused on Cu
2+
and Fe
2+
oxygenase activities known from related cupin enzymes. Fe
2+
elicited enzymatic catalysis of O
2
-dependent conversion of various b-dike-
tone substrates via a nucleophilic mechanism of carbon–carbon bond
cleavage. Data from X-ray absorption spectroscopy (XAS) support a
five-coordinate or six-coordinate Fe
2+
center where the metal is bound by
three imidazole nitrogen atoms at 1.98 A
˚
. Results of structure modeling
studies suggest that His60, His62 and His102 are the coordinating residues.
In the ‘best-fit’ model, one or two oxygens from water and a carboxylate
oxygen (presumably from Glu96) are further ligands of Fe
2+

at estimated
distances of 2.04 A
˚
and 2.08 A
˚
, respectively. The three-histidine Fe
2+
site
of Bxe_A2876 is compared to the mononuclear nonheme Fe
2+
centers of
the structurally related cysteine dioxygenase and acireductone dioxygenase,
which also use a facial triad of histidines for binding of their metal cofac-
tor but promote entirely different substrate transformations.
Abbreviations
ARD, acireductone dioxygenase; CDO, cysteine dioxygenase; Dke1, b-diketone-cleaving dioxygenase; DLS, dynamic light scattering; EXAFS,
extended X-ray absorption fine structure; QDO, quercetin dioxygenase; RgCarb, Rubrivivax gelatinosus acetyl ⁄ propionyl-CoA carboxylase;
SOD, superoxide dismutase; XANES, X-ray absorption near-edge structure; XAS, X-ray absorption spectroscopy.
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5983
low sequence homology, proteins classified as cupins
display a common double-stranded b-helix fold that
forms a core b-barrel. Two highly conserved histidine-
containing motifs separated by a variable intermotif
region provide the signature for the superfamily and
contribute the residues for metal binding [1,2]. A wide
range of catalytic functions, spanning primary enzyme
classes EC 1, EC 3, EC 4, and EC 5, have evolved in
cupin proteins [3–6]. Because the metal center usually
fulfils an essential role in catalysis by cupin enzymes,
there is the fundamental question of how the structures

of cupin proteins determine metal-binding recognition
as well as reactivity in chemical transformations. Func-
tional annotation of cupin proteins from sequence and
3D structural data alone is a challenging task [7], as
reflected by the recent addition of several new protein
structures (Protein Data Bank identifiers of selected
examples: 2PFW, 1VJ2, 2OZJ, 3ES1, 3EBR, 3FJS,
3ES4, 3D82, 3BCW, 3CEW, and 3CJX) to the data-
base without assignment of a putative function. Metal
promiscuity in several cupin enzymes, including super-
oxide dismutase (SOD) (Fe
2+
,Mn
2+
) [8], acireductone
dioxygenase (ARD) (Ni
2+
,Fe
2+
) [9,10], quercetin
dioxygenase (QDO) (Cu
2+
,Fe
2+
) [11,12], and homo-
protocatechuate 2,3-dioxygenase (Mn
2+
,Fe
2+
) [13,14],

further adds to the complexity of structure–function
relationships.
Fe
2+
cupins have recently attracted special atten-
tion because of the important roles that they play in
cell biology, such as DNA ⁄ RNA repair [15] and O
2
sensing [16]. Their ability to promote a wealth of
O
2
-dependent transformations has raised interest
among enzymologists and bioinorganic chemists. In
contrast to their catalytic versatility, the protein me-
tallocenters that bind the Fe
2+
display a remarkably
conserved structure [2,17–19]. A facial triad of two
histidines and one carboxylate residue (aspartate or
glutamate), exemplified by the metal centers of a
large class of 2-ketoglutarate-dependent oxygenases,
was long thought to form the canonical primary
coordination sphere for the Fe
2+
cofactor, as shown
in Fig. S1A [18].
With the expansion of the structural basis for Fe
2+
cupins, it has recently become clear that the original
two-motif structure of cupins, as in germin (Fig. S1B),

is also capable of forming a mononuclear nonheme
center for Fe
2+
, in which three histidines are coordi-
nated. Structurally characterized cupin oxygenases har-
boring this alternative Fe
2+
site are cysteine
dioxygenase (CDO) (Protein Data Bank identifier:
2ATF) [20], ARD (Protein Data Bank identifier:
1VR3) [21], QDO (Protein Data Bank identifiers:
1Y3T and 1JUH) [11,12], gentisate 1,2-dioxygenase
(Protein Data Bank identifiers: 2D40 and 3BU7)
[22,23], and b-diketone-cleaving dioxygenase (Dke1)
(Protein Data Bank identifier: 3BAL) [24]. Pirins are
nuclear proteins that also contain a three-histidine cen-
ter for Fe
2+
(Protein Data Bank identifiers: 1J1L and
1TQ5), and were recently shown to display QDO activ-
ity [25,26].
Advances in our knowledge of structure–activity
relationships for these and other three-histidine cen-
ters of Fe
2+
is currently limited by insufficient bio-
chemical evidence, and would benefit from the
characterization of novel cupin oxygenases of this
group. We identified an ORF in the genome of the
polychlorinated biphenyl-degrading proteobacterium

Burkholderia xenovorans through a database search in
which the cupin signature and the sequence of Dke1
from Acinetobacter johnsonii were used as queries.
The deduced primary structure of the novel cupin
protein Bxe_A2876 (UniProtKB: Q140Z1) and a
structural model derived from it suggested a cupin
protein featuring a three-histidine metal site. To
examine the unknown function of Bxe_A2876, we
performed a detailed biochemical characterization of
the recombinant protein produced in Escherichia coli.
A screening for O
2
-dependent enzyme activities elic-
ited by different combinations of metal and substrate
revealed that the Fe
2+
form of Bxe_A2876 was an
efficient catalyst of carbon–carbon bond cleavage in
b-diketone substrates. X-ray absorption spectroscopy
(XAS) was used to examine the coordination of Fe
2+
in the active site of the resting enzyme. The best fit
of the extended X-ray absorption fine structure (EX-
AFS) data indicated a five-coordinate or six-coordi-
nate Fe
2+
center that involves three nitrogen donors
from the histidine imidazole, one oxygen donor from
a carboxylate side chain, and one or two oxygen
donors from water. The Fe

2+
center of b-diketone-
cleaving oxygenase has not been previously character-
ized structurally.
Results
Structural properties of Bxe_A2876
Figure 1A shows a multiple alignment of the deduced
primary structure of Bxe_A2876 with the sequences of
Dke1 and a structurally characterized cupin protein
from Rubrivivax gelatinosus PM1 (Protein Data Bank
identifier: 2O1Q) that has been functionally annotated
as acetyl ⁄ propionyl-CoA carboxylase (RgCarb). The
three proteins share a high amount of sequence iden-
tity (equal to or > 50%) and homology (equal to or
> 70%). A homology model of Bxe_A2876 was there-
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5984 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS
fore constructed, and the obtained fold was aligned
with the crystallographically determined structures of
the subunits of Dke1 (Protein Data Bank identifer:
3BAL) and RgCarb (Fig. S2). Residue conservation in
the cupin two-motif structure of Bxe_A2876 suggests a
three-histidine metal center as in Dke1 and RgCarb
(Fig. 1A). A close-up view of the nonheme metal site
in the structural model of Bxe_A2876 is given in
Fig. 1B. It supports the proposed mode of coordina-
tion with His60, His62 and His102 as metal ligands.
Note that the coordinating histidines are contributed
from b-strands of the central cupin barrel, suggesting a
rather rigid metal-binding site. Residues in the immedi-

ate vicinity of the metal center (Glu96, Thr105,
Met115, Phe117 and Leu121 in Bxe_A2876) are con-
served in the modeled structure relative to the experi-
mentally determined protein structures. It is therefore
interesting to note that the crystal structures of Dke1
and RgCarb were both solved for the respective Zn
2+
-
bound proteins. However, Dke1 requires Fe
2+
to be
active as a b-diketone-cleaving oxygenase. The first
coordination sphere of Fe
2+
could thus be different
from that of Zn
2+
seen in the enzyme structure (see
Discussion).
On an SDS ⁄ polyacrylamide gel of recombinant
Bxe_A2876 isolated from E. coli BL21(DE3), the puri-
fied protein migrated as a single band to the approxi-
mate position in the gel that was expected from its
predicted subunit size of 16 kDa (Fig. S3, lane 3).
Prior to purification and intein-tag cleavage, the bacte-
rial cell extract displayed a clear protein band of a size
corresponding to the  75 kDa mass for the fusion of
Bxe_A2876 and the IMPACT tag (Fig. S3, lane 2).
We used dynamic light scattering (DLS) to evaluate
the multiplicity of protomers in a preparation of

