Tài liệu Báo cáo khoa học: The yeast ubiquitin ligase Rsp5 downregulates the alpha subunit of nascent polypeptide-associated complex Egd2 under stress conditions docx

The yeast ubiquitin ligase Rsp5 downregulates the alpha
subunit of nascent polypeptide-associated complex Egd2
under stress conditions
Hiroyuki Hiraishi
1,
*, Takashi Shimada
2,
*, Iwao Ohtsu
1
, Taka-Aki Sato
2
and Hiroshi Takagi
1
1 Graduate School of Biological Sciences, Nara Institute of Science and Technology, Nara, Japan
2 Life Science Research Center, Shimadzu Co., Tokyo, Japan
Introduction
Stress induces protein denaturation, generates abnor-
mal proteins, and leads to growth inhibition or cell
death. Such abnormal proteins are ubiquitinated and
mainly degraded via the proteasome pathway, as indi-
cated by the fact that some ubiquitin-conjugating
enzyme mutants and ubiquitin ligase mutants showed
increased sensitivity to various stresses [1–3]. A few
studies have analysed the degradation system of stress-
induced ubiquitinated proteins using model substrates,
for example mis-folded proteins such as CPY*, a
mutant type of carboxypeptidase Y, or ubiquitin-fused
proteins such as ubiquitinated b-galactosidase [4,5]. It
Keywords
nascent polypeptide-associated complex;
Saccharomyces cerevisiae; stress response;

ubiquitination; ubiquitin ligase Rsp5
Correspondence
H. Takagi, Graduate School of Biological
Sciences, Nara Institute of Science and
Technology, 8916-5 Takayama, Ikoma, Nara
630-0192, Japan
Fax: +81 743 72 5429
Tel: +81 743 72 5420
E-mail:
*These authors contributed equally to this
work
(Received 23 May 2009, revised 6 July
2009, accepted 20 July 2009)
doi:10.1111/j.1742-4658.2009.07226.x
The ubiquitination and subsequent degradation of stress-induced abnormal
proteins are indispensable to cell survival. We previously showed that a
yeast (Saccharomyces cerevisiae) mutant carrying a single amino acid
change, Ala401Glu, in RSP5, which encodes an essential E3 ubiquitin
ligase, is hypersensitive to various stresses. To identify the protein sub-
strates of Rsp5, we performed a comparative proteome analysis of the
wild-type and rsp5 mutant strains under stress conditions. The results we
obtained indicate that several proteins, including the a-subunit of nascent
polypeptide-associated complex (aNAC, Egd2) accumulated in the rsp5
mutant. To investigate whether or not Rsp5 ubiquitinates these proteins in
a stress-dependent manner, cell extracts were analyzed by immunoprecipita-
tion followed by western blotting after exposure to temperature upshift.
Interestingly, Egd2 was ubiquitinated in the wild-type cells but not in the
rsp5 mutant cells under these stress conditions. We also detected in vitro
ubiquitination of Egd2 by Rsp5 at elevated temperature. Moreover, Egd2
was ubiquitinated in the egd1 and not4 deletion mutants lacking bNAC

and the RING-type ubiquitin ligase Not4, respectively, indicating that
ubiquitination of Egd2 is independent of Egd1 and Not4. We also showed
that, under stress conditions, Egd2 was mainly degraded via the protea-
some pathway. These results strongly suggest that Rsp5 is involved in selec-
tive ubiquitination and degradation of stress-induced unstable proteins,
such as Egd2.
Structured digital abstract
l
MINT-7228949: EGD2 (uniprotkb:P38879) physically interacts (MI:0915) with ubiquitin
(uniprotkb:
P61864) by anti-tag co-immunoprecipitation (MI:0007)
Abbreviations
CX, cycloheximide; NAC, nascent polypeptide-associated complex.
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5287
has also been reported that short-lived or long-lived
proteins are degraded by the proteasome or vacuolar
proteolysis pathways, respectively [6], but the detailed
mechanisms underlying these pathways are poorly
understood.
Previously, we isolated a yeast (Saccharomyces cere-
visiae) mutant that is hypersensitive to various stresses,
including toxic amino acid analogues, high growth
temperature in a rich medium, ethanol, LiCl and
H
2
O
2
. This mutant carried a single amino acid change,
replacing Ala (GCA) at position 401 with Glu (GAA)
in the RSP5 allele encoding an essential HECT-type

E3 ubiquitin ligase [7]. Therefore, we speculate that
Rsp5 is involved in degradation of stress-induced
abnormal proteins and that the mutant Rsp5 fails to
recognize or ubiquitinate the targeted proteins.
Recently, we showed that Rsp5 primarily regulates the
expression of Hsf1 and Msn2 ⁄ 4, major transcription
factors that are required for expression of genes encod-
ing stress proteins, at the post-transcriptional level,
and is involved in the repair system for stress-induced
abnormal proteins [8,9]. The Rsp5 protein is known to
ubiquitinate plasma membrane permeases such as the
general amino acid permease Gap1, followed by endo-
cytosis and vacuolar degradation [10]. On the other
hand, Rsp5 has been reported to mediate stress-
induced degradation of cytosolic proteins such as
Hpr1, a member of the THO ⁄ TREX (transcription ⁄
export) complex that couples mRNA transcription to
nuclear export, and the large subunit of RNA poly-
merase II [11,12]. These results suggest that Rsp5 is
involved in the expression of some proteins at both the
transcriptional and post-translational level. However,
it remains unclear what kind of proteins are denatured
and trigger growth inhibition or cell death under
stress conditions. Hence, identification of the sub-
strates of ubiquitin ligase represents a major challenge
to understanding of the mechanism of ubiquitination
and degradation via either the proteasome-mediated or
vacuolar proteolysis pathway under stress conditions.
The nascent polypeptide-associated complex (NAC)
is conserved throughout the eukaryotic world from

yeast to human, where it is present as a heterodimer
composed of two subunits (aNAC and bNAC) that
are both in direct contact with nascent polypeptide
chains protruding from the ribosome to protect from
protease attack [13–15]. The yeast genome encodes one
aNAC (Egd2) and two bNAC (Egd1 and Btt1) [16–
18]. Both bNACs can form heterodimeric complexes
with aNAC, although Btt1 is significantly less abun-
dant than Egd1 [19,20]. NAC was thought to be
involved in the mitochondrial import of precursor
proteins by having a stimulatory effect on protein
targeting in vitro [14]. Moreover, the general impor-
tance of NACs is emphasized by the embryonic
lethality of NAC mutants in mice, nematodes (Caenor-
habditis elegans) and fruit flies (Drosophila melanoga-
ster), although deletion of the genes encoding NAC
results in no obvious phenotypes in yeast [21–23].
Recently, it was found that Egd2 was ubiquitinated by
the RING-type E3 ubiquitin ligase Not4 when glucose
was decreased in the growth medium [24]. However, it
remains to be elucidated how ubiquitination of this
complex could contribute to the interaction with ribo-
somes or nascent polypeptides.
To identify the targeted substrates for Rsp5 whose
ubiquitination and subsequent degradation could play
a crucial role in cell survival under severe stress condi-
tions, we performed a proteome analysis of the wild-
type and rsp5 mutant strains using comparative
2D-PAGE and MS. We show that the Egd2 protein is
ubiquitinated by Rsp5 and degraded mainly via the

proteasome pathway under stress conditions. Our
results reveal that several proteins can be ubiquitinated
by Rsp5 in a stress-dependent manner, and we propose
a model for the role of Rsp5 under stress conditions.
Results
Comparative proteome analysis of the wild-type
and rsp5 mutant cells under stress conditions
We previously isolated the rsp5 mutant strain CHT81,
which, relative to the wild-type strain, shows greater
sensitivity to various stresses that induce protein dena-
turation or mis-folding in the cell, such as toxic amino
acid analogues, high growth temperature in a rich
medium, ethanol, LiCl and H
2
O
2
[7]. Thus, we pro-
posed a novel function of Rsp5 in selective degrada-
tion of abnormal proteins generated by such stresses.
To identify stress-dependent substrates for Rsp5, we
performed a proteome analysis of strains CKY8 (wild-
type) and CHT81 (rsp5 mutant) exposed to tempera-
ture upshift using comparative 2D-PAGE and MS
(Fig. 1 and Table 1). The activity of Rsp5 is indispens-
able to regulate the expression of many proteins at the
transcriptional and post-translational level, because
Rsp5 is known to regulate the activity of the RNA
polymerase II and Hpr1, which is a member of the
THO ⁄ TREX complex [11,12]. Nevertheless, some pro-
teins, such as Hsp12, Pda1, Sod1, Hsp78 and Egd2,

accumulated to higher levels in the rsp5 mutant cells
than in the wild-type cells under high growth tempera-
ture in a rich medium (Fig. 1A and Table 1). As it is
known that the heat-shock proteins (Hsp12 and
Hsp78) and Sod1 are induced in response to various
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5288 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
stresses, we excluded these proteins from further analy-
sis as candidate substrates of Rsp5 (Fig. 1A). Thus, we
focused on the behavior of other two proteins, i.e.
Egd2 and Pda1 (Fig. 1B). Egd2 was upregulated in the
wild-type cells within 2 h after temperature upshift,
and was subsequently downregulated. However, in the
rsp5 mutant cells, Egd2 was upregulated within 4 h
after temperature upshift, and its level then remained
stable. The protein level of Pda1 in the rsp5 mutant
cells increased in a time-dependent manner compared
with wild-type cells throughout the temperature
upshift.
Identification of substrates of Rsp5 under stress
conditions
Based on the above results showing that some proteins
accumulated in the rsp5 mutant in a stress-dependent
A
B
Egd2
0246 8
(h)
024 6 8
Pda1

CHT81 (rsp5 mutant)
CHT81 (rsp5 mutant)
CHT81 (rsp5 mutant)
CKY8 (Wild-type)
CKY8 (Wild-type)
024 6 8Time (h)
Time (h)
02468
(h)
CHT81
(rsp5 mutant)
CKY8
(Wild-type)
Hsp12
Egd2
Sod1
Egd2
Pda1
Pda1
Hsp78
Hsp78
Hsp12
Sod1
250
150
100
75
50
37
25

20
15
10
250
150
100
75
50
37
25
20
15
10
pH
pH
5.0
8.0
pH
pH
5.0
8.0
Fig. 1. Comparative proteome analysis of yeast cells. (A) Strains CKY8 (wild-type) and CHT81 (rsp5 mutant) were cultured to stationary
growth phase in YPD medium at 25 °C and subjected to a temperature upshift to 37 °C for 0, 2, 4, 6 and 8 h. Cell extracts were prepared
from the cultures and subjected to 2D-PAGE. The gel patterns represent the cell extracts for each strain after shifting to 37 °C for 6 h. Pro-
teins were visualized using Coomassie brilliant blue G-250. Proteins that accumulate in the rsp5 mutant cells are indicated by arrowheads
and protein names. The positions of molecular mass standards are shown on the left. (B) Time course of the change in Egd2 and Pda1
amounts in strains CKY8 (wild-type) and CHT81 (rsp5 mutant) subjected to temperature upshift to 37 °C for 0, 2, 4, 6 and 8 h. Histograms
show the protein abundance based on the intensity of bands in the 2D gels indicated by white and black bars for the wild-type and rsp5
mutant strains, respectively.
Table 1. Classification of identified gene products that accumulated in the rsp5 mutant strains under high growth temperature.

Gene Function Peptide sequence identified
HSP12 Heat shock protein ASEALKPD SQKSYAEQGK EYITDK
PDA1 a-subunit of pyruvate dehydrogenase complex GFCHLSVGQEAIAVGIENAITK
SOD1 Cu–Zn superoxide dismutase VQAVAVLKGD AGVSGVVK
HSP78 Heat shock protein MDPNQQPEKPALEQFGTNLTK
EGD2 a-subunit of nascentpolypeptide associated complex LAAAQQQAQASGIMPSNEDVATK
H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5289
manner, we constructed wild-type and rsp5 mutant
strains expressing HA fusion proteins such as Pda1–
HA and Egd2–HA, and examined the stability of these
proteins at 25 or 37 °C using the protein synthesis
inhibitor cycloheximide (CX). In the absence of CX,
western blot analysis using anti-HA serum showed that
the protein level of Egd2 in the wild-type cells (CKE8)
gradually decreased after the temperature upshift,
probably due to its degradation (Fig. 2A). It is note-
worthy that the level of Egd2 in the rsp5 mutant cells
(CHE81) remained stable (Fig. 2A). However, in the
presence of CX, the amount of Egd2 was decreased in
both the wild-type and rsp5 mutant cells after the tem-
perature upshift. There was no significant difference in
the amounts of other proteins between the strains after
up to 6 h of exposure to high temperature (data not
shown).
Next, we examined whether or not Egd2 is ubiquiti-
nated by Rsp5 in the wild-type cells under stress condi-
tions (Fig. 2B). When the wild-type and rsp5 mutant
strains expressing Egd2–HA (CKE8 and CHE81,
respectively) were exposed to high growth temperature,

the polyubiquitin-conjugated form of Egd2 was clearly
detected in the wild-type cells. However, it seems likely
that little ubiquitination of Egd2 occurred in the rsp5
mutant cells (Fig. 2B).
As Egd2 was shown to be ubiquitinated in the wild-
type cells, but not in the rsp5 mutant cells under stress
conditions, we examined whether or not Rsp5 can
directly ubiquitinate Egd2 at high temperature by an
in vitro ubiquitination assay using Ubc4 and Egd2–HA
as the E2 enzyme and the substrate, respectively
(Fig. 3). In agreement with the results of the in vivo
ubiquitination experiment, more polyubiquitinated
Egd2 was detected in the presence of Rsp5 at 37 °C
than at 25 °C. Moreover, the monoubiquitinated form
of Rsp5 was detected at both temperatures (25 and
37 °C). Taken together, our results show that Egd2 is
ubiquitinated by Ubc4 and then polyubiquitinated in
the presence of Rsp5 under stress conditions such as
high temperature.
Ubiquitination of Egd2 is independent of Egd1
and Not4
Panasenko et al. [24] recently reported that Egd2 and
Egd1, which form a heterodimeric complex named
A
B
0124Time (h)
+CX–CX –CX +CX
25 °C 37 °C
CKE8
(Wild-type)

CHE81
(rsp5 mutant)
Egd2
Pgk1
Egd2
Pgk1
124124124
Time (h)
Time (min)
CKE8
(Wild-type)
CHE81
(rsp5 mutant)
Ub-Egd2
Egd2
Pgk1
0 30 60 120 0 30 60 120
Fig. 2. Stress-induced ubiquitination of Egd2 by Rsp5. Strains
CKE8 (wild-type) and CHE81 (rsp5 mutant) expressing Egd2–HA
were cultured to logarithmic growth phase at 25 °C and shifted to
37 °C for the times indicated. (A) The wild-type and rsp5 mutant
cells were incubated for indicated times in the presence or absence
of 0.2 mgÆml
)1
CX at 25 or 37 °C. Whole-cell extracts were
prepared, and the protein levels of Egd2–HA were examined by
western blot analysis using an anti-HA serum. (B) The Egd2–HA
proteins were immunoprecipitated from whole-cell extracts using
anti-HA serum. Egd2–HA and ubiquitinated proteins were then
detected by western blot analysis using anti-HA and anti-ubiquitin

sera, respectively. The cytosolic Pgk1 protein used as a protein-
loading control was detected using an anti-Pgk1 serum.
Rsp5
Rsp5
Rsp5
Egd2
(Ub)n-Egd2
Egd2
Ubc4
25 °C
37 °C
Fig. 3. In vitro ubiquitination of Egd2 by Rsp5. Purified recombinant
Egd2–HA was incubated with E1, Ubc4, Ub and ATP in the pres-
ence or absence of Rsp5 at 25 or 37 °C. For the negative control,
Egd2–HA or Ubc4 were omitted. Egd2–HA and ubiquitinated
proteins were detected as described in Fig. 2B. The recombinant
His6-tagged Rsp5 proteins were detected using an anti-His serum.
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5290 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
NAC, are ubiquitinated by the RING-type ubiquitin
ligase Not4, particularly when glucose is decreased in
the growth medium. We thus investigated whether
stress-induced ubiquitination of Egd2 might depend on
the presence of Egd1 and Not4 using strains CKE8e1
(egd1D) and CKE8n4 (not4D) expressing Egd2–HA at
25 or 37 °C (Fig. 4A,B). As with wild-type strain
CKE8 cells, polyubiquitination of Egd2 was observed
in cells of both deletion mutants at 37 °C. These
results show that Rsp5-mediated ubiquitination of
Egd2 is independent of Egd1 and Not4 under stress

conditions.
Degradation pathway of Egd2 ubiquitinated by
Rsp5
To explore the pathway involved in degradation of the
ubiquitinated Egd2, we first examined the protein lev-
els of Egd2 by western blot analysis using mutant
strains deficient in the major proteolytic pathways (the
vacuolar and proteasome pathways) (Fig. S1). Under
high temperature, Egd2 was clearly degraded in cell
extracts of the wild-type strains (YPH500 and CKE8).
A similar result was obtained using the pep4-disrupted
strain CKE8p4, which lacks the major vacuolar prote-
olytic pathway, under stress conditions. In contrast,
Egd2 was stabilized even at elevated temperature in
the cim5-1 temperature-sensitive mutant CMY765E in
which proteasome activity is impaired [25]. The Cim5
protein is one of six ATPases of the 19S regulatory
particle of the 26S proteasome involved in the degra-
dation of ubiquitinated substrates [25].
Next, to further examine the role of the proteasome
in degradation of heat-labile Egd2, we analyzed the
stability of Egd2 at 25 or 37 °C using CX (Fig. 5).
Under high temperature, in the presence or absence of
CX, Egd2 was clearly destabilized in cell extracts of
the wild-type strain (YPH500E) compared with the
cim5-1 mutant deficient in the proteasome pathway
(CMY765E). These results show that Egd2 is degraded
mainly via the proteasome pathway under high tem-
peratures.
Discussion

Conformational changes in proteins caused by post-
translational modifications, such as oxidation [26],
phosphorylation[27] and N-linked glycosylation [28],
are involved in specific recognition by ubiquitin ligase
for ubiquitination of the substrate proteins. These
observations suggest that stress-induced unfolding or
mis-folding of proteins may also be a signal for ubiqui-
tination of denatured proteins that are recognized by
the appropriate ubiquitin ligase. In human cells, block-
ing of the metabolism of mis-folded proteins leads to
the formation of intracellular aggregates, which causes
serious diseases such as neurodegenerative disorders,
B
A
Ub-Egd2
0 30 60 120 30 60 120 0 30 60 120 30 60 120
25 °C 37 °C 25 °C 37 °C
Egd2
Pgk1
CKE8e1
(egd1D)
CKE8
(Wild-type)
Time (min)
0 30 60 120 30 60 120
0 30 60 120 30 60 120
25 °C
37 °C 25 °C 37 °C
Ub-Egd2
Egd2

Pgk1
CKE8n4
(not4D)
CKE8
(Wild-type)
Time (min)
Fig. 4. Ubiquitination of Egd2 in the absence of Egd1 and Not4.
Strains CKE8 (wild-type) (A,B), CKE8e1 (egd1D) (A) and CKE8n4
(not4D) (B) expressing Egd2–HA were cultured to logarithmic
growth phase at 25 °C and shifted to 37 °C for the times indicated.
The ubiquitination of Egd2–HA were examined by western blot
analysis as described in Fig. 2B. The cytosolic Pgk1 protein used as
a protein-loading control was detected using an anti-Pgk1 serum.
Egd2
Pgk1
Egd2
Pgk1
YPH500E
(Wild-type)
CMY765E
(cim-1)
0124Time (h)
25 °C
–CX
–CX
+CX +CX
37 °C
124 124 124
Fig. 5. Degradation of Egd2 under stress conditions. Strains
YPH500E (wild-type) and CMY765E (cim5-1) expressing Egd2–HA

were cultured to logarithmic growth phase at 25 °C, and incubated
for indicated times in the presence or absence of 0.2 mgÆml
)1
CX
at 25 or 37 °C. Whole-cell extracts were prepared, and the protein
levels of Egd2–HA were examined by western blot analysis using
an anti-HA serum. The cytosolic Pgk1 protein used as a protein-
loading control was detected using an anti-Pgk1 serum.
H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5291
including Alzheimer’s disease, Huntington’s disease
and amyotrophic lateral sclerosis [29,30]. These aggre-
gates are ubiquitinated by RING-type ubiquitin ligases
such as Parkin, following active sequestration into ag-
gresomes and autophagic clearance [31]. It is also
reported that U-box- and RING-type ubiquitin ligases
such as CHIP, San1 and Ubr1 are involved in ubiquiti-
nation of denatured proteins under stress conditions
[32–34]. In addition, identification of ubiquitinated
forms of mis-folded proteins by HECT-type ubiquitin
ligase under stress conditions has not been studied pre-
viously. Thus, we focused here on the function of
HECT-type ubiquitin ligase and the degradation mech-
anism of the substrates under stress conditions using
yeast cells.
We previously isolated the yeast HECT-type ubiqu-
itin ligase rsp5 mutant, which shows hypersensitivity to
various stresses that induce protein mis-folding in the
cell, probably because this mutant fails to ubiquitinate
the mis-folded abnormal proteins generated under

stress conditions [7]. In the present study, we identified
Egd2 (aNAC) as one of the protein substrates for
Rsp5 under stress conditions. The Egd2 protein was
co-purified with its partner Egd1 [16]. Egd2 forms a
complex with Egd1 (b
1
NAC) as well as Btt1 (b
2
NAC)
in vivo. Cells lacking both Egd1 and Btt1 show growth
defects at 37 °C. However, such temperature sensitivity
does not occur when the EGD2 gene is disrupted in
the egd1D btt1D background [19]. Rospert et al. [15]
interpreted this result as follows: in the absence of its
partner subunits, Egd2 negatively affects the growth of
yeast cells, and the induction of several genes, includ-
ing the GAL genes, is due to a toxic effect of ‘mono-
meric’ Egd2. Thus we speculate that, under stress
conditions, unstable forms of Egd2 are not ubiquitinat-
ed but accumulate in the rsp5 mutant cells, leading to
growth inhibition or cell death. It should be noted that
the mRNA levels of EGD2 were almost the same in
wild-type and rsp5 cells, and were not significantly
affected by stress (data not shown). This suggests that
ubiquitin-conjugated forms of Egd2 are produced
under stress conditions, but that little ubiquitination of
the native forms of Egd2 occurs under non-stress con-
ditions. We also found that the stability of Egd2 was
decreased in wild-type cells but not in rsp5 mutant cells
in the absence of CX (Fig. 2A). However, in the pres-

ence of CX, Egd2 levels were decreased in both the
wild-type and rsp5 mutant cells. This result suggests
that newly synthesized Egd2, but not already existing
Egd2, accumulates in rsp5 mutant cells. This raises the
possibility that Rsp5 is involved in regulation of the
Egd2 level by either direct or indirect ubiquitination,
regardless of the stress.
Rsp5 has been shown to play a pivotal role in the
nuclear export and modification of mRNA, rRNA and
tRNA [35,36]. Ubiquitination of some mRNA nuclear
transport factors contributes to regulation of this
transport pathway. mRNA export requires that newly
synthesized precursor mRNAs undergo several pro-
cessing steps, which include 5¢-capping, splicing, 3¢-end
cleavage and polyadenylation. The various steps lead-
ing to formation of the ribonucleoprotein complex are
linked, and are often mediated by interactions with the
RNA polymerase II transcription machinery. Recently,
Neumann et al. [37] reported that the rsp5-3 mutant
was strongly impaired in nuclear export of mRNA and
ribosomal 60S subunits after a shift from 25 to 37 ° C.
In addition, tRNA and rRNA export defects in the
rsp5-3 mutant are preceded by severe inhibition of pre-
tRNA and pre-rRNA processing. In our study, how-
ever, there were no significant differences in the levels
of EGD2 mRNA between the wild-type and rsp5 cells
under stress conditions (data not shown). Taking this
account, it appears that Rsp5 does not regulate Egd2
at the transcriptional level, but is involved in post-
translational modifications such as ubiquitination.

Egd2 is reportedly ubiquitinated by the Ccr4–Not
complex, containing Not4 as the RING-type ubiquitin
ligase, under physiological conditions such as glucose
depletion [24]. In addition, Egd2 does not associate
with a ubiquitin molecule, although it contains a
ubiquitin-associated domain [38]. However, it is inter-
esting that stress-induced ubiquitination of Egd2 is
likely to occur in a Not4-independent manner. Thus
we concluded that the ubiquitination mechanism of
Egd2 differs between non-stress and stress conditions.
Although Rsp5 has three WW domains that bind the
PY motifs conserved in its substrates [39–41], no PY
motif is found in the amino acid sequence of Egd2.
Therefore, other motifs or sequences in the unstable
Egd2 may be recognized via the WW3 domain of
Rsp5 in order for ubiquitination to proceed.
Panasenko et al. [24] reported ubiquitination of
Egd2 but did not demonstrate the degradation path-
way of ubiquitinated Egd2. Here, we found that the
Egd2 protein is degraded via the proteasome pathway
at elevated temperatures. This result suggests that the
polyubiquitin-conjugated form of Egd2 under stress
conditions is degraded through the proteasome path-
way like other mutant or abnormal proteins [42].
George et al. [43] reported that yeast mutant cells lack-
ing NAC suffered from mitochondrial defects and
decreased levels of mitochondria co-translationally. On
the other hand, purified Egd2 has been reported to
prevent the aggregation of a denatured model protein,
suggesting that Egd2 has a chaperone-like activity [44].

Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5292 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
In addition to Rsp5-regulated ubiquitination and
degradation of unstable proteins such as Egd2, the
stress-induced instability of Egd2 might cause its dys-
function, leading to mis-targeting and ⁄ or mis-folding
of mitochondrial proteins in the cell under stress con-
ditions. In addition, it is important to determine
whether or not Egd2 is correctly folded and functions
under stress conditions. Unfortunately, we could not
obtain any direct evidence of mis-folding or denaturing
of the Egd2 protein despite various functional analyses
such as a pulldown assay using glutathione S-transfer-
ase (GST) to detect denatured and inactive forms of
Egd2 under stress conditions. It may be difficult to
prove that Egd2 is inactive under stress conditions
because both Egd2 (aNAC) and Egd1 (b
1
NAC) mole-
cules have low molecular weights and each NAC
domain in the two proteins is also small [45], so that
the unfolded or mis-folded Egd2 proteins might be
folded correctly in the purification or interaction pro-
cess. In the wild-type strain, it is probable that the
ubiquitinated forms of Egd2 are degraded as part of
an adaptive response to stress rather than a conse-
quence of mis-folding in the proteasome, and yeast
cells could acquire stress resistance. In contrast, the
Egd2 proteins in the rsp5 mutant strain might accumu-
late under stress conditions, and yeast cells would

show stress sensitivity. We must further analyze how
Rsp5 recognizes Egd2 and which lysine residue in the
ubiquitin molecule participates in the polyubiquitina-
tion of Egd2 under stress conditions.
The above approach could be a useful method for
studying the ubiquitin-mediated degradation of stress-
induced abnormal proteins. It is unclear whether or
not the molecular mechanism of ubiquitin ligase Rsp5
can distinguish between native and unfolded states of
the proteins under stress conditions. We aim to deter-
mine whether there is a general rule underlying the
mechanism to distinguish unfolded forms from native
ones by using model protein substrates.
Experimental procedures
Materials
Monoclonal anti-HA (12CA5), anti-ubiquitin (P4D1), anti-
3-phosphoglycerate kinase (22C5), and anti-pentaHis sera
were purchased from Roche Diagnostics (Mannheim,
Germany), Santa Cruz Biotechnology (Santa Cruz, CA,
USA), Molecular Probes (Eugene, OR, USA) and Qiagen
(Valencia, CA, USA), respectively. Horseradish peroxidase-
coupled secondary antibody was from GE Healthcare
(Piscataway, NJ, USA). N-ethylmaleimide (solubilized in
DMSO) and electrophoresis reagents were purchased from
Nacalai Tesque (Kyoto, Japan).
Strains and plasmids
The S. cerevisiae strains used in this study are listed in
Table 2. Strains CKE8, CHE81, YPH500E and CMY765E
were constructed by the homologous recombination method
[46]. The integration cassette from plasmid pFA6a-3HA-

kanMX6 (supplied by K. Kitamura, Center for Gene
Science, Hiroshima University, Japan) [47] was amplified
using oligonucleotide primers EGD2-F2 and EGD2-R1
(Table 3). These PCR fragments were introduced into
strains CKY8 (wild-type) (supplied by C. Kaiser, Depart-
ment of Biology, Massachusetts Institute of Technology,
Cambridge, MA, USA) and YPH500 (wild-type) (supplied
by Yeast Genetic Resource Center, Osaka University,
Japan) or CHT81 (the Ala401Glu rsp5 mutant) [7] and
CMY765 (cim5-1 mutant) (supplied by Yeast Genetic
Resource Center), and strains into which EGD2-3HA-Kan
was integrated were selected as geneticin (G418)-resistant
transformants. The correct integration and expression of
EGD2 were confirmed by PCR, DNA sequencing and
western blot analysis.
To construct pGEX-EGD2HA, the DNA fragment of
EGD2 was amplified by PCR performed using genomic
DNA from CKY8 and oligonucleotide primers EGD2-
EcoRI (+) and EGD2HA-XhoI ()) (Table 3). The unique
amplified band of 565 bp corresponding to EGD2-HA was
Table 2. Yeast strains used in this study.
Strain Genotype References
CKY8 MATa ura3-52 leu2-3, 112 RSP5 [7]
CKE8 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan This study
CKE8e1 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan egd1::URA3 This study
CKE8n4 MATa ura3-52 leu2-3, 112 RSP5 EGD2-3HA-Kan not4::URA3 This study
CHT81 MATa ura3-52 leu2-3, 112 rsp5A401E [7]
CHE81 MATa ura3-52 leu2-3, 112 rsp5A401E EGD2-3HA-Kan This study
YPH500 MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1 Yeast Genetic Resource Center
YPH500E MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1 EGD2-3HA-Kan This study

CMY765 MATa cim5-1 ura3-52 leu2-D1 his3-D200 Yeast Yeast Genetic Resource Center
CMY765E MATa cim5-1 ura3-52 leu2-D1 his3-D200 EGD2-3HA-Kan This study
H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5293
digested with EcoRI and XhoI, and then ligated into the
EcoRI and XhoI sites of pGEX-6P-1 (GE Healthcare) to
construct pGEX-EGD2HA, which expresses GST-tagged
Egd2–HA. We also amplified the DNA fragment containing
the 2nd exon of UBC4 by PCR performed using pUBC4
containing UBC4 including its intron and oligonucleotide
primers UBC4-BamHI (+) and UBC4-XhoI ()) (Table 3).
The unique amplified band of 455 bp corresponding to the
2nd exon of UBC4 was digested with BamHI and XhoI and
then ligated into the BamHI and XhoI sites of pBlue-
script II SK+ (Toyobo Biochemicals, Osaka, Japan). The
resultant plasmid was digested with BamHI to amplify the
cDNA of UBC4 using oligonucleotide primers UBC4-SmaI
(+) and UBC4-XhoI ()) (Table 3). The unique amplified
band of 503 bp corresponding to cDNA of UBC4 was
digested with SmaI and XhoI and then ligated into the SmaI
and XhoI sites of pGEX-6P-1 to construct pGEX-UBC4,
which expresses GST-tagged Ubc4. To prepare recombinant
Rsp5, the DNA fragment containing the WW1 and HECT
domains of Rsp5 was amplified by PCR performed using
pAD-RSP5 [8] containing full-length RSP5 and oligonucleo-
tide primers WW-Sph (+) and HECT-Pst ()) (Table 3). The
unique amplified band of 1.8 kbp corresponding to the
RSP5 fragment was digested with SphI and PstI and then
ligated into the SphI and PstI sites of pQE2 (Qiagen) to con-
struct pQE-RSP5, which expresses His6-tagged Rsp5.

Escherichia coli strain JM109 (recA1 endA1 gryA96 thi-1
hsdR17 supE44 relA1 D(lac-proAB) ⁄ F’ [traD36 proAB
+
lacI
q
lacZDM15]) was used as a host for plasmid construc-
tion and the expression of Egd2–HA, Ubc4 and Rsp5.
Culture media
The media used for growth of S. cerevisiae were a nutrient
medium, YPD (2% glucose, 1% yeast extract, 2% peptone)
and a synthetic minimal medium, SD (2% glucose, 0.67%
Bacto yeast nitrogen base without amino acids; Difco
Laboratories, Detroit, MI). Where appropriate, required
supplements were added to the SD medium for auxotrophic
strains. The E. coli recombinant strains were grown in Luri-
a–Bertani complete medium (LB) containing 50 lgÆml
)1
ampicillin or M9 minimal medium plus 2% Casamino acids
(M9CA) containing 50 lgÆml
)1
ampicillin. If necessary, 2%
agar was added to solidify the medium.
Disruption of the NOT4 and EGD1 genes
Complete gene disruption of NOT4 and EGD1 were
performed by gene replacement using homologous recom-
bination [48] to construct strains CKE8n4 and CKE8e1,
respectively. Oligonucleotides used to generate the PCR
products were as follows: NOT4, NOT4disURA3 (+) and
NOT4disURA3 ()); EGD1, EGD1disURA3 (+) and
EGD1disURA3 ()) (Table 3). The correct gene disruptions

were confirmed by PCR.
Sample preparation, 2D-PAGE, and gel image
analysis
Strains CKY8 and CHT81 cells were grown to the stationary
phase (attenuance at 600 nm of 10) in YPD medium at 25 °C
and subjected to temperature upshift (to 37 °C) for 0, 2, 4, 6
and 8 h. The cells were harvested and washed, and suspended
in three volumes of Y-PER-S (Pierce, Rockford, IL, USA),
and the whole-cell extracts were prepared by vortexing the
cells with glass beads. The protein concentration was
determined by the Bradford method, and desalted by cold
10% TCA precipitation. The protein pellet (300 lg) was
rinsed with cold ethanol ⁄ diethylether solution to remove
TCA. Collected proteins were air-dried, and solubilized in
200 lL of isoelectric focusing buffer containing 6 m urea,
2 m thiourea, 3% Chaps, 1% Triton X-100 and 50 mm
dithiothreitol. The protein solution was diluted using an IPG
ReadyStrip gel (pH 5-8, 11 cm, Bio-Rad, Hercules, CA,
Table 3. Oligonucleotides used in this study. The underlining indicates the sequence upstream of the initiation codon and downstream of
the termination codon of each target gene. The bold letters indicate the restriction sites GAATTC (EcoRI), CTCGAG (XhoI), GGATCC (BamHI),
CCCGGG (SmaI), GCATGC (SphI) and CTGCAG (PstI).
Name Oligonucleotide sequence (5¢-to3¢)
EGD2-F2 CAATGGTGACTTAGTCAACGCTATCATGTCCTTGTCTAAACGGATCCCCGGGTTAATTAA
EGD2-R1 AGAATAACTACGTACCCCTATATAATATATTTTTATATCAGAATTCGAGCTCGTTTAAAC
NOT4disURA3(+)
TCGTATATAATCCAGTCATAATGATGAATCCACACGTTCAAGAAAATTTGCAAGCAATCCAATGTGGCTGTGGTTTCAGG
NOT4disURA3())
CTGCAGCAAGAGATTGCTTCTTCTTGCTACCATGGGAGTGACTTGTAGCATTGGTATTGGGTTCTGGCGAGGTATTGGAT
EGD1disURA3(+)
GGAGGTTTAAGAATAGAACATCTCACACCAGACGCGACTCATAATTCATAATGCCAATTGAATGTGGCTGTGGTTTCAGG

EGD1disURA3())
AGTTATTTATTCGACGTCAGCATCAAAAGTTTGACCTTCAACTAACTCTGGAATAGCTTCGTTCTGGCGAGGTATTGGAT
EGD2-EcoRI(+) CCGGAATTCATGTCTGCTATCCCAGAAA
EGD2HA-XhoI()) AATTCTCGAGTTAAGCGTAATCTGGTACGTCGTATTTAGACAAGGACATGATAGCG
UBC4-BamHI(+) CACAGGATCCAGATCCACCTACTTCATGTT
UBC4-XhoI()) CCGCTCGAGCGGGCTTCTCTTTTTCAGCTGAG
UBC4-SmaI(+) AATACCCGGGGATGTCTTCTTCTAAACGTATTGCTAAAGAACTAAGTGATCTAGAAAGAGATCCACCTACTTCATGTT
WW-Sph(+) CAATGCATGCCAGACAATACTCTTCGTTTG
HECT-Pst()) GAACTGCAGAATAATCATTCTTGACCAA
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5294 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
USA). Isoelectric focusing was performed at 5000 V for 16 h
using an isoelectric focusing cell (Bio-Rad). After equilibrat-
ing the strip gel with 2D-PAGE buffer containing 6 m urea,
2% SDS, 2% dithiothreitol, 20% glycerol and bromophenol
blue, 2D-PAGE was performed on an 10-18% gradient gel
and stained using 0.1% Coomassie brilliant blue G-250
solution. Gel images were acquired by using a GS-800
calibrated imaging densitometer (Bio-Rad), and protein spot
quantification was performed using PDQuest software
(Bio-Rad). Individual protein spot intensity was normalized
against the total intensity of detected spots.
Protein identification by MS
Protein spots were listed by quantitative variation of time-
dependent fashion. Selected spots were excised, and reduc-
tive alkylation was performed using 10 mm dithiothreitol
and 100 mm ammonium bicarbonate at 56 °C, followed by
55 mm iodoacetatamide and 100 mm ammonium bicarbon-
ate at room temperature in the dark. After washing off
residual reagent and dehydrating from gel slice, the protein

was digested using trypsin in 50 mm ammonium bicarbon-
ate and 5 mm calcium chloride at 37 °C for 15 h. Peptide
fragments of the tryptic digest were purified using a ZipTip
microC18 (Millipore, Billerica, MA, USA), and eluted
directly onto a MALDI target plate according to the
manufacturer’s protocol. After air-drying, saturated
a-cyano-4-hydroxycinnamic acid solution was spotted on a
sample well, and MALDI-TOF MS analysis was performed
using AXIMA CFRplus (Shimadzu, Tokyo, Japan).
Detected peptide peaks were first externally calibrated using
the bradykinin fragment ([M+H]+ 757.40) and ACTH
fragment ([M+H]+ 2465.20), and internally calibrated
using the trypsin autolysis fragment ([M+H]+ 842.51 and
2211.10). Protein identification was performed by peptide
mass fingerprinting analysis, and monoisotopic peak pro-
cessing and database searches were performed using Mascot
Distiller and Mascot Protein Identification System (Matrix
Science, Boston, MA, USA).
Cycloheximide (CX) chase analysis
Yeast cells were grown to an attenuance at 600 nm of 2.0 in
YPD medium at 25 °C. After adding CX (Wako Pure Chem-
icals, Osaka, Japan) to a final concentration of 0.2 mgÆ ml
)1
,
cells were subjected to temperature upshift (to 37 °C) for 1, 2
and 4 h. The cells were harvested and washed, and suspended
in three volumes of Y-PER-S (Pierce), and whole-cell extracts
were prepared as described above.
SDS–PAGE and western blotting
Cell lysates or immunoprecipitated proteins were subjected

to SDS–PAGE using a 12.5% acrylamide gel, and trans-
ferred to poly(vinylidene difluoride) membrane for protein
immunoblotting [9]. Blots were visualized by enhanced
chemiluminescence and autoradiography (GE Healthcare).
The 3-phosphoglycerate kinase Pgk1 was used as an inter-
nal control.
Immunoprecipitation
At the indicated times, yeast cells were recovered and
washed, then suspended in Y-PER-S (Pierce) containing
yeast protease inhibitor cocktail, 5 mm dithiothreitol and
5mm N-ethylmaleimide. Whole-cell extracts were pre-
pared by vortexing the cells with glass beads, and diluted
using ice-cold NaCl ⁄ P
i
. The immunoprecipitation assay
was performed according to the manufacturer’s protocol
(Sigma-Aldrich, St Louis, MO, USA). Diluted whole-cell
extracts (40 lg of protein) were incubated with anti-HA
agarose (Sigma) at 4 °C overnight. The immunoprecipitated
samples were recovered after centrifugation (12 000 g,
30 s, 4 °C), and washed four times for 5 min with
NaCl ⁄ P
i
. Immunoprecipitated proteins were eluted from
agarose by incubation in 2· SDS sample buffer for 3 min
at 95–100 °C. The eluted proteins were subjected to SDS–
PAGE and analyzed by immunoblotting as described
above.
Protein purification
E. coli strain JM109 expressing GST-fused Egd2–HA or

His6-tagged Rsp5 was grown in M9CA medium at 37 ° C
to an attenuance at 600 nm of 0.5. Protein expression was
induced overnight at 18 °C using 0.1 mm isopropyl-b-d-thi-
ogalactopyranoside. The GST–Ubc4 fusion protein was
expressed in JM109 grown in LB medium at 37 °Ctoan
attenuance at 600 nm of 0.5, and induced with 0.5 mm iso-
propyl-b-d-thiogalactopyranoside for 4 h at 25 °C. Fusion
proteins were purified on glutathione–Sepharose 4B beads
(Amersham Biosciences, Piscataway, NJ, USA) and nickel–
agarose beads (Qiagen) according to the manufacturers’
instructions. GST was cleaved from Ubc4 and Egd2–HA
using pre-scission protease (Amersham Biosciences) over-
night at 4 °Cin50mm Tris ⁄ HCl, pH 7.5, 150 mm NaCl,
1mm dithiothreitol, 1 mm EDTA.
In vitro ubiquitination assay
Standard ubiquitination reactions contained 10 lLof
10· assay buffer (250 mm Tris ⁄ HCl, pH 7.5, 500 mm NaCl,
100 mm MgCl
2
,30mm ATP, 1 mm dithiothreitol), 2.5 lg
of ubiquitin, 0.1 lg of E1, 0.1 lg of Ubc4 E2 and 1.3 lgof
Egd2–HA, with or without 0.6 lg of His6-tagged Rsp5
(E3). Reactions were allowed to proceed for 2 h at 25 or
37 °C, and stopped by addition of 4· SDS–PAGE sample
buffer. The ubiquitinated Egd2–HA, His6-tagged Rsp5 and
H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5295
non-ubiquitinated Egd2–HA were detected using anti-
ubiquitin, anti-pentaHis and anti-HA sera, respectively.
Acknowledgements

We wish to thank Drs Y. Haitani, N. Yoshida, S.
Morigasaki, Y. Hamano and M. Takahashi of our lab-
oratory for discussions on this work. We also thank
Drs K. Kitamura (Center for Gene Science, Hiