Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Efficient killing of SW480 colon carcinoma cells by a
signal transducer and activator of transcription (STAT) 3
hairpin decoy oligodeoxynucleotide – interference with
interferon-c-STAT1-mediated killing
`
´
Ali Tadlaoui Hbibi1,2, Christelle Laguillier1,2, Ines Souissi1,2, Denis Lesage1,2, Stephanie Le Coquil1,2,
An Cao3, Valeri Metelev4, Fanny Baran-Marszak1,2,5 and Remi Fagard1,2,6
1
2
3
4
5
6

´
´
Institut National de la Sante et de la Recherche Medicale, U978, Bobigny, France
´
Universite Paris 13, UFR SMBH Bobigny, France
Centre National de la Recherche Scientifique, UMR 7033, Bobigny, France
Department of Chemistry, Moscow State University, Russia
ˆ
´
AP-HP, hopital Avicenne, service d’hematologie, Bobigny, France
ˆ
AP-HP, hopital Avicenne, service de biochimie, Bobigny, France

Keywords
cell death; hairpin decoy oligonucleotide;
interferon-c; STAT1; STAT3

Correspondence
ˆ
R. Fagard, service de biochimie, hopital
Avicenne 125 rue de Stalingrad, 93009
Bobigny Cedex, France
Fax: +33 014 895 5627
Tel: +33 014 895 5928
E-mail:
(Received 17 November 2008, revised 25
January 2009, accepted 19 February 2009)
doi:10.1111/j.1742-4658.2009.06975.x

The signal transducers and activators of transcription (STATs) convey signals from the membrane to the nucleus in response to cytokines or growth
factors. STAT3 is activated in response to cytokines involved mostly in cell
proliferation; STAT1 is activated by cytokines, including interferon-c,
involved in defence against pathogens and the inhibition of cell proliferation. STAT3, which is frequently activated in tumour cells, is a valuable
target with respect to achieving inhibition of tumour cell proliferation.
Indeed, its inhibition results in cell death. We previously observed that
inhibition of the transcription factor nuclear factor-jB, a key regulator of
cell proliferation, with decoy oligodeoxynucleotides results in cell death.
We used a similar approach for STAT3. A hairpin STAT3 oligodeoxynucleotide was added to a colon carcinoma cell line in which it induced cell
death as efficiently as the STAT3 inhibitor stattic. The hairpin STAT3
oligodeoxynucleotide co-localized with STAT3 within the cytoplasm,
prevented STAT3 localization to the nucleus, blocked a cyclin D1 reporter
promoter and associated with STAT3 in pull-down assays. However, the
same cells were efficiently killed by interferon-c. This effect was counteracted by the STAT3 oligodeoxynucleotide, which was found to efficiently
inhibit STAT1. Thus, although it can inhibit STAT3, the hairpin STAT3
oligodeoxynucleotide appears also to inhibit STAT1-mediated interferon-c
cell killing, highlighting the need to optimize STAT3-targeting oligodeoxynucleotides.

Signal transducer and activators of transcription
(STATs) are a family of transcription factors that are
activated in response to cytokines regulating cell proliferation, differentiation, inflammation, the immune
response, apoptosis and fetal development [1]. Sche-

matically, the inactive STATs are cytoplasmic; once
activated, they dimerize and enter the nucleus where
they induce the expression of target genes [2].
Several studies have demonstrated that STAT3 is a
key regulator of cell proliferation. It was shown to be a

Abbreviations
FITC, fluorescein isothiocyanate; GAS, c-activated sequence; IFN, interferon; IL, interleukin; IRF, interferon regulatory factor; NF, nuclear
factor; ODN, oligodeoxynucleotide; PARP, poly(ADP-ribose) polymerase; STAT, signal transducer and activator of transcription; TEAPC-chol,
3b-[N-(N ¢,N ¢,N ¢-triethylaminopropane)-carbamoyl] cholesterol iodide.

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

2505


STAT3 hairpin decoy oligonucleotide cell killing

A. Tadlaoui Hbibi et al.

major effector of epidermal growth factor receptor signalling [3–5] and of cytokines such as interleukin (IL)-6
[6]. It is also involved in transformation and tumour
progression [7] and its activation, as detected in breast,
head and neck, lung and colon cancers [8], is considered
to be a marker of poor prognosis. The role played by

STAT3 in malignant cell growth is mediated in part by
the up-regulation of the expression of genes involved
in cell survival and proliferation, including those for
Bcl-xl, Bcl-2, c-Myc, cyclin D1, survivin, Mcl-1, vascular endothelial growth factor, IL-10 and transforming
growth factor b [9–13]. The constitutive activation of
STAT3 observed in many tumours and tumour cell lines
suggests that it may be a good target for the induction
of cell death. Several therapeutic approaches have been
developed to inhibit STAT3, including inhibition of its
expression [14,15], inhibition of its dimerization [16,17]
and inhibition of its binding to the DNA promoter
sequence using decoy oligodeoxynucleotides (ODN)
[18,19]. ODNs comprise a valuable approach for inhibiting transcription factors because they have the potential to inhibit transcriptional function without affecting
other nontranscriptional functions. They have been
successfully used in the treatment of some diseases,
including rheumatoid arthritis [20] or atopic dermatitis
[21]. In cancer cell lines, the STAT3 ODNs were shown
to inhibit cell proliferation [18,22].
How the STAT3 decoy ODNs interact with STAT3
within cells, including how they affect its function, has
not been thoroughly investigated. One potential difficulty regarding specific targeting of STAT3 is that it
shares 72% sequence homology with STAT1. STAT3
and STAT1 are generally recognized to be antagonistic, with STAT3 functioning as a proliferation activator and STAT1 as an inhibitor [23–25], this
antagonism is further illustrated by the fact that cytokines, such as IL-6, which favour cell proliferation,
activate principally STAT3, whereas cytokines, such as
interferon (IFN)-a ⁄ b or IFN-c, which favour cell
death, activate principally STAT1. However, despite
their different functions in cells, STAT3 and STAT1
recognize very similar sequences on the gene promoters
and share common targets; they can also form heterodimers, whose function has not been clearly elucidated.

In the present study, we focussed on the colorectal
carcinoma cell line SW480, in which STAT3 is constitutively activated [26] and found that SW480 cells were
efficiently killed by the hpST3dODN. SW480 cells
were also efficiently killed by IFN-c treatment, and
this action was counteracted by hpST3dODN, which
reduced transcriptional activity and nuclear localization of STAT1 after IFN-c treatment. Thus, although
IFN-c treatment did not impair hpST3dODN-induced
2506

cell killing, IFN-c-induced cell killing was impaired by
hpST3dODN, most likely as a result of its interaction
with activated STAT1.

Results
The hairpin STAT3 decoy ODN induces cell death
of the colon carcinoma SW480 cells
To examine the transfection efficiency of hpST3dODN
into cells, we applied different concentrations of the
fluorescein isothiocyanate (FITC)-labelled hpST3d
ODN combined with cationic lipid and analysed the
intensity of FITC fluorescence by flow cytometry.
Transfection efficiency increased with increasing ODN
amounts (0.5, 1 and 2 lgỈmL)1) but not linearly, suggesting the possibility of a saturable mechanism of
entry (Fig. 1A); identical results were obtained with a
control ODN (not shown). Examination of the cells by
light microscopy showed that untreated cells, cells
treated with empty liposomes and cells treated with
control ODN were identical and had a normal appearance, whereas cells treated with hpST3dODN became
rounded and were detached from the culture dish (not
shown). To further analyse cell death induced by

hpST3dODN, different concentrations of ODN were
added to cells (0.5, 1 and 2 lg) or, alternatively, a control ODN was used (1 and 2 lg). After 48 h of culture,
cell death was determined by measuring trypan blue
uptake; the number of dead cells increased with
hpST3dODN concentration (0.5, 1 and 2 lg), whereas
control ODN (1 and 2 lg) or the liposomes alone had
little effect (Fig. 1C). Kinetic analysis showed that cell
death was undetectable after 12 h, and became detectable after 16, 24 and 48 h (Fig. 1B); after 72 h, the
amount of dead cells and debris made it difficult to
count dead cells. Analysis by flow cytometry clearly
showed the cells that had incorporated hpST3dODN
(FITC positive) were those that were dying (PI positive) (Fig. 1D). hpST3dODN was also applied to the
2C4 fibroblastic cell line in which STAT3 is not constitutively activated. There was no effect on cell viability,
despite the fact that hpST3dODN could efficiently
enter the cells (not shown). However, curcumin, a nonspecific inhibitor [27,28], could kill the cells (Fig. 1E)
as efficiently as SW480 cells (not shown). To further
explore the sensitivity of SW480 cells to STAT3 inhibition, the inhibitor stattic, which is considered to be
specific to STAT3 [29], was used and trypan bluepositive cells counted. Increased cell death was
observed (Fig. 1F), thus strengthening the notion that
specific inhibition of STAT3 is sufficient to induce the
death of these cells. Interestingly, in stattic-treated 2C4

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS


STAT3 hairpin decoy oligonucleotide cell killing

D
FITC lab intensity

A
100
80
60
40
20
0
0.5

1

2

PI/FITC-pos cells (%)

A. Tadlaoui Hbibi et al.

25
20
15
10
5
0
n

e

ODN (µg)

1

ODN (µg)

2
1
Cont. (µg)

Dead cells (%)

E

Dead cells (%)

B
30
20
10

Time (h)

16 24 48

16 24 48

n

16 24 48

ODN
(2 µg)

30

2C4

15
10

E. Lip ODN

cont

Curc

Contr
F
Dead cells (%)

C

Dead c
cells (%)

0.5

30
15
10
n

e

0.5

1

2

ODN (µg)

1

2

80
60
40
20
10
0

Cont. (µg)

1

5 10 15 30 40
Stattic (µM)

Fig. 1. Cell death induced by treatment of the SW480 colon carcinoma cell line with the STAT3 decoy ODN. (A) Efficient incorporation of
FITC-STAT3 decoy ODN into SW480 cells using decoy ⁄ lipid complexes. After 6 h of incubation, cells were placed in fresh culture medium

containing 10% serum for 24 h. Fluorescence intensity was measured by flow cytometry after treatment with lipids combined with increasing concentrations of FITC-labelled hpST3dODN in the range 0.5–2 lg. (B) SW480 cells were treated with empty lipids (n), hairpin decoy
ODN (2 lg) or control ODN (con) and the dead cells were counted after 16, 24 and 48 h of culture using trypan blue staining. (C) Cells were
treated with 0.5, 1 and 2 lg of hpST3dODN and 1 and 2 lg of control ODN for 6 h or with lipids only; after 48 h of culture, they were
stained with trypan blue and counted (n, untreated cells; e, empty liposomes). (D) Cells were treated as described in (C) and then analysed
by flow cytometry for propidium iodide (PI) and FITC uptake, the results shown are for the cells that are positive for both PI and FITC
uptake. (E) Cells of the fibroblastic line 2C4 were treated with empty lipids (E. lip), hairpin decoy ODN, control ODN (con) and curcumin
(40 lM) (curc) and the dead cells were counted after 48 h of culture using trypan blue staining. (F) Cells were treated with concentrations of
Stattic in the range 0–30 lM, stained with trypan blue and dead cells were counted. To facilitate the comparison of different experiments,
the results are expressed as a percentage.

cells (in which STAT3 is not activated), there were 5%
dead cells with 10 lm stattic, (28% in SW480), 10%
with 15 lm (35% in SW480), 25% with 30 lm (45% in
SW480) and 35% with 40 lm (60% in SW480).
The hairpin STAT3 decoy ODN inhibits the
transcriptional activity of STAT3 and colocalizes
with STAT3 to the cytoplasm of SW480 cells
The transcriptional activity of STAT3 after treatment
of the cells with hpST3dODN was analysed in SW480
cells transfected with a cyclin D1-promoter luciferase
reporter. The luminescence of cell extracts, measured
24 h after transfection, was found to decrease by 86%,
whereas control ODN had no measurable effect

(Fig. 2A). To assess the specificity of the effect of
ODN, we verified that the hST3dODN did not inhibit
the nuclear factor (NF)-jB-luciferase reporter in these
cells and that the NF-jB inhibitory ODN [30] did not
inhibit the cyclin D1-luciferase reporter (not shown).
To determine whether the subcellular localization of

STAT3 had been modified by ODN, fluorescence
microscopy was employed. In untreated SW480 cells,
phospho-STAT3 was detectable in the cytoplasm and
nucleus (Fig. 2B). In FITC-labelled hpST3dODNtransfected cells, phospho-STAT3 was detected in the
cytoplasm, but not in the nucleus, and ODN was
detected only in the cytoplasm (Fig. 2C), suggesting
that hpST3dODN somehow prevented the nuclear
localization of phospho-STAT3. Indeed, in cells that

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

2507


B

C

Cont. ODN

A. Tadlaoui Hbibi et al.

800
600
400
200
0
No add

STAT3

STAT3

STAT3

ODN

DAPI

Merge

DAPI

Merge

DAPI

Merge

were either not treated (Fig. 2B) or treated with control ODN (Fig. 2D), phospho-STAT3 was found
within the nucleus.
The hairpin STAT3 decoy ODN also disrupts
IFN-c-induced STAT1 signalling
Because STAT3 and STAT1 share a high degree of
homology and bind to similar promoter sequences, they
are likely to interact with the same ODN. Although
hpST3dODN induced the death of SW480 cells, and
blocked the transcriptional activity of STAT3, it was
important to verify whether, within cells, this ODN was
STAT3-specific or could also interact with STAT1 and

disrupt its signalling. In colorectal carcinoma cells,
treatment with IFN-c sensitizes cells to cytotoxic compounds, and can also induce cell death on its own
[11,25,31,32]. Experiments were performed to determine
whether this was also observed in SW480 cells. IFN-c,
at 200 ngỈmL)1 for 48 h, efficiently killed the cells; however, lower concentrations (10 ngỈmL)1) and shorter
exposures (4 h) had no effect on cell death (Fig. 3A). In
addition, treatment of the cells with 100–200 ngỈmL)1
IFN-c for 24–48 h induced poly(ADP-ribose) polymer-

2508

Fig. 2. Transcriptional activity and subcellular localization of STAT3 are altered in
STAT3 decoy ODN-treated SW480 cells. (A)
Inhibition of the transcriptional activity of
STAT3 by hpST3dODN. SW480 cells were
cotransfected with a cyclin D1-luc plasmid,
treated with either hpST3dODN or a control
ODN and the luciferase activity measured
after 24 h of incubation. The relative STAT3
transcriptional activity in transfected cells is
shown. Each transfection experiment was
performed in triplicate. Subcellular location
of phospho-STAT3 analysed by fluorescence
microscopy: (B) in nontreated cells, phophoSTAT3 was cytoplasmic and nuclear; (C) in
hpST3dODN-treated cells, STAT3 was
almost exclusively cytoplasmic and not
detected in the nuclei (arrow); the FITClabelled hpST3dODN was also cytoplasmic;
(D) in control ODN-treated cells, phosphoSTAT3 was mostly nuclear, as in control
cells; the ODN was mostly cytoplasmic
(scale bar = 10 lm).

Cont. ODN

A 70
Dead cells (%)

A

Cyclin D1-Luciferase
activity (Rlu per µg prot)

STAT3 hairpin decoy oligonucleotide cell killing

60
50
40
30
20
10
0

IFN-γ (ng·mL–1) 0

10

100

200

cPARP

actin

24 h

cPARP
actin

B

48 h

IFN-γ 0
(ng·mL–1)

5

20 100

200

Fig. 3. Treatment with IFN-c induces cell death of SW480 cells.
(A) SW480 cells were incubated in the absence of IFN-c or with
10, 100 and 200 ngỈmL)1 for 4, 24 and 48 h of incubation
and cell death was measured by trypan blue exclusion. Each
experiment was performed in triplicate. The results are expressed
as a percentage of dead cells. (B) Cleavage of PARP, induced by
24 or 48 h of treatment with IFN-c at 5, 20, 100 and
200 ngỈmL)1 was analysed by western blotting using anti-cleavedPARP serum.

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

STAT3 hairpin decoy oligonucleotide cell killing

A

2500
2000
1500
1000
500
0

B

D

ODN

hpST3dODN binds both STAT3 and STAT1
The results obtained indicate that hpST3dODN is
acting on both STAT3 and STAT1 and that it has
the potential to interfere with the biological activity

ODN

Contr

IFN-γ
IFN

STAT1

A

DAPI

Merge

STAT1

Contr-ODN

ase (PARP) cleavage (Fig. 3B). The transcriptional
activity of STAT1, as measured with an interferon regulatory factor (IRF) 1-promoter luciferase reporter after
treatment of IFN-c-treated cells with hpST3dODN
(1 lgỈmL)1), was considerably reduced compared to the
effect of control ODN (Fig. 4A). The subcellular localization of STAT1 was also modified by treatment with
hpST3dODN. In IFN-c-treated cells, STAT1 was
detected in the nucleus (Fig. 4B); in cells treated with
hpST3dODN, STAT1 remained in the cytoplasm and
was found to colocalize with ODN (Fig. 4C); and, in
cells treated with control ODN, the nuclear translocation of STAT1 occurred normally (Fig. 4D). These
observations suggest that hpST3dODN could interfere
with STAT1, a key signalling factor for IFN-c. Accordingly, cell death was analysed in SW480 cells after treatment with IFN-c and the addition of hpST3dODN. In
cells that were treated with IFN-c, the addition of
hpST3dODN reduced cell death by more than 50%
(Fig. 5A); interestingly, such a reduction of IFN-cinduced cell death was not observed when treating cells
with stattic, a compound that binds the SH2 domain of
STAT3 with high affinity (Fig. 5B).

No
add

0

Dead cells (%)

C

IRF1

DAPI

Merge

40

20
10
0

+

0

IFN-γ (ng·mL–1) 0

ODN

0

0

0

+

Control

B

70
60
50
40
30
20
10
0
Stattic (µM)

0

0

0

+

+

0

0

100 200 100 200 100 200
0

0

0

0

+

+

Dead cells (%)

Fig. 4. Transcriptional activity and subcellular localization of STAT1 are altered in
STAT3 decoy ODN-treated SW480 cells.
(A) SW480 cells were transfected with an
IRF-1-luc plasmid, treated with IFN-c at
20 ngỈmL)1, and either not treated (no add.),
treated with hpST3dODN (ODN) or treated
with control ODN (contr.); after 24 h of incubation, luciferase activity was measured.
Each transfection experiment was performed in triplicate. Subcellular location of
STAT1 determined by fluorescence microscopy: (B) cytoplasmic location of STAT1 in

untreated cells and nuclear location in IFN-c
treated cells (20 ngỈmL)1); (C) cytoplasmic
location of phospho-STAT1 (red) in
hpST3dODN-treated (1 lg) SW480 cells that
had been treated with IFN-c (20 ngỈmL)1);
the decoy ODN (green) was also cytoplasmic; (D) nuclear location of STAT1 (red) in
cells treated with control ODN (green) (scale
bar = 10 lm).

Luciferase activity
(Rlu per µg prot)

A. Tadlaoui Hbibi et al.

0

IFN-γ (ng·mL–1) 0

0

0

15

15

15

100

200

0

100

200

Fig. 5. Inhibition of IFN-c-induced cell death by the STAT3 decoy
ODN in SW480 cells. (A) Cells were either treated with 1 lg of
hpST3dODN or control ODN for 6 h, with IFN-c alone or with ODN
and IFN-c; after 48 h of culture, they were stained with trypan blue
and counted. (B) Cells were either not treated, or treated with
stattic alone, IFN-c alone or both combined together. After 48 h of
incubation, dead cells were counted using trypan blue exclusion.

of IFN-c. In the SW480 cell line, IFN-c treatment
resulted in the inhibition of the STAT3-dependent
cyclin D1 promoter, and activation of the STAT1-

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

2509


STAT3 hairpin decoy oligonucleotide cell killing

Cyclin D1

A

A. Tadlaoui Hbibi et al.

interaction of both STAT1 and STAT3 with
hpST3dODN, pull-down experiments were performed
using a biotinylated version of this ODN. This was followed by gel separation and western blotting with
anti-phospho-STAT1 or anti-phospho-STAT3. The
results obtained show that, in SW480 cells that have
not been stimulated, there is a basal level of binding of
phospho-STAT3 to hpST3dODN. This binding is
increased in cells treated with IL-6 and, to a lesser
extent, in cells treated with IFN-c (Fig. 6C, lanes 1
and 2). On the other hand, binding of phospho-STAT1
is detected only in cells that have been treated with
IFN-c (Fig. 6C, lane 3).

IRF1

200

2000

100

1000
0

0

IFN-γ 0

(100 ng·mL–1)

+

IFN-γ 0
(100 ng·mL–1)

+

Western blotting

B
IFN-γ (ng·mL–1) 0

5

20 100

200

P-STAT1
STAT1
P-STAT3
STAT3

Discussion

–
–

Pull-down
–
+
+
–

–
+

1

2

4

C

IFN-γ
IL6

+
–

P-STAT1
P-STAT3

3

5

Fig. 6. Binding of the STAT3 decoy ODN to STAT3 and STAT1. (A)
SW480 cells were transfected with a cyclin D1-luc plasmid (left
panel) or an IRF1-luc plasmid (right panel) and either treated or not
with IFN-c at 100 ngỈmL)1. After 24 h of incubation, luciferase
activity was measured. Relative STAT1 and STAT3 transcriptional
activities in transfected cells are shown. (B) Phosphorylation levels
of STAT3 and STAT1 in SW480 cells after treatment with different
concentrations of IFN-c analysed by western blotting using antiP-STAT1 and anti-P-STAT3 sera. (C) Interaction of the STAT3 decoy
ODN with STAT3 and STAT1 as determined by pull-down assays.
Cells were treated with biotinylated hpST3dODN (1 lg) (lanes 1, 2
and 3) or control biotinylated ODN (lanes 4 and 5) for 16 h and
lysed; the complexes were bound to streptavidine and separated
on gels. Cells were either not treated (lane 1), treated with IL-6
(30 ngỈmL)1, lanes 2 and 4) or treated with IFN-c (100 ngỈmL)1,
lanes 3 and 5). Western blotting was performed using antiphospho-STAT3 and anti-phospho-STAT1 sera. Identical amounts of
cellular extracts were used, as determined by the Bradford method.
The experiment was repeated several times, with identical results
being obtained.

dependent IRF1 promoter (Fig. 6A). To determine
whether this correlated with phosphorylation levels,
the phosphorylation of STAT1 on tyrosine 701, and of
STAT3 on tyrosine 705, was examined in IFN-c-treated SW480 cells. STAT1 phosphorylation increased
dramatically, even at the lowest concentration used,
whereas STAT3 phosphorylation never increased by
more than twofold (Fig. 6B). In the absence of IFN-c
treatment, there was a low but clearly detectable
phosphorylation of STAT3. Finally, to analyse the
2510

In the present study, we observed that a hairpin decoy
ODN targeting STAT3 (hpST3dODN) induces cell
death of the carcinoma cell line SW480, apparently by
trapping STAT3 within the cytoplasm.
The hairpin decoy, but not control ODN, inhibited
cell proliferation, eliminating any possible effects as a
result of the introduction of DNA within cells, and
indicating that, in itself, the interaction of ODN with
STAT3 induced these effects (i.e. inhibition of the
cyclin-D1-dependent promoter, colocalization with
STAT3 and STAT3 binding in pull-down assays). Our
data indicate a correlation between inhibition of
STAT3 by hpST3dODN and induction of cell death.
In addition, they confirm previous observations made
in head and neck nonsquamous carcinoma cell lines,
with a nonhairpin ODN containing the c-activated
sequence (GAS) sequence [18]. Taken together with
our observation that ODN does not kill the fibrosarcoma cell line 2C4, in which STAT3 is not activated,
these results suggest that the effect of ODN may be
restricted to cells in which STAT3 is activated. These
results are also in agreement with a previous study
showing that inhibition of the constitutively activated
Janus kinase ⁄ STAT3 pathway with AG490 resulted in
the diminished viability of SW480 cells [26]. The mechanism by which hpST3dODN inhibits STAT3 is not
clearly understood. Our immunofluorescence microscopy data suggest that activated STAT3 may be
trapped by ODN within the cytoplasm. This view is
supported by our pull-down assays, which indicate a
direct interaction of hpST3dODN with activated
STAT3. Cytoplasmic trapping of a transcription factor
was previously observed in the laboratory with a

NF-jB decoy ODN [30], indicating that the mechanism involved is probably not specific to one transcription factor. Nevertheless, the mechanism by which
binding of a hairpin to STAT3 prevents nuclear entry

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS


A. Tadlaoui Hbibi et al.

is not understood. Because nuclear transport is a
highly regulated process, one possibility is that binding
to hpST3dODN modifies the conformation of key
components of the STAT3 protein complex, thereby
impairing normal interaction with the nuclear transport machinery. Alternatively, the hairpin ODN itself
might interact with components of the nuclear transport machinery through its hairpin structure. Although
the combination of induced cell death, inhibited transcription activity and nuclear entry strongly indicates
that hpST3dODN functions by preventing nuclear
entry, further studies are required, including cell fractionation assays, to directly demonstrate this proposal
and to identify the cellular components involved.
Nevertheless, these results suggest that nuclear entry of
a decoy ODN is not a prerequisite for the inhibition of
transcription factors, as previously assumed [33].
There is an intriguing similarity between STAT3 and
STAT1. Both factors share activating stimuli and a
high homology of sequence, and they have common
gene targets and recognize very similar consensus
sequences; yet, they have clearly distinct functions in
cells. STAT3 is mostly involved in cell survival and
proliferation, and STAT1 is involved in anti-viral and
immune defence and cell death, in response to interferons, including IFN-c [34]. Inhibition of STAT1 using
GAS-based decoy ODNs was previously found to efficiently inhibit inflammation-linked processes such as

graft rejection [35,36], arthritis [37] and contact hypersensitivity [38]. The decoy ODN used in these studies
was considered STAT1-specific. However, a recent
study, using a GAS sequence-based nonhairpin decoy
ODN [39] to inhibit STAT3 in head and neck squamous carcinoma cell lines, although demonstrating
inhibition of IFN-c-activated STAT1, concluded that
there was an absence of interference with STAT1mediated actions. The present study of the colon
carcinoma cell line SW480 demonstrates that IFN-ctreatment induces cell death, using conditions similar
to previous studies [31,32,40]. Treatments of at least
2 days with IFN-c concentrations of at least
100 ngỈmL)1 are necessary; indeed, when using lower
concentrations of IFN-c [39], we did not observe any
cell killing. If the decoy ODNs used do not discriminate between STAT3 and STAT1, then a STAT3
decoy ODN may potentially inhibit the action of IFNc because STAT1 has long been recognized as a key
component of this action [23]. We therefore verified
whether hpST3dODN inhibited STAT1, and whether
this would result in an impaired action of IFN-c. The
results obtained demonstrate that, in the SW480 cell
line, hpST3dODN inhibited STAT1: it inhibited its
transcriptional activity on an IRF1 reporter and its

STAT3 hairpin decoy oligonucleotide cell killing

nuclear localization, which is associated with inhibited
IFN-c-induced cell death. Although these results could
mean that STAT3 has no effect on IFN-c-induced cell
death, they show that, in our cell system, the action of
hpST3dODN must be interpreted with caution because
it has the potential to inhibit IFN-c-induced cell death.
Alternatively, the STAT3-inhibitor stattic did not
prevent cell death induced by IFN-c. Because the

hairpin decoy STAT3 ODN induces cell death of the
nontreated SW480 cells in which there is a constitutive
level of activated STAT3, which is necessary for the
survival of these cells [30], and because it inhibits
STAT1 in these cells when they are treated with
IFN-c, we can tentatively conclude that it interacts
with the activated forms of STAT3 and STAT1. The
actions of STAT3 and STAT1 are highly entangled,
they also have antagonistic activities, and they regulate
each others activity. Thus, the inhibition of both
factors in vivo may have unpredictible results. For
example, in cardiac ischaemia, the action of STAT3 is
protective and that of STAT1 increases cardiomyocyte
apoptosis [41,42]. Thus, the inhibition of STAT3 using
decoy ODNs that are not strictly STAT3-specific may
lead to unpredictable results (particularly in whole animals) by impairing the action of STAT1-dependent
interferon.
The results obtained in the present study, including
the ability of the hairpin decoy STAT3 ODN to inhibit
both activated STAT3 and STAT1, also reveal that, in
SW480 cells, survival may depend in part upon an
equilibrium between the two STATs. This equilibrium
is in favour of activated STAT3 in our untreated colocarcinoma cells, and is tilted in favour of activated
STAT1 in IFN-c-treated cells. Such an equilibrium
was observed in cells treated with the Janus kinasefamily inhibitor AG490, where only limited potentiation of the pro-apoptotic effect of doxorubicin was
found, whereas inhibition of STAT3 with a dominant
negative or a platinum derivative increased the
pro-apoptotic effect of doxorubicin [43]. Thus, the
efficiency of blocking STAT3 may depend on
the absence of the inhibition of STAT1. Indeed, cell

death induced by ODN and by IFN-c may be the
result of completely different mechanisms. Furthermore, ODN might trap STAT1 ⁄ STAT3 heterodimers
whose function remains to be elucidated. One way to
explore the complex interaction between STAT1 and
STAT3 in SW480 cells is to suppress their expression.
Such an approach is indeed in progress in our laboratory: using shRNA transduction, we are presently
examining whether STAT3 silencing causes proapoptotic effects and whether STAT1 silencing causes
anti-apoptotic effects.

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

2511


STAT3 hairpin decoy oligonucleotide cell killing

A. Tadlaoui Hbibi et al.

The involvement of STAT1 may depend on the cell
line used. In some cell lines, ODN bound both STAT3
and STAT1 but did not inhibit STAT1 [32]. However,
the functions of STAT1 and STAT3 differ considerably and this must depend at some point on the
specific recognition of a DNA-binding motif. Specific
inhibition of STAT3 by DNA-binding targeting may
require an improved consensus sequence that would be
recognized principally by STAT3.
As noted above, an NF-jB decoy ODN induced cell
death in the same cells [30], suggesting that the STAT3
and the NF-jB pathway are connected in these cells,
as described in other systems in which cytokines,

secreted as a result of NF-jB activation, activate
STAT3. Unphosphorylated STAT3-dependent activation of NF-jB has also been reported [35], although
our data indicate that the hairpin ODN blocks activated STAT3 and may not inhibit unphosphorylated
STAT3.

Preparation of liposomes
Liposomes were formulated using a cationic lipid, 3b-[N(N¢,N¢,N¢-triethylaminopropane)-carbamoyl]
cholesterol
iodide (TEAPC-Chol) and neutral colipid dioleoyl phosphatidylethanolamine, as previously described [25]. Briefly,
TEAPC-Chol and dioleoyl phosphatidylethanolamine were
mixed at a ratio of 1 : 1 (w ⁄ w) and dissolved in chloroform. The solution was dried in vacuum. Sterile water was
then added and the mixture was sonicated to clarity for 1 h
in cycles of 15 min. Using light scattering, we found that
the size distribution of the liposomes was unimodal. The
concentration of cationic lipid was monitored by UV spectroscopy at 226 nm and the value was used to calculate the
charge ratio, assuming one positive charge for each cationic
lipid molecule.

Transfection using liposomes

Experimental procedures
Cell culture
SW480 (colon), 2C4 (fibrosarcoma) cell lines were grown in
10% FBS ⁄ DMEM (Gibco BRL, Life Technologies, CergyPontoise, France), 100 mL)1 penicillin, 10 lgỈmL)1 streptomycin (Gibco BRL), 1 mm sodium pyruvate (Gibco
BRL), MEM vitamins 100 · (Gibco BRL) and 5 lgỈmL)1
plasmocin (Cayla InvivoGen, Toulouse, France). Curcumin
was obtained from Acros Organics (Halluin, France).

Synthesis of the hairpin STAT3 decoy ODN
The oligodeoxynucleotides used comprised: RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3

NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and
RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG
GGAAATG-(CH2)3NHR (mutated hairpin control ODN)
(Sigma-Proligo; Sigma-Aldrich Corp., St Louis, MO, USA),
where R is either H, FITC or biotin. To synthesize oligodeoxynucleotides with biotin, 7–10 nmol of the oligodeoxynucleotide bearing 3¢- and 5¢-aminoalkyl linkers were
dissolved in 20 lL of 0.1 m NaHCO3. EZ-Link NHS-biotin
(Pierce, Rockford, IL, USA) (10 lL of a 65 mm solution in
dimethyl sulfoxide) was added, and the mixture was incubated at room temperature for 6–16 h in the dark. Next,
25 lL of water were added, and the modified oligodeoxynucleotide was separated from the excess of hydrolyzed
reagent by two consecutive separations on Micro Bio-Spin 6
columns (Bio-Rad, Foster City, CA, USA) in accordance
with the manufacturer’s instructions. After the second spin,
the biotinylated oligodeoxynucleotide was precipitated with

2512

ethanol-sodium acetate. In control experiments, the previously described NF-jB decoy ODN [30] was used.

Cells were grown in four-well plates to a density of
0.5 · 106 cellsỈmL)1. When the cells reached 50–60% confluence, they were transfected with hpST3dODN or the
hairpin control ODN (0.5, 1 and 2 lg corresponding to
100, 200 and 400 nm, respectively) in 150 lL of DMEM
medium (without stromal vascular fraction cells) combined
with the liposomes (0.5, 1 or 2 lg of cationic lipid), thus
yielding liposome : ODN ratios of 0.5 : 0.5, 2 : 2, 1 : 0.5
and 1 : 1 (lg ⁄ lg). After 6 h at 37 °C in a humidified 5%
CO2 incubator, the cells were placed in fresh serumcontaining medium. Expression was analysed after 48 h.
In control experiments, the liposomes were used alone at
the same lipid concentrations.

Flow cytometry, cell viability
The uptake of FITC-labelled hpST3dODN was measured
by flow cytometry, gating on the FL1-positive signal on an
EPICS XL Beckman-Coulter counter (Beckman Coulter,
Villepinte, France). To measure the rate of cell death, cells
were resuspended in annexin V-binding buffer, incubated
with 5 lL of propidium iodide (BD Pharmingen, Morangis,
France) and analysed in a EPICS XL Beckman-Coulter
counter. Cell viability was assessed using the trypan blue
exclusion method.

Luciferase activity
To measure the transcriptional activity of STAT3 and
STAT1, cells were transfected with either the cyclin D1
luciferase 1745 promoter [44] (a generous gift of R. Pestell,
Kimmel Cancer Center, Jefferson University in

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS


A. Tadlaoui Hbibi et al.

Philadelphia, PA, USA) or the IRF-1 luciferase promoter
(a generous gift of P. Kovarik, University of Vienna,
Austria). Cells were then transfected with hpST3dODN or
the hairpin control ODN (1 lg, corresponding to 200 nm)
combined with liposomes. After 24 h of incubation, cells
were lyzed for 30 min on ice with lysis buffer (10 mm Tris–
HCl, pH 7.5, 1 mm EDTA, 100 mm NaCl, 1% NP40 and
1 mm dithiothreitol). In control experiments, the transcriptional activity of NF-jB was analysed using the NF-jB-luc

0.4K-luc plasmid (a generous gift of A. Israel, Institut
ă
Pasteur, Paris, France). The lysates were centrifuged at
18 000 g for 10 min at 4 °C. Supernatants were collected
and assayed for luciferase activity using the Luciferase
Assay kit (Promega, Madison, WI, USA) and a luminometer (Clarity, Fisher Bioblock Scientific, Illkirsch, France).
Protein concentrations were measured using the Bradford
method. Luciferase activity was normalized as relative light
units per lg of total protein in the supernatant. The experiments were performed in triplicate.

Immunofluorescence
Cellular uptake and subcellular localization of the FITClabelled hpST3dODN were analysed on cells grown on
glass slides (Lab-Tek; Nunc, Rochester, NY, USA). Cells
were washed twice in NaCl ⁄ Pi, fixed in 3.7% formaldehyde
in NaCl ⁄ Pi for 15 min, permeabilized in 0.1% Triton X-100
for 15 min and blocked with 5% FBS, 0.1% Tween in
NaCl ⁄ Pi for 1 h. Cells were incubated with the primary
antibody (anti-STAT3, anti-STAT1; Cell Signaling Technology, Beverly, MA, USA; dilution 1 : 100) for 2 h. Alexa
Fluor 546-labelled secondary anti-rat serum (InvitrogenMolecular Probes, Carlsbad, CA, USA) at 1 : 250 was
added for 90 min. After counterstaining with 4¢,6¢-diamidino-2-phenylindole, coverslips were mounted onto glass
slides in Vectashield (Vectorlabs, Clinisciences, Montrouge,
France). Fluorescence images were digitally acquired using
a Zeiss Axioplan2 Deconvolution microscope (CarlZeiss,
Le Pecq, France) and analysed with Metafer4 (Metasystems, Altlussheim, Germany).

Oligodeoxynucleotide pull-down assays and
western blotting
Nuclear protein extracts were obtained as follows: 20 million cells were resuspended in lysis buffer (20 mm Hepes,
pH 7.4, 1 mm MgCl2, 10 mm KCl, 0.3% NP40, 0.5 mm
dithiothreitol, 0.1 mm EDTA, protease inhibitors;

CompeteÔ; Boehringer Ingelheim GmbH, Ingelheim
Germany) at 4 °C for 5 min. The lysates were centrifuged
at 14 000 g for 5 min at 4 °C, and the supernatants containing the cytoplasmic proteins were discarded. The pellets
were resuspended in the cell lysis buffer adjusted with 20%
glycerol and 0.35 m NaCl for 30 min at 4 °C. After centrifugation at 14 000 g for 5 min at 4 °C, the supernatants

STAT3 hairpin decoy oligonucleotide cell killing

were stored at )80 °C. For pull-down assays, 100–200 lg
of nuclear protein extracts were incubated for 30 min at
4 °C in binding buffer (1% NP40, 50 mm Hepes, pH 7.6,
140 mm NaCl) containing salmon sperm DNA (1 lg per
assay) and 1 lg of biotinylated hairpin decoy ODN or
mutated control ODN. The complexes were captured by
incubation with 50 lL of avidin-sepharose beads (neutravidin; Pierce) for 2 h at 4 °C, washed three times with NaCl ⁄
Tris (20 mm NaCl, 500 mm Tris–HCl, pH 8), and once with
NaCl ⁄ Tris-0.1% Tween. After resuspension in sample buffer, complexes were separated on a SDS-polyacrylamide
(10%) gel, and subjected to immunoblotting using
anti-STAT3 (Cell Signaling Technology). Results were
analysed by chemiluminescence (LumiGLO; Cell Signaling
Technology) and autoradiography (X-Omat R; Eastman
Kodak, Rochester, NY, USA).

Acknowledgements
A.T.H. was supported in part by the Fondation
Martine Midy. This work was supported in part by
grants from the Association de recherche contre le
cancer (ARC, grant 3133) and RFBR 06-04-49196.

References

1 Benekli M, Baer MR, Baumann H & Wetzier M (2003)
Signal transducer and activator of transcription proteins
in leukemias. Blood 101, 2940–2954.
2 Zhong Z, Wen Z & Darnell JE Jr (1994) Stat3: a STAT
family member activated by tyrosine phosphorylation in
response to epidermal growth factor and interleukin-6.
Science 264, 95–98.
3 Park OK, Schaefer TS & Nathans D (1996) In vitro
activation of Stat3 by epidermal growth factor receptor kinase. Proc Natl Acad Sci USA 93, 13704–
13708.
4 Coffer PJ & Kruijer W (1995) EGF receptor deletions
define a region specifically mediating STAT transcription factor activation. Biochem Biophys Res Commun
210, 74–81.
5 Shao H, Cheng HY, Cook RG & Tweardy DJ (2003)
Identification and characterization of signal transducer
and activator of transcription 3 recruitment sites within
the epidermal growth factor receptor. Cancer Res 63,
3923–3930.
6 Fujitani Y, Nakajima K, Kojima H, Nakae K, Takeda
T & Hirano T (1994) Transcriptional activation of the
IL-6 response element in the junB promoter is mediated
by multiple Stat family proteins. Biochem Biophys Res
Commun 202, 1181–1187.
7 Bromberg J & Darnell JE Jr (2000) The role of STATs
in transcriptional control and their impact on cellular
function. Oncogene 19, 2468–2473.

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

2513

STAT3 hairpin decoy oligonucleotide cell killing

A. Tadlaoui Hbibi et al.

8 Garcia R, Bowman TL, Niu G, Yu H, Minton S,
Muro-cacho CA, Cox CE, Falcone R, Fairclough R,
Parsons S et al. (2001) Constitutive activation of Stat3
by the Src and JAK tyrosine kinases participates in
growth regulation of human breast carcinoma cells.
Oncogene 20, 2499–2513.
9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M,
Nakajima T, Kawashima T, Nanakin A, Sawabu T,
Uenoyama Y et al. (2004) STAT3 is constitutively
activated and supports cell survival in association with
survivin expression in gastric cancer cells. Oncogene 23,
4921–4929.
10 Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y,
Pestell RG, Albanese C & Darnell JE (1999) STAT3 as
an oncogene. Cell 98, 295–303.
11 Epling-Burnette PK, Zhong B, Bai F, Jiang K, Bailey
RD, Garcia R, Jove R, Djeu JY, Loughran TP Jr &
Wei S (2001) Cooperative regulation of Mcl-1 by Janus
kinase ⁄ stat and phosphatidylinositol 3-kinase contribute
to granulocyte-macrophage colony-stimulating factordelayed apoptosis in human neutrophils. J Immunol
166, 7486–7495.
12 Adachi Y, Aoki C, Yoshio-Hoshino N, Takayama K,
Curiel DT & Nishimoto N (2006) Interleukin-6 induces
both cell growth and VEGF production in malignant

mesotheliomas. Int J Cancer 119, 1303–1311.
13 Wang T, Niu G, Kortylewski M, Burdelya L, Shain K,
Zhang S, Bhattacharya R, Gabrilovich D, Heller R,
Coppola D et al. (2004) Regulation of the innate and
adaptive immune responses by Stat-3 signaling in tumor
cells. Nat Med 10, 48–54.
14 Grandis JR, Drenning SD, Zeng Q, Watkins SC,
Melhem MF, Endo S, Johnson DE, Huang L, He Y &
Kim JD (2000) Constitutive activation of Stat3
signaling abrogates apoptosis in squamous cell
carcinogenesis in vivo. Proc Natl Acad Sci USA 97,
4227–4232.
15 Konnikova L, Kotecki M, Kruger MM & Cochran BH
(2003) Knockdown of STAT3 expression by RNAi
induces apoptosis in astrocytoma cells. BMC Cancer 3,
23.
16 Nagel-Wolfrum K, Buerger C, Wittig I, Butz K,
Hoppe-Seyler F & Groner B (2004) The interaction of
specific peptide aptamers with the DNA binding
domain and the dimerization domain of the transcription factor Stat3 inhibits transactivation and induces
apoptosis in tumor cells. Mol Cancer Res 2, 170–182.
17 Turkson J, Ryan D, Kim JS, Zhang Y, Chen Z, Haura
E, Laudano A, Sebti S, Hamilton AD & Jove R (2001)
Phosphotyrosyl peptides block Stat3-mediated DNA
binding activity, gene regulation, and cell transformation. J Biol Chem 276, 45443–45455.
18 Leong PL, Andrews GA, Johnson DE, Dyer KF, Xi S,
Mai JC, Robbins PD, Gadiparthi S, Burke NA, Watkins SF et al. (2003) Targeted inhibition of Stat3 with a

2514

19

20

21

22

23

24

25

26

27

28
29

30

decoy oligonucleotide abrogates head and neck cancer
cell growth. Proc Natl Acad Sci USA 100, 4138–4143.
Barton BE, Murphy TF, Shu P, Huang HF, Meyenhofer
M & Barton A (2004) Novel single-stranded oligonucleotides that inhibit signal transducer and activator of
transcription 3 induce apoptosis in vitro and in vivo in
prostate cancer cell lines. Mol Cancer Ther 3, 1183–1191.
Tomita T, Takano H, Tomita N, Morishita R, Kaneko

M, Shi K, Takahi K, Nakase T, Kaneda Y, Yoshikawa
H et al. (2000) Transcription factor decoy for
NFkappaB inhibits cytokine and adhesion molecule
expressions in synovial cells derived from rheumatoid
arthritis. Rheumatology (Oxford) 39, 749–757.
Nakamura H, Aoki M, Tamai K, Oishi M, Ogihara T,
Kaneda Y & Morishita R (2002) Prevention and regression of atopic dermatitis by ointment containing NF-kB
decoy oligodeoxynucleotides in NC ⁄ Nga atopic mouse
model. Gene Ther 9, 1221–1229.
Liu X, Li J & Zhang J (2007) STAT3-decoy ODN
inhibits cytokine autocrine of murine tumor cells. Cell
Mol Immunol 4, 309–313.
Bromberg JF, Horvath CM, Wen Z, Schreiber RD &
Darnell JE Jr (1996) Transcriptionally active Stat1 is
required for the antiproliferative effects of both interferon alpha and interferon gamma. Proc Natl Acad Sci
USA 93, 7673–7678.
Bromberg JF, Fan Z, Brown C, Mendelsohn J & Darnell JE Jr (1998) Epidermal growth factor-induced
growth inhibition requires Stat1 activation. Cell Growth
Differ 9, 505–512.
Chin YE, Kitagawa M, Kuida K, Flavell RA & Fu XY
(1997) Activation of the STAT signaling pathway can
cause expression of caspase 1 and apoptosis. Mol Cell
Biol 17, 5328–5337.
Lin Q, Lai R, Chirieac LR, Li C, Thomazy VA, Grammatikakis I, Rassidakis GZ, Zhang W, Fujio Y, Kunisada K et al. (2005) Constitutive activation of
JAK3 ⁄ STAT3 in colon carcinoma tumors and cell lines:
inhibition of JAK3 ⁄ STAT3 signaling induces apoptosis
and cell cycle arrest of colon carcinoma cells. Am J
Pathol 167, 969–980.
Kunnumakkara AB, Anand P & Aggarwal BB (2008)
Curcumin inhibits proliferation, invasion, angiogenesis

and metastasis of different cancers through interaction
with multiple cell signaling proteins. Cancer Lett 269,
199–225.
Lin JK (2007) Molecular targets of curcumin. Adv Exp
Med Biol 595, 227–243.
Schust J, Sperl B, Hollis A, Mayer TU & Berg T (2006)
Stattic: a small-molecule inhibitor of STAT3 activation
and dimerization. Chem Biol 13, 1235–1242.
Laguillier C, Hbibi AT, Baran-Marszak F, Metelev V,
Cao A, Cymbalista F, Bogdanov A Jr & Fagard R
(2007) Cell death in NF-kappaB-dependent tumour cell
lines as a result of NF-kappaB trapping by linker-modi-

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS


A. Tadlaoui Hbibi et al.

31

32

33

34

35

36

37

fied hairpin decoy oligonucleotide. FEBS Lett 581,
1143–1150.
Geller J, Petak I, Szucs KS, Nagy K, Tillman DM &
Houghton JA (2003) Interferon-gamma-induced sensitization of colon carcinomas to ZD9331 targets caspases,
downstream of Fas, independent of mitochondrial
signaling and the inhibitor of apoptosis survivin. Clin
Cancer Res 9, 6504–6515.
Geller JI, Szekely-Szucs K, Petak I, Doyle B & Houghton JA (2004) P21Cip1 is a critical mediator of the
cytotoxic action of thymidylate synthase inhibitors in
colorectal carcinoma cells. Cancer Res 64, 6296–6303.
Bene A, Kurten RC & Chambers TC (2004) Subcellular
localization as a limiting factor for utilization of decoy
oligonucleotides. Nucleic Acids Res 32, e142.
Regis G, Pensa S, Boselli D, Novelli F & Poli V (2008)
Ups & downs: The STAT1:STAT3 seesaw of Interferon
and gp130 receptor signalling. Semin Cell Dev Biol 19,
351–359.
Holschermann H, Stadlbauer TH, Wagner AH, Fingerhuth H, Muth H, Rong S, Guler F, Tillmanns H &
Hecker M (2006) STAT-1 and AP-1 decoy oligonucleotide therapy delays acute rejection and prolongs cardiac
allograft survival. Cardiovasc Res 71, 527–536.
Stojanovic T, Scheele L, Wagner AH, Middel P, Bedke
J, Lautenschlager I, Leister I, Panzner S & Hecker M
(2007) STAT-1 decoy oligonucleotide improves microcirculation and reduces acute rejection in allogeneic rat
small bowel transplants. Gene Ther 14, 883–890.
Huckel M, Schurigt U, Wagner AH, Stockigt R, Petrow
PK, Thoss K, Gajda M, Henzgen S, Hecker M & Brauer R (2006) Attenuation of murine antigen-induced
arthritis by treatment with a decoy oligodeoxynucleo-

STAT3 hairpin decoy oligonucleotide cell killing

38

39

40

41

42

43

44

tide inhibiting signal transducer and activator of
transcription-1 (STAT-1). Arthritis Res Ther 8, R17.
Wagner AH, Wittjen I, Stojanovic T, Middel P, Meingassner JG & Hecker M (2008) Signal transducer and
activator of transcription 1 decoy oligodeoxynucleotide
suppression of contact hypersensitivity. J Allergy Clin
Immunol 121, 158–165.
Lui VW, Boehm AL, Koppikar P, Leeman RJ, Johnson
D, Ogagan M, Childs E, Freilino M & Grandis JR
(2007) Antiproliferative mechanisms of a transcription
factor decoy targeting signal transducer and activator
of transcription (STAT) 3: the role of STAT1. Mol
Pharmacol 71, 1435–1443.
Ozaki Y, Edelstein MP & Duch DS (1988) Induction of
indoleamine 2,3-dioxygenase: a mechanism of the antitumor activity of interferon gamma. Proc Natl Acad Sci

USA 85, 1242–1246.
Stephanou A (2004) Role of STAT-1 & STAT-3 in
ischaemia ⁄ reperfusion injury. Cell J Mol Med 8,
519–525.
Hilfiker-Kleiner D, Hilfiker A & Drexler H (2005)
Many good reasons to have STAT3 in the heart. Pharmacol Ther 107, 131–137.
Gariboldi MB, Ravizza R, Molteni R, Osella D,
Gabano E & Monti E (2007) Inhibition of
Stat3 increases doxorubicin sensitivity in a human
metastatic breast cancer cell line. Cancer Lett 258,
181–188.
Albanese C, Johnson J, Watanabe G, Eklund N, Vu D,
Arnold A & Pestell RG (1995) Transforming p21ras
mutants and c-Ets-2 activate the cyclin D1 promoter
through distinguishable regions. J Biol Chem 270,
23589–23597.

FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS

2515