Bxe_A2876 as isolated, and results unambiguously
showed the protein to be tetrameric. The calculated
molecular mass based on DLS data was 73 kDa, and
corresponds reasonably with the predicted molecular
mass of 64.4 kDa for the Bxe_A2876 homotetramer.
The relative distribution of secondary structure
elements of Bxe_A2876 derived from CD spectroscopic
data (Fig. 2) agreed very well with the findings from
the structure modeling studies.
Metal-dependent reactivities of Bxe_A2876
The protein as isolated from E. coli cell extracts
showed mixed fractional occupancy of its 16.1 kDa
subunit with metal ligands (0.06 copper; 0.11 iron;
0.17 zinc). We focused the quest for possible enzymatic
A
B
Fig. 1. Sequence analysis and structure modeling for Bxe_2876.
(A) Multiple sequence alignment of Bxe_A2876 with Acinetobac-
ter johnsonii Dke1 (AjDKE) and RgCarb (RgCAR). The sequence
alignment was performed with
ALIGNX as a component of
VECTOR NTI 9.0.0, using standard settings. Secondary structure
elements were manually assigned using the crystal structure of
RgCarb (Protein Data Bank: 2O1Q). H indicates a-helix, and –>
indicates b-strand. Metal ligands are shown in bold, and conserved
residues are shown in italic. (B) Predicted active site of Bxe_A2876
expanded 6 A
˚
around the metal center. Figures were created with
PYMOL 0.99 [53].

Fig. 2. CD spectrum of Bxe_A2876. Evaluation of the data was
performed with
DICHROWEB. The inset shows the distribution of
secondary structure elements. [h]
MRE
is the mean residual molar
ellipticity.
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5985
functions of Bxe_A2876 on O
2
-dependent substrate
transformations catalyzed by members of the cupin
superfamily. Considering the structural similarity to
Dke1, special emphasis was placed on enzymatic reac-
tions involving Fe
2+
as cofactor. Reactions that could
have been promoted by a Zn
2+
protein were not inves-
tigated.
Preparations of Bxe_A2876 reconstituted with Fe
2+
or Cu
2+
were completely inactive against superoxide.
These proteins did not consume detectable amounts
of O
2

when one of the following substrates was
offered to a protein solution containing 7 lm metal
sites: xanthine in the presence of 2-ketoglutarate; cat-
echol; or quercetin. However, when a series of b-dike-
tones were tested in combination with the Fe
2+
protein (see below), the activity of Bxe_A2876
towards O
2
was markedly stimulated as compared
with controls that contained apoprotein or lacked a
putative substrate. The Cu
2+
form of Bxe_A2876 did
not show activity under otherwise identical reaction
conditions.
The activity of Fe
2+
Bxe_A2876 with b-diketones
was characterized by comparing measurements of con-
sumption of O
2
and substrate with the formation of
detectable products. Figure S4 shows that conversion
of 2,4-pentanedione (5 mm) proceeded with depletion
of a molar equivalent of dissolved O
2
. HPLC analysis
of the products of the enzymatic transformation
revealed that Bxe_A2876 catalyzed breakdown of the

b-diketone substrate via oxidative carbon–carbon bond
cleavage to yield methylglyoxal and acetate.
Kinetic characterization of Fe
2+
Bxe_A2876
The activity of Bxe_A2876 in the O
2
-dependent con-
version of b-diketones was strictly dependent on the
Fe
2+
cofactor. We determined catalytic constants (k
cat
)
for different preparations of Bxe_A2876 whose frac-
tional occupancy with Fe
2+
varied between 0.1 and
0.9. Whereas the apparent value of k
cat
that was calcu-
lated from the V ⁄ [E] ratio (where V is the reaction rate
and [E] is the molar concentration of the 16 kDa
protein subunit) increased linearly with increasing
fractional saturation of the metal site in Bxe_A2876,
the k
cat
determined from the molar concentration of
Fe
2+

-containing active sites was constant. It had a
value of  0.8 s
)1
for air-saturated reaction conditions
at athmospheric pressure ( 250 lm O
2
). It was noted
that the dithiothreitol used in the intein cleavage step
of the purification protocol caused irreversible inacti-
vation of the purified enzyme (data not shown). We
therefore believe that dithiothreitol could be a source
of variation in the k
cat
of Bxe_A2876 preparations as
isolated. However, attempts to replace dithiothreitol
with b-mercaptoethanol (45 mm) or hydroxylamine
(50 mm) in the purification proved fruitless. The dura-
tion of exposure of Bxe_A2876 to dithiothreitol was
therefore kept as short as possible, and repeated cycles
of buffer exchange were used after the purification to
carefully remove any of the dithiothreitol still present
in solution. The reported kinetic data are for the of
Bxe_A2876 exhibiting a k
cat
of 0.8 s
)1
. The Michaelis
constant for 2,4-pentanedione was 5.1 lm (± 0.3 lm)
and independent of the fractional occupancy of
Bxe_A2876 with Fe

2+
.
To characterize substrate structural requirements
for the reaction catalyzed by Bxe_A2876, we tested a
series of b-diketones and related compounds in a two-
step assay. Enzyme substrates were first identified by
their ability to elicit O
2
consumption by Fe
2+
Bxe_A2876, and initial rate kinetic data were then
acquired by measuring spectroscopically the conversion
of the respective substrate. Previously reported molar
extinction coefficients for each active compound [27]
were confirmed and used in the determination of
reaction rates under conditions of apparent saturation
of the enzyme with the respective substrate. The
following k
cat
values were obtained: 0.4 s
)1
for 3,5-
heptanedione; 0.4 s
)1
for 2,4-octanedione; 0.2 s
)1
for
2,4-nonanedione; and 3.5 s
)1
for 2-acetylcyclohexa-

none. By way of comparison, k
cat
values of Bxe_A2876
were lower, by about one order of magnitude, than
the corresponding k
cat
values of Dke1 [28]. Bxe_A2876
was inactive towards 3,3-dimethylpentanedione, 1,3-
cyclohexanedione, and 4-methyl-2-oxovalerate, and
these compounds are likewise not turned over by
Dke1.
Bond cleavage selectivity
Unlike 2,4-pentanedione, whose symmetrical molecular
structure dictates that its conversion by Bxe_A2876
can yield only a single pair of products, carbon–carbon
bond cleavage in substrates harboring a different sub-
stituent on either side of the central b-diketone moiety
can proceed in one of two possible ways, each leading
to a characteristic pair of products. Scheme 1 shows
the possible reaction coordinates for 1-phenyl-1,3-
butanedione. We used HPLC analysis to determine the
distribution of products obtained upon enzymatic con-
version of a series of b-diketone substrates, which are
listed in Tables 1 and S4. The results reveal that the
bond cleavage selectivity of Bxe_A2876 was strongly
influenced by the structural properties of the substitu-
ents. The turnover number of the enzyme also showed
a large substituent effect.
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5986 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS

Scheme 1. Possible cleavage pathways of 1-phenyl-1,3-butanedione during enzymatic conversion by Bxe_A2876.
Table 1. Relative turnover numbers and cleavage ratios of 2,4-pentanedione and substituted variants. Activity measurements were per-
formed spectrophotometrically at 280 nm, where a decrease in absorbance reflects depletion of b-diketone substrate. Turnover numbers
were normalized using the k
cat
value for 2,4-pentanedione (0.8 s
)1
). Product analysis was performed by HPLC. The cleavage ratio is the ratio
of the concentrations of methylglyoxal (c
2
) and acetate (c
1
) formed upon conversion of unsymmetrical derivatives of 2,4-pentanedione. When
benzoylic substrates are used, the relevant ratio is that of phenylglyoxal (c
2
) and benzoate (c
1
). The preferred cleavage site in the respective
b-diketone substrate is indicated. The full set of experimental data used in the calculation of the cleavage ratio is shown in Table S4. NM,
not measured.
Structure Substrate Relative k
cat
Cleavage ratio, c
2
⁄ c
1
2,4-Pentanedione 1 1
1,1-Difluoro-2,4-pentanedione 2 · 10
)3
8.2

1,1,1-Trifluoro-2,4-pentanedione 3 · 10
)4
NM
1-Phenyl-1,3-butanedione 5 · 10
)2
0.3
4,4-Difluoro-1-phenyl-1,3-butanedione 4 · 10
)4
7.5
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5987
b-Diketone-cleaving oxygenase activity in
B. xenovorans
We examined growth and the formation of oxygenase
activity in B. xenovorans using the media listed in
Table S2. The strain did not grow on 2,4-pentanedione
as the sole carbon source. Growth was observed on a
mixed carbon source of glucose and 2,4-pentanedione.
However, it was much lower than in the ‘glucose-only’
medium, suggesting that 2,4-pentanedione inhibits the
growth of the organism (Table S3).
Crude cell extracts of B. xenovorans were analyzed
by SDS ⁄ PAGE. The distribution of protein bands on
the gel was not altered significantly in response to a
change in incubation conditions. A protein of about
16 kDa was not abundant in the cell extracts (data not
shown). However, the b-diketone-cleaving oxygenase
activity displayed by isolated preparations of recombi-
nant Bxe_A2876 was clearly present in B. xenovorans.
Cell extracts obtained from bacteria incubated in

the presence of glucose and 2,4-pentanedione con-
tained a low level of specific activity (£ 5mU
mg
)1
protein). By contrast, no activity was measured
in cells grown on glucose alone. Addition of 2.0 mm
Fe
2+
to the assay strongly enhanced the enzyme activ-
ity by a factor of 10–50. Interestingly, upon comple-
mentation with Fe
2+
, differences in specific activity for
cells grown in the presence and absence of 2,4-pentan-
edione were essentially eliminated at a level of
 100 mU mg
)1
(Table S3). The specific activities
measured in B. xenovorans can be compared to a value
of  1600 mU mg
)1
for the purified recombinant
enzyme.
Characterization of the nonheme Fe
2+
center by
XAS
Figure 3A displays the XANES spectrum of
Bxe_A2876 around the Fe
2+

absorption edge. The
pre-edge feature of the spectrum at energies near
7113 eV reveals a forbidden 1s fi 3d electronic tran-
sition that, according to prior studies of nonheme
Fe
2+
centers [29–31], is assigned to the mixing of the
4p orbital with the 3d orbital of the metal cofactor.
Two important pieces of information can be gleaned
from the pre-edge peak. First, occurrence of this tran-
sition implies distortion of the metal center from per-
fect octahedral geometry. Second, the area associated
with the peak was previously shown to provide a use-
ful measure of the coordination number of the Fe
2+
center [29–31]. The value of (12 ± 1) · 10
)2
eV there-
fore indicates that the Fe
2+
bound to Bxe_A2876 is
coordinated by a total of five ligand atoms.
An initial estimation of the first coordination shell
of Fe
2+
was made using abra [32]. The average of
the six best models lacked sulfur as Fe
2+
ligand, and
A

B
C
Fig. 3. X-ray absorption spectroscopy data for Bxe_A2876. (A)
Fe K-edge region in the XANES spectrum. (B) k
3
-weighted EXAFS
spectrum of Bxe_A2876 (solid line, black) overlaid by the fit model
of three histidines, one carboxylate, and one H
2
O (dotted line,
gray). v(k) is the EXAFS amplitude. See Table 2 for further details
of the fit. (C) Fourier transform (FT) of the EXAFS data. r is the
metal–ligand distance corrected for the phase shift.
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5988 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS
contained two or three nitrogen donors and three
oxygen donors at a distance of 2.00 A
˚
. Further refine-
ment was performed with excurv98, using various
models (Table S1) that incorporated histidine imidaz-
ole nitrogen atoms and different oxygen donor groups.
Separation of the single shell of scattering nitro-
gen ⁄ oxygen atoms into two shells (see center types 1
and 3 in Table S1) did not improve the goodness of fit
significantly, and gave differences in coordination
distance between the two shells (D  0.13–0.16 A
˚
) that
were generally at the limit of the resolution of the data

( 0.14 A
˚
). Nitrogen and oxygen donor groups could
not be distinguished with the methods used. However,
metal centers based on histidine imidazole nitrogen
donor groups clearly improved the goodness of fit, and
it was possible to identify a probable combination
of nitrogen and oxygen donor groups as well as the
corresponding metal–scatterer distances.
Figure 3B shows the EXAFS data together with the
best theoretical fit that we obtained. The suggestion
for the nonheme Fe
2+
center consists of three imidaz-
ole nitrogen atoms, one carboxylate oxygen atom from
either glutamate or aspartate, and one or two oxygen
atoms from water. The comparison of fits provided by
metal center type 8 (three histidines, two H
2
O) and
type 11 (three histidines, one carboxylate, one H
2
O)
gives strong support to the idea of a carboxylate oxy-
gen ligand for the Fe
2+
in Bxe_A2876. In particular,
the 3.1 A
˚
scatterer peak in the EXAFS spectra was

very well accounted for by center type 11, whereas it
was only poorly represented using center type 8. The
phase shift-corrected Fourier transform of the EXAFS
data is displayed in Figure 3C. Note that reasonable
Debye–Waller factors for all scattering atoms were
obtained using center type 11.
Discussion
Bxe_A2876 is an Fe
2+
-dependent oxygenase from
B. xenovorans that catalyzes the cleavage of carbon–
carbon bonds in b-diketone substrates. The enzyme is
not inducible by addition of b-diketone to the growth
medium. Cell extracts of B. xenovorans appear to
contain Bxe_A2876 largely in the inactive apo-form. It
is therefore possible that the enzyme recruits its redox-
active metal cofactor together with the substrate from
the solution complex of Fe
2+
and b-diketone, which is
known from the literature to be quite stable [33]. The
molecular and mechanistic properties of Bxe_A2876
are very similar to those of Dke1 (EC 1.13.11.50)
[28,34,35]. Evidence from XAS supports a five-coordi-
nate or six-coordinate Fe
2+
cofactor. Imidazole nitro-
gen atoms of His60, His62 and His102 and a
carboxylate oxygen atom, presumably contributed by
the side chain of Glu96, are suggested to function as

protein-derived ligands of the bound metal.
Mechanistic deductions from biochemical data
for Bxe_A2876
The proposed catalytic mechanism utilized by
Bxe_A2876 in the O
2
-dependent conversion of 2,4-pen-
tanedione is shown in Scheme 2. The results are
consistent with participation of Fe
2+
as a redox-active
cofactor in enzymatic catalysis of oxidative carbon–
carbon bond cleavage. However, a role of Fe
2+
as an
essential structural component of the active enzyme
cannot be definitely ruled out on the basis of the data
presented.
As in Dke1, an important prerequisite for b-dike-
tones to be accepted as substrates of Bxe_A2876
appears to be the ability to rearrange into a cis-b-
keto–enol structure. The required structure is not
accessible, for chemical and steric reasons, respectively,
in 3,3-dimethylpentanedione and 1,3-cyclohexanedione.
Productive binding of 2,4-pentanedione and cognate
b-diketones probably involves coordination to the
Fe
2+
cofactor as cis-b-keto–enolates, as shown in
Scheme 2.

From the literature [28,34,35], the b-diketone bound
at the active site of Bxe_A2876 would seem to undergo
O
2
-dependent transformation into a C-3 peroxo inter-
mediate. Fe
2+
is expected to provide essential catalytic
assistance for this conversion. The low reactivity of
substrates harboring electron-withdrawing substituents
such as fluorine (Table 1) is explicable by a chemical
Scheme 2 Proposed reaction mechanism of Bxe_A2876.
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5989
mechanism in which strong nucleophilic participation
of the substrate is required during the initial reduction
of O
2
[28,34–36].
Previous studies of Dke1 have also shown that elec-
tronic substituent effects on the distribution of prod-
ucts resulting from the cleavage of the b-diketone
substrate provide useful insights into the enzymatic
mechanism of carbon–carbon bond fission. Note, how-
ever, that the substituent effects governing the bond
cleavage steps are not the same as those controlling
the reactivity towards O
2
; hence the formation of the
proposed peroxo intermediate, which is rate-limiting

in the reaction catalyzed by Dke1 [35]. Upon intro-
duction of the strongly electron-withdrawing difluoro-
methyl group, a marked shift in bond cleavage
specificity was observed as compared with the
corresponding specificity for the unsubstituted parent
substrate (Tables 1 and S4). The measured preference
for bond cleavage at the more electron-deficient
carbonyl carbon of the b-diketone moiety is consistent
with a nucleophilic mechanism of carbon–carbon bond
fission, where the C-3 peroxo intermediate undergoes
decomposition via a dioxetane (see [34,35] for a
detailed discussion). It is proposed in Scheme 2 that
the distal oxygen of the peroxidate performs an intra-
molecular attack on a neighboring carbonyl carbon,
preferably the one that harbors the relatively more
strongly electron-withdrawing substituent (e.g. –CHF
2
as compared with –CH
3
), to yield the dioxetane,
from which products are finally generated through
concerted C–C and O–O bond cleavage. From the
evidence reported herein, as well as the previous mech-
anistic analysis for Dke1 [34], a Criegee rearrangement
mechanism of bond cleavage by Bxe_A2876 seems
unlikely.
The three-histidine center of Fe
2+
in Bxe_A2876
Results of analysis of the X-ray absorption spectra

arising from the Fe
2+
in Bxe_A2876 are consistent
with five or six nitrogen ⁄ oxygen ligands of the bound
metal. Although X-ray absorption near-edge structure
(XANES) data favor a five-coordinate Fe
2+
, the pres-
ence of six donor groups, as in the related Fe
2+
sites
of CDO [27], human pirin [25,26], and gentisate 1,2-
dioxygenase [22,23], cannot be definitely ruled out. The
modeled structure of the nonheme metal site of
Bxe_A2876 (Fig. 1B) predicts that three nitrogen
donor ligands are contributed by the side chains of the
cupin triad of histidines, His60, His62, and His102.
This is in excellent agreement with the suggestion from
EXAFS analysis that three nitrogen atoms from the
histidine imidazole coordinate the Fe
2+
.
EXAFS data further suggest that the Fe
2+
center of
Bxe_A2876 does not involve a sulfur donor ligand,
again consistent with the model of the active site
(Fig. 1B), which has no candidate cysteine within a
realistic coordination distance from the likely position
of the Fe

2+
. There is, however, strong evidence from
the EXAFS analysis that the Fe
2+
cofactor is coordi-
nated by an oxygen donor group derived from the
carboxylate side chain of either a glutamate or an
aspartate. The apparent conflict of this finding with
the absence of a coordinating carboxylate in the mod-
eled metal center of Bxe_A2876 is reconciled by
considering that the template structures used for
homology modeling are for cupin proteins (Dke1,
RgCarb) in their respective Zn
2+
-bound form. Accom-
modation of Fe
2+
in the metallocenter may require a
subtly different active site conformation from that
employed for the binding of Zn
2+
. In a previous study
of ARD, it was shown that similar, but not identical,
metal-binding modes are exploited for the coordination
of Fe
2+
and Ni
2+
cofactors. However, the enzyme is
active with both metal ions, despite different catalytic

pathways [37].
From the structure model of Bxe_A2876, the most
plausible candidate amino acid coordinating Fe
2+
would be Glu96. In a Zn
2+
-bound enzyme that was
completely inactive as a b-diketone-cleaving oxygenase
(data not shown) and therefore was not investigated
here, this glutamate could adopt an alternative, nonco-
ordinating, conformation that orients its carboxylate
side chain out of the metal center (Fig. 1B), as
observed for homologous glutamate residues in the
crystal structures of Zn
2+
-Dke1 and Zn
2+
-RgCarb.
The proposed Fe
2+
center (three histidines, one gluta-
mate, and one or two H
2
O) for Bxe_A2876 in the rest-
ing state is therefore novel among b-diketone-cleaving
oxygenases of the cupin protein superfamily, and
significantly advances our knowledge of the structural–
mechanistic basis for this group of enzymes. The opti-
mized metal–ligand distances (Table 2) compare very
favorably with data in the protein database, from

which an average distance of 2.03 A
˚
for Fe–N(His)
was inferred [38], and a target distance of between 1.93
and 2.13 A
˚
for Fe–O was obtained [39]. Considering
the proposed mode of substrate coordination by the
Fe
2+
of Bxe_A2876 (Scheme 2), it seems probable that
metal ligation by protein side chains undergoes a
change as result of binding of the b-diketone. Mecha-
nistically, a five-coordinate Fe
2+
in the enzyme–
substrate complex, as implied by Scheme 2, would
leave one coordination site on the catalytic metal for
reaction with O
2
. Work on QDO provides a relevant
example, showing that the side chain of the glutamate
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5990 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS
participating in metal coordination in the free enzyme
rotates away upon accommodation of the substrate in
the active site [40]. The possibility of Glu96 also
adopting a noncoordinating position in Bxe_A2876
has been mentioned.
The model for the nonheme Fe

2+
center of
Bxe_A2876, as derived by the combination of mole-
cular modeling and XAS, is similar to related three-
histidine metal sites which were characterized by X-ray
crystallography [20,21,41,42], XAS [27,37], or a combi-
nation of the two methods [27,41]. The three-histidine
one-glutamate type of metal coordination was found
in high-resolution structures of resting state forms of
Cu
2+
-QDO [40], Ni
2+
-ARD [21], and Fe
2+
-pirin [25].
Metal coordination by a tetrad of three histidines
and one glutamate was likewise seen in other members
of the cupin protein superfamily, including oxalate
oxidase (germin) [6]. Interestingly, the position of
the glutamate ligand was not conserved in the amino
acid sequence, relative to the cupin core motifs that
contribute the three histidine ligands in each of these
proteins.
For QDO, XAS studies were performed with the
Cu
2+
enzyme [43]. XAS data for rat CDO in the rest-
ing state and in complex with l-cysteine were both
consistent with six nitrogen or oxygen donor ligands

being bound to the Fe
2+
at average distances of
2.04 A
˚
and 2.12 A
˚
, respectively [27]. In resting ARD,
the Fe
2+
was also six-coordinate and had two nitro-
gen(oxygen) donor ligands at an average distance of
1.90 A
˚
and four nitrogen(oxygen) ligands at an
average distance of 2.06 A
˚
. Three of the four ligands
were reported to be consistent with histidine imidazole
side chains. Upon formation of the ARD–acireductone
complex, the best fit of the EXAFS suggested three
nitrogen(oxygen) donor ligands at an average distance
of 1.92 A
˚
and three nitrogen(oxygen) donor ligands at
an average distance of 2.15 A
˚
, one of which was an
imidazole side chain of histidine [37]. Interestingly, the
prominent second sphere feature at a distance of about

3.15 A
˚
in the Fourier transform of the EXAFS spec-
trum of Bxe_A2876 (Fig. 3C) was not observed in the
corresponding spectra of CDO and ARD, suggesting
subtle differences in the coordination of Fe
2+
by
Bxe_A2876 as compared with the other two enzymes.
The active site of resting QDO was equally well
described by four or five ligands of Cu
2+
(three nitro-
gen donors from the histidine imidazole and one or
two oxygen donors) at an average distance of 2.00 A
˚
.
In the anaerobic complex of QDO and quercetin, the
Cu
2+
was five-coordinate, with three histidine nitrogen
donors and two oxygen donors in a single shell at
2.00 A
˚
[43].
Collectively, the XAS analysis for the Fe
2+
bound
to Bxe_A2876 makes an important contribution to the
characterization of the emerging three-histidine group

of nonheme Fe
2+
centers. The results obtained are in
useful agreement overall with suggestions from struc-
ture modeling studies of Bxe_A2876. The XAS data
indicate that binding of Fe
2+
may require a different
active site conformation than binding of Zn
2+
. Flexi-
bility of the conserved Glu96 could have a role in
determining metal-binding selectivity. An immediate
question that arises upon comparison of the XAS data
for Bxe_A2876, CDO and ARD pertains to the rela-
tionship between coordination of the catalytic metal
and reactivity in different O
2
-dependent transforma-
tions. Examination of the function of noncoordinating
Table 2. Proposed ligand environment of the iron bound in the active site of Bxe_A2876 in the resting state, as derived from EXAFS data
analysis (fit 2). The ‘best-fit’ model (fit 2) is compared with one of the initial models considered (fit 1). See Table S1 for further details of
EXAFS data analysis. N is the number of ligands, r is the distance to the central iron atom, and r
2
is the Debye–Waller factor. The k-range is
2–13 A
˚
)1
. See Table S1 for further details of EXAFS data analysis.
Fit Ligand Atom type Nr(A

˚
) r
2
(A
˚
2
) E
0
(eV) R-factor (%) Fit index
1N⁄ O 5 2.02 0.013 )5.65 35.61 0.2207
2 His N 3 1.98 0.008
a
C 3.04 0.012
b
C 3.13 0.012
b
N 4.06 0.016
c
C 4.31 0.016
c
)6.57 16.65 0.0134
Glu O 1 2.04 0.008
a
C 3.31 0.012
b
O 4.28 0.012
b
C 3.83 0.012
b
H

2
O O 1 2.08 0.008
a
a,b,c
The Debye-Waller factors were grouped and refined in batches (a, b and c).
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5991
residues in and around the active site may provide the
answer. Systematic comparison of biochemical infor-
mation with structural evidence for different three-
histidine cupin enzymes will hopefully lead to the
identification of fingerprint regions that determine
metal-binding selectivity and catalytic activity (see
the recent work on ARD [37]). Within the cupin super-
family of proteins, structure-based distinction between
Fe
2+
and Mn
2+
forms of SOD provides an interesting
example [8].
Experimental procedures
Materials
B. xenovorans LB400 was obtained from the Belgian
Co-ordinated Collections of Micro-organisms (BCCM,
Gent, Belgium), deposited under accession number
LMG 21463. It was grown using a protocol supplied by
BCCM. All chemicals were purchased from Sigma-Aldrich
(Gillingham, UK) in the highest available purity. B-Per and
the bicinchoninic acid assay were from Thermo Scientific

(Waltham, MA, USA). All materials for genetic work were
obtained from New England Biolabs (Beverly, MA, USA)
and Fermentas International Inc. (Burlington, Canada).
Cultivation
Table S2 summarizes the different conditions in which the
B. xenovorans strain was incubated to examine growth and
the formation of oxygenase activity. All experiments were
performed in 80 mL shaken flasks at 30 °C, using an agita-
tion rate of 110 r.p.m. Bacteria obtained after growth for
48 h in medium B2 were used for inoculation of 250 mL of
medium to an initial attenuance at 600 nm of  0.4. Culti-
vation was continued for 48 h, and cells were harvested by
centrifugation (15 min, 4 °C, 4400 g). Crude cell extract
was prepared by lysis with B-Per reagent, following the
manufacturer’s protocol. The protein concentration was
determined using the bicinchoninic acid assay, and oxygen-
ase activity measurement was performed using the photo-
metric and HPLC assay described below. The activity of
the crude extract was expressed as mUÆmg
)1
protein. One
unit is defined as the amount of enzyme needed for the con-
version of 1 lmol acetylacetone min
)1
.
Cloning
The gene encoding Bxe_A2876 (accession number
gi:91782944) was amplified from genomic DNA of B. xenovo-
rans LB400 through a PCR with GAGCGG
CATATGGA

AATCAAACCGAAGGTTCGCGA and GAGCGG
CATA
TGGAAATCAAACCGAAGGTTCGCGA as the forward
and reverse oligonucleotide primers, respectively. The
primers were designed to introduce restriction sites (under-
lined) for NdeI and SapI, respectively. The amplified gene
and a pTYB1 plasmid vector were digested with NdeI and
SapI in a one-pot reaction at 37 °C for 1 h. After purification
of the DNA by precipitation with ethanol, the gene was
ligated with the pTYB1 vector using T4 DNA ligase in an
overnight reaction at room temperature. Following degrada-
tion of empty plasmid by XhoI (37 °C, 1 h), the ligation
mixture was transformed into E. coli TOP10 cells by electro-
poration. Cells were subsequently transferred to LB–ampicil-
lin plates. Single colonies were picked, and plasmids were
isolated with a QIAprep spin Miniprep Kit from Qiagen
(Hilden, Germany). Positive clones were selected by restric-
tion analysis with ClaI and sequenced (MWG Biotech,
Ebersberg, Germany). The pTYB1 vector harboring the
target gene was transferred into the expression strain
E. coli BL21(DE3). It encodes a chimeric form of
Bxe_A2876 that has the IMPACT tag fused to the authentic
C-terminal Gly145.
Expression and purification
Recombinant protein was produced by cultivating the
expression strain in shaking flasks containing LB medium
supplemented with 100 lgÆ mL
)1
ampicillin. The media were
inoculated to an attenuance at 595 nm (D

595 nm
) of 0.1 with
an overnight preculture of E. coli BL21(DE3). The strain
was incubated at 37 °C and 120 r.p.m. to a D
595 nm
of 0.6,
the temperature was reduced to 15 °C, and expression of the
target protein was initiated by addition of 250 lm isopropyl
thio-b-d-galactoside. Cells were harvested after approxi-
mately 20 h, resuspended in about the same volume of
20 mm Tris ⁄ HCl buffer (pH 7.5), and then disrupted by two
passages through a French press (American Instruments
Company, Silver Spring, MD, USA) operated at  8 MPa.
The cell-free extract was subsequently passed over a chi-
tin bead column (New England Biolabs, Beverly, MA,
USA), with a column volume of 15 mL. The column had
already been equilibrated with 10 column volumes of buf-
fer A (20 mm Tris ⁄ HCl, pH 7.5, 500 mm NaCl, 0.1%
Triton X). After the crude extract had been applied
( 650 mg of protein), the column was washed with 20
column volumes of buffer A, followed by three column
volumes of buffer B (20 mm Tris ⁄ HCl, pH 7.5, 500 mm
NaCl). Buffer B supplemented with 5 mm dithiothreitol
was employed to induce intein cleavage for 16 h at 15 °C.
The eluted protein was concentrated using Vivaspin concen-
trator tubes (M
r
cut-off of 10 000; Sartorius Stedim Biotech
S.A., Aubagne, France), and, finally, buffer was exchanged
in three cycles with 20 mm Tris ⁄ HCl (pH 7.5), with NAP

columns (GE Healthcare, Chalfont St Giles, UK). Purifica-
tion was checked by SDS ⁄ PAGE. Protein solutions
( 5mgÆmL
)1
) were stored in 100 lL aliquots at )20 °C
until further use. Repeated freeze–thaw cycles of the protein
stock solution were avoided.
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5992 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS
Sequence analysis and protein structure
modeling
vector nti 10.3.0 (Invitrogen, Carlsbad, CA, USA) was
used for sequence analysis. The alignx module, which uses
a modified clustalw algorithm, was employed for multiple
sequence alignments. Results of the automated alignment
were adjusted manually when necessary. Homology model-
ing of protein folds was performed using the program mod-
eller 9v2 [44]. Quality assessment of modeled protein
structures was performed by calculating the Ramachandran
plot with the program sirius (San Diego Supercomputer
Center, San Diego, CA, USA).
Metal analysis
This was performed with an inductively coupled plasma
optical emission spectrometer (Spectro Ciros Vision EOP,
Kleve, Germany) calibrated with Fe, Zn, Cu, Ni and Mn
standards in the range £ 500 lgÆL
)1
. The wavelengths used
were 238.204 nm (Fe), 213.856 nm (Zn), 324.754 nm (Cu),
231.604 nm (Ni), and 259.373 nm (Mn). Sample solutions

containing, typically, 17 mg of purified protein were pre-
pared in a mixture of 2 mL each of concentrated double-
distilled nitric acid, hydrochloric acid, and ultrapure water.
They were processed by microwave-assisted combustion
with a Multiwave 3000 microwave sample preparation
system (Anton Paar, Graz, Austria), using high-pressure
quartz vessels at 1400 W for 30 min [45]. Prior to measure-
ment, each sample was diluted 10-fold with water.
Reversible binding of Fe
2+
to Bxe_A2876
Metal-depleted Bxe_A2876 was prepared using Slide-A-
Lyzer 2K molecular weight cut-off dialysis cassettes (Pierce
Biotechnology, Rockford, IL, USA). About 1500 lLofa
solution containing 5 mg purified protein ⁄ mL was used.
Dialysis was performed at 4 °C for  48 h against 20 mm
Tris ⁄ HCl (pH 7.5), which was supplemented with 2 mm
EDTA for the first 12 h of the procedure. It was proven
that the protein preparation thus obtained did not contain
bound metal within the limits of detection of the analytical
methods used.
The apo-form of Bxe_A2876 was dissolved to a concen-
tration of 200 lm in 20 mm Tris ⁄ HCl (pH 7.5), and incu-
bated on ice in the presence of a 10-fold molar excess of
FeSO
4
over protein subunit of 16.1 kDa. The buffer and
the metal solutions used had been made micro-aerobic
(£ 15 lm dissolved O
2

) through repeated cycles of filtration
and purging with N
2
. To prevent oxidation of Fe
2+
,2mm
sodium l-ascorbate was added. After about 1 h of incuba-
tion, unbound Fe
2+
was removed by three cycles of
buffer exchange using NAP columns (GE Healthcare), and
the enzyme was concentrated with Vivaspin concentrator
tubes.
Spectrophotometric assays
These were performed at 25 °C, using a DU 800 UV–visible
spectrophotometer (Beckmann Coulter, Inc., Fullerton, CA,
USA). Unless otherwise specified, 20 mm Tris ⁄ HCl
(pH 7.5) was used in all experiments.
Protein-bound iron
FereneS was added in a final concentration of 20 mm to
the protein sample to give a total volume of 600 lL and a
protein concentration in the range 5–10 lm. The formation
of a colored complex between FereneS and Fe(II) in solu-
tion was monitored at 592 nm. The sample was incubated
directly in the cell holder of the spectrophotometer until the
absorbance had reached a constant value (typically 6–8 h,
or overnight). The extinction coefficient for the Fe
2+
com-
plex (e

592
= 35.5 mm
)1
Æcm
)1
) [46] was used to determine
the metal concentration.
O
2
-dependent conversion of b-diketones
Air-saturated buffer containing about 250 lm O
2
was used.
The concentration of the b-diketone substrate was 170 lm.
Reactions were performed in a total volume of 600 lL,
which contained 10 lL of enzyme, appropriately diluted to
measure the initial rate. The enzymatic rate was obtained
from the linear plot of substrate converted against the reac-
tion time (£ 2 min). Substrate consumption was monitored
from the decrease in absorbance at 280 nm, which reflects
breakdown of the b-diketone moiety. The following molar
extinction coefficients (e
280
) were used [28]: 2,4-pentanedi-
one, 2240 m
)1
Æcm
)1
; 3,5-heptanedione, 1200 m
)1

Æcm
)1
; 2,4-
octanedione, 1200 m
)1
Æcm
)1
; and 2-acetylcyclohexanone,
2400 m
)1
Æcm
)1
. Values of e
280
from the literature [28] were
confirmed under the conditions used here. The e
280 nm
value
for 2,4-nonanedione was determined to be 2240 m
)1
Æcm
)1
.
SOD activity
Bxe_A2876 was tested for SOD activity by adding a puri-
fied protein preparation to the assay in a final concentra-
tion of 10 lm Fe
2+
sites. A coupled enzymatic assay was
used and performed at 25 °Cin50mm potassium phos-

phate buffer (pH 7.8). The reaction mixture of 1 mL con-
tained 0.01 mm cytochrome c, 0.05 mm xanthine, and
0.005 U of xanthine oxidase from bovine milk (Sigma-
Aldrich, Gillingham, UK). Production of superoxide by
xanthine oxidase was followed indirectly by measuring the
increase in absorbance at 550 nm resulting from cyto-
chrome c being reduced by superoxide in the course of the
reaction. The principle of the assay is that the presence of a
SOD inhibits the reduction of cytochrome c. This was vali-
dated by adding a total of 2.5 U of commercial SOD from
bovine erythrocytes (Sigma-Aldrich, Gillingham, UK) to
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5993
the assay. Experiments were performed in the presence and
absence of 0.1 mm EDTA, and yielded similar results.
Activity towards quercetin
The substrate solution contained 50 lm quercetin in 50 mm
Tris ⁄ HCl (pH 7.5), supplemented with 100 mm NaCl and
5% (v ⁄ v) dimethylsulfoxide. Purified Bxe_A2876 was added
in a final concentration of 4 lm metal sites. Reactions were
performed in the absence and presence of 2 mm CuSO
4
.
Conversion of quercetin was monitored from the decrease
in absorbance at 380 nm, using a reported molar extinction
coefficient of 18 500 m
)1
Æcm
)1
[47].

Measurement of O
2
consumption
An oxygen electrode cell (Digital Oxygen System model 10;
Rank Brothers, Cambridge, UK) was used to measure the
consumption of O
2
in the course of reactions catalyzed by
Bxe_A2876. The working solution had a controlled temper-
ature of 25 °C, and consisted of 20 mm Tris ⁄ HCl (pH 7.5).
The protein concentration was between 2 lm and 7 lm.
The following substrates were tested: 2,4-pentanedione
(200 lm, added in aliquots of 35 lm or 70 lm from a
3.7 mm stock solution); xanthine (360 lm) in the presence
of 2-ketoglutarate (1 mm); catechol (200 lm); and quercetin
(170 lm). The duration of the assay varied from a few
minutes (2,4-pentanedione) to 0.5 h (other substrates).
CD spectroscopy
Far-UV CD spectra were recorded with a Jasco J-715 spec-
tropolarimeter (Tokyo, Japan) at room temperature, using
0.02 cm and 0.10 cm path length cylindrical cells. The
following instrument parameters were applied: step resolu-
tion, 0.2 nm; scan speed, 50 nmÆmin
)1
; response, 1 s; and
bandwidth, 1 nm. Bxe_A2876 in both the apo-form and
Fe
2+
-reconstituted form (or as isolated from E. coli) was
dissolved to a concentration of  0.15 mgÆmL

)1
in 20 mm
potassium phosphate buffer (pH 7.5), and analyzed. Tripli-
cate spectra obtained in the wavelength range 260–190 nm
were subsequently averaged and corrected by a blank
spectrum lacking enzyme before conversion of the CD
signal to mean residue ellipticity. Data were eventually
processed with the program dichroweb [48,49].
DLS
This was performed at 20 °C using an Fe
2+
-saturated prep-
aration of purified Bxe _A2876 dissolved to 1.0 mgÆmL
)1
in
20 mm potassium phosphate buffer (pH 7.5). Prior to mea-
surement, the protein sample was thoroughly centrifuged
(10 min, 16 000 g) to remove insoluble aggregates, and
45 lL of the supernatant was transferred to a cylindrical
quartz cuvette. Data were recorded using a Protein Solu-
tions DynaPro DLS instrument (Wyatt Technology Corpo-
ration, Santa Barbara, CA, USA), with the diode laser
wavelength and the sampling time set to 824.2 nm and
10 s, respectively. dynamics version 6 (Wyatt Technology
Corporation) was used to obtain hydrodynamic radius
distributions and the molecular mass distribution.
HPLC analysis of O
2
-dependent enzymatic
conversion of b-diketones

Reactions were carried out in a total volume of 0.5 mL
containing between 5 lm and 25 lm Bxe_A2876 that had
been reconstituted with Fe
2+
. The conversion of aliphatic
b-diketone substrates (2,4-pentanedione, 5 mm; 1-difluoro-
2,4-pentanedione, 2 mm; 1,1,1-trifluoro-2,4-pentanedione,
2mm) was examined in 20 m m sodium citrate buffer
(pH 7.5). A 20 mm sodium phosphate buffer (pH 7.5) was
used with aromatic b-diketones (1-phenyl-1,3-butanedione,
0.5 mm; 4,4-difluoro-1-phenyl-1,3-butanedione, 0.2 mm).
Each buffer contained about 250 lm O
2
. Incubation was at
25 °C for about 3 h. The reaction mixtures were centrifuged
(2 min, 16 000 g), and subsequently analyzed by HPLC
using a Merck-Hitachi La Chrom system (Darmstadt,
Germany) equipped with an Aminex HPX-87H column
(Biorad, Hercules, CA, USA) as well as with UV and RI
detectors. Elution was performed with sulfuric acid
(0.005 m) at a flow rate of 0.6 mLÆmin
)1
, and a column
temperature of 65 °C was used.
XAS measurements
Sample preparation
The Fe
2+
-reconstituted form of Bxe_A2876 was prepared
as described above. The protein was then concentrated to

 1mm in 20 mm Tris ⁄ HCl (pH 7.5), supplemented with
20% glycerol (v ⁄ v) as cryoprotectant. It was loaded into
plastic holders of 1 mm thickness with polyimide windows,
and immediately flash-frozen in liquid nitrogen.
XAS measurements
These were carried out at 20 K, using the facilities at
EMBL Hamburg (DESY, EXAFS beamline D2, Hamburg,
Germany) with the DORIS storage ring operated at
4.5 GeV. An Si(111) double-crystal monochromator
scanned X-ray energies around the Fe K-edge (6.9–
7.85 keV). Harmonic rejection was achieved by a focusing
mirror (cut-off energy at 20.5 keV) and monochromator
detuning to 50% of its peak intensity. The X-ray absorp-
tion spectra were recorded as Fe K
a
fluorescence spectra
with a Canberra 13-element Ge solid-state detector. Data
reduction, such as background removal, normalization, and
extraction of the fine structure, was performed with kemp
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5994 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS
[50], assuming a threshold energy E
0,Fe
= 7120 eV. Sample
integrity during exposure to synchrotron radiation was
checked by monitoring the position and shape of the
absorption edge on sequential scans. No changes were
detectable.
Methods used in XANES and EXAFS analyses
winxas [51] was used to fit the pre-edge peak around

7113 eV in the XANES spectrum. A combination of two
pseudo-Voigt functions and a polynomial equation of first
order were employed. The difference between the fitted
background and the spectrum was integrated. The apparent
edge energy of the sample was determined as the maximum
of the first derivative of the XANES spectrum.
The extracted Fe K-edge (25–730 eV) EXAFS data were
converted to photoelectron wave vector k-space and weighted
by k
3
. A screening for models fitting the data was performed
with abra [32]. Spectra were then refined with excurv98
[52], with the theoretical EXAFS spectra being calculated for
defined structural models based on the curved-wave theory.
Parameters of each structural model, namely the atomic
distances (R), the Debye–Waller factors (2r
2
), and a residual
shift of the energy origin (EF) were refined, minimizing the
fit index (R
EXAFS
) [52]. An amplitude reduction factor
(AFAC) of 1.0 was used throughout data analysis.
Acknowledgements
This work was financially supported by Graz Univer-
sity of Technology. XAS data were recorded at the
EMBL EXAFS beamline D2 at DESY (Deutsches
Elektronen Synchrotron). We thank G. Wellenreuther
and W. Meyer-Klaucke for data collection and assis-
tance in data evaluation. The assistance of T. Pavkov

(Institute of Chemistry, University of Graz) in the
acquisition of CD and DLS data is gratefully acknowl-
edged. B. Kuczewski and H. Wiltsche (Institute of
Analytical Chemistry and Radiochemistry, Graz Uni-
versity of Technology) are thanked for metal analysis.
G. D. Straganz acknowledges support from the Aus-
trian Science Funds (FWF), project number P18828.
References
1 Khuri S, Bakker FT & Dunwell JM (2001) Phylogeny,
function, and evolution of the cupins, a structurally
conserved, functionally diverse superfamily of proteins.
Mol Biol Evol 18, 593–605.
2 Dunwell JM, Purvis A & Khuri S (2004) Cupins: the
most functionally diverse protein superfamily? Phyto-
chemistry 65, 7–17.
3 Cleasby A, Wonacott A, Skarzynski T, Hubbard RE,
Davies GJ, Proudfoot AE, Bernard AR, Payton MA &
Wells TN (1996) The x-ray crystal structure of phos-
phomannose isomerase from Candida albicans at 1.7 A
˚
resolution. Nat Struct Biol 3, 470–479.
4 Raymond S, Tocilj A, Ajamian E, Li Y, Hung MN,
Matte A & Cygler M (2005) Crystal structure of ureido-
glycolate hydrolase (AllA) from Escherichia coli
O157:H7. Proteins 61, 454–459.
5 Titus GP, Mueller HA, Burgner J, Rodriguez Cordoba
De S, Penalva MA & Timm DE (2000) Crystal struc-
ture of human homogentisate dioxygenase. Nat Struct
Biol 7, 542–546.
6 Anand R, Dorrestein PC, Kinsland C, Begley TP &

Ealick SE (2002) Structure of oxalate decarboxylase
from Bacillus subtilis at 1.75 A
˚
resolution. Biochemistry
41, 7659–7669.
7 Andreini C, Bertini I, Cavallaro G, Najmanovich RJ &
Thornton JM (2009) Structural analysis of metal sites in
proteins: non-heme iron sites as a case study. J Mol
Biol 388, 356–380.
8 Wintjens R, Gilis D & Rooman M (2008) Mn ⁄ Fe
superoxide dismutase interaction fingerprints and
prediction of oligomerization and metal cofactor from
sequence. Proteins 70 , 1564–1577.
9 Dai Y, Wensink PC & Abeles RH (1999) One protein,
two enzymes. J Biol Chem 274, 1193–1195.
10 Dai Y, Pochapsky TC & Abeles RH (2001) Mechanistic
studies of two dioxygenases in the methionine salvage
pathway of Klebsiella pneumoniae. Biochemistry 40,
6379–6387.
11 Fusetti F, Schroter KH, Steiner RA, van Noort PI,
Pijning T, Rozeboom HJ, Kalk KH, Egmond MR &
Dijkstra BW (2002) Crystal structure of the copper-
containing quercetin 2,3-dioxygenase from
Aspergillus japonicus. Structure 10, 259–268.
12 Gopal B, Madan LL, Betz SF & Kossiakoff AA (2005)
The crystal structure of a quercetin 2,3-dioxygenase
from Bacillus subtilis suggests modulation of enzyme
activity by a change in the metal ion at the active
site(s). Biochemistry 44, 193–201.
13 Vetting MW, Wackett LP, Que L Jr, Lipscomb JD &

Ohlendorf DH (2004) Crystallographic comparison of
manganese- and iron-dependent homoprotocatechuate
2,3-dioxygenases. J Bacteriol 186, 1945–1958.
14 Emerson JP, Kovaleva EG, Farquhar ER, Lipscomb
JD & Que L Jr (2008) Swapping metals in Fe- and Mn-
dependent dioxygenases: evidence for oxygen activation
without a change in metal redox state. Proc Natl Acad
Sci USA 105, 7347–7352.
15 Yu B, Edstrom WC, Benach J, Hamuro Y, Weber PC,
Gibney BR & Hunt JF (2006) Crystal structures of
catalytic complexes of the oxidative DNA
⁄ RNA repair
enzyme AlkB. Nature 439, 879–884.
16 McDonough MA, Li V, Flashman E, Chowdhury R,
Mohr C, Lienard BM, Zondlo J, Oldham NJ, Clifton
IJ, Lewis J et al. (2006) Cellular oxygen sensing: crystal
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5995
structure of hypoxia-inducible factor prolyl hydroxylase
(PHD2). Proc Natl Acad Sci USA 103, 9814–9819.
17 Joseph CA & Maroney MJ (2007) Cysteine Dioxy-
genase: Structure and Mechanism. Chem Commun 32,
3338–3349.
18 Clifton IJ, McDonough MA, Ehrismann D, Kershaw
NJ, Granatino N & Schofield CJ (2006) Structural
studies on 2-oxoglutarate oxygenases and related
double-stranded b-helix fold proteins. J Inorg Biochem
100, 644–669.
19 Hausinger RP (2004) Fe(II) ⁄ a-ketoglutarate-dependent
hydroxylases and related enzymes. Crit Rev Biochem

Mol Biol 39, 21–68.
20 McCoy JG, Bailey LJ, Bitto E, Bingman CA, Aceti DJ,
Fox BG & Phillips GN Jr (2006) Structure and mecha-
nism of mouse cysteine dioxygenase. Proc Natl Acad
Sci USA 103, 3084–3089.
21 Xu Q, Schwarzenbacher R, Sri Krishna S, McMullan
D, Agarwalla S, Quijano K, Abdubek P, Ambing E,
Axelrod H, Biorac T et al. (2006) Crystal structure of
acireductone dioxygenase (ARD) from Mus musculus at
2.06 A
˚
resolution. Proteins 64, 808–813.
22 Chen J, Li W, Wang M, Zhu G, Liu D, Sun F, Hao N,
Li X, Rao Z & Zhang XC (2008) Crystal structure and
mutagenic analysis of GDOsp, a gentisate 1,2-dioxygen-
ase from Silicibacter pomeroyi. Protein Sci 17, 1362–
1373.
23 Adams MA, Singh VK, Keller BO & Jia Z (2006)
Structural and biochemical characterization of gentisate
1,2-dioxygenase from Escherichia coli O157:H7. Mol
Microbiol 61, 1469–1484.
24 Stranzl GR (2002) X-ray crystal structure of acetylace-
tone-cleaving dioxygenase of Acinetobacter johnsonii
and NMR evidence for a strong short hydrogen bond
in the active site of HbHNL. PhD thesis. Karl Franzens
University Graz, Graz, Austria.
25 Pang H, Bartlam M, Zeng Q, Miyatake H, Hisano T,
Miki K, Wong LL, Gao GF & Rao Z (2004) Crystal
structure of human pirin: an iron-binding nuclear
protein and transcription cofactor. J Biol Chem 279,

1491–1498.
26 Adams M & Jia Z (2005) Structural and biochemical
analysis reveal pirins to possess quercetinase activity.
J Biol Chem 280, 28675–28682.
27 Chai SC, Bruyere JR & Maroney MJ (2006) Probes of
the catalytic site of cysteine dioxygenase. J Biol Chem
281, 15774–15779.
28 Straganz GD, Glieder A, Brecker L, Ribbons DW &
Steiner W (2003) Acetylacetone-cleaving enzyme Dke1:
a novel C–C-bond-cleaving enzyme from Acinetobac-
ter johnsonii. Biochem J 369, 573–581.
29 Roe AL, Schneider DJ, Mayer RJ, Pyrz JW, Widom J
& Que L (1984) X-ray absorption spectroscopy of
iron-tyrosinate proteins. J Am Chem Soc 106,
1676–1681.
30 Randall CR, Shu L, Chiou Y-M, Hagen KS, Ito M,
Kitajima N, Lachicotte RJ, Zang Y & Que L (1995)
X-ray absorption pre-edge studies of high-spin iron(II)
complexes. Inorg Chem 34, 1036–1039.
31 Westre TE, Kennepohl P, DeWitt JG, Hedman B,
Hodgson KO & Solomon EI (1997) A multiplet analysis
of Fe K-edge 1s fi 3d pre-edge features of iron
complexes. J Am Chem Soc 119, 6297–6314.
32 Wellenreuther G & Meyer-Klaucke W (2007) Towards
a black-box for biological EXAFS data analysis – I.
Identification of zinc finger proteins. AIP Conf Proc
882, 322–324.
33 Fay DP, Nichols AR & Sutin N (1971) The kinetics
and mechanisms of the reactions of iron(III) with b-dik-
etones. The formation of monoacetylacetoatoiron(III)

and the effect of copper (II) on the formation of
monothenoyltrifluoroacetonatoiron (III). Inorg Chem
10, 2096–2101.
34 Straganz GD, Hofer H, Steiner W & Nidetzky B (2004)
Electronic substituent effects on the cleavage specificity
of a non-heme Fe
2+
-dependent b-diketone dioxygenase
and their mechanistic implications. J Am Chem Soc
126, 12202–12203.
35 Straganz GD & Nidetzky B (2005) Reaction coordinate
analysis for b-diketone cleavage by the non-heme
Fe
2+
-dependent dioxygenase Dke1. J Am Chem Soc
127, 12306–12314.
36 Bugg TDH (2003) Dioxygenase enzymes: catalytic
mechanisms and chemical models. Tetrahedron 59,
7075–7101.
37 Chai SC, Ju T, Dang M, Goldsmith RB, Maroney MJ
& Pochapsky TC (2008) Characterization of metal
binding in the active sites of acireductone dioxygenase
isoforms from Klebsiella ATCC 8724. Biochemistry 47,
2428–2438.
38 Harding MM (2006) Small revisions to predicted
distances around metal sites in proteins. Acta Crystal-
logr D Biol Crystallogr 62, 678–682.
39 Harding MM (2001) Geometry of metal–ligand interac-
tions in proteins. Acta Crystallogr D Biol Crystallogr
57, 401–411.

40 Steiner RA, Kalk KH & Dijkstra BW (2002) Anaerobic
enzyme.substrate structures provide insight into the
reaction mechanism of the copper-dependent quercetin
2,3-dioxygenase. Proc Natl Acad Sci USA 99, 16625–
16630.
41 Simmons CR, Liu Q, Huang Q, Hao Q, Begley TP,
Karplus PA & Stipanuk MH (2006) Crystal structure of
mammalian cysteine dioxygenase. A novel mononuclear
iron center for cysteine thiol oxidation. J Biol Chem
281, 18723–18733.
42 Ye S, Wu XA, Wei L, Tang D, Sun P, Bartlam M &
Rao Z (2007) An insight into the mechanism of human
cysteine dioxygenase. Key roles of the thioether-bonded
tyrosine-cysteine cofactor. J Biol Chem 282, 3391–3402.
b-Diketone-cleaving oxygenase from B. xenovorans S. Leitgeb et al.
5996 FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS
43 Steiner RA, Meyer-Klaucke W & Dijkstra BW (2002)
Functional analysis of the copper-dependent quercetin
2,3-dioxygenase. 2. X-ray absorption studies of
native enzyme and anaerobic complexes with the
substrates quercetin and myricetin. Biochemistry 41,
7963–7968.
44 Sali A & Blundell TL (1993) Comparative protein
modelling by satisfaction of spatial restraints. J Mol
Biol 234, 779–815.
45 Flores EMM, Barin JS, Paniz JNG, Medeiros JA &
Knapp G (2004) Microwave-assisted sample combus-
tion: a technique for sample preparation in trace
element determination. Anal Chem 76, 3525–3529.
46 Johnson-Winters K, Purpero VM, Kavana M, Nelson

T & Moran GR (2003) (4-Hydroxyphenyl)pyruvate
dioxygenase from Streptomyces avermitilis: the basis
for ordered substrate addition. Biochemistry 42, 2072–
2080.
47 Schaab MR, Barney BM & Francisco WA (2006)
Kinetic and spectroscopic studies on the quercetin
2,3-dioxygenase from Bacillus subtilis. Biochemistry 45,
1009–1016.
48 Whitmore L & Wallace BA (2004) DICHROWEB, an
online server for protein secondary structure analyses
from circular dichroism spectroscopic data. Nucleic
Acids Res 32, W668–W673.
49 Lobley A, Whitmore L & Wallace BA (2002)
DICHROWEB: an interactive website for the analysis
of protein secondary structure from circular dichroism
spectra. Bioinformatics 18, 211–212.
50 Korbas M, Marsa DF & Meyer-Klaucke W (2006)
KEMP: a program script for automated biological
x-ray absorption spectroscopy data reduction. Rev Sci
Instrum 77, 063105.
51 Ressler T (1998) WinXAS: a program for x-ray
absorption spectroscopy data analysis under
MS-Windows. J Synchrotron Radiat 5, 118–122.
52 Binsted N, Strange RW & Hasnain SS (1992)
Constrained and restrained refinement in Exafs data-
analysis with curved wave theory. Biochemistry 31,
12117–12125.
53 DeLano WL (2002) The PyMOL Molecular Graphics
System. DeLano Scientific, Palo Alto, CA.
Supporting information

The following supplementary material is available:
Fig. S1. Structural comparison of nonheme metal-
dependent enzymes.
Fig. S2. Overlay of the homology model of Bxe_A2876
(white) with the template crystal structure of RgCarb
(RgCAR) (yellow) and the crystal structure of Acineto-
bacter johnsonii Dke1 (AjDKE) (green).
Fig. S3. Purification of Bxe_A2876 documented by
SDS ⁄ PAGE.
Fig. S4. Oxygen consumption during the conversion of
acetylacetone by Bxe_A2876.
Table S1. Various EXAFS model fits.
Table S2. Media composition for the cultivation of
Burkholderia xenovorans LB400.
Table S3. Growth and formation of oxygenase activity
by Burkholderia xenovorans LB400.
Table S4. Product distribution for the cleavage of
substituted diketone substrates.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
S. Leitgeb et al. b-Diketone-cleaving oxygenase from B. xenovorans
FEBS Journal 276 (2009) 5983–5997 ª 2009 The Authors Journal compilation ª 2009 FEBS 5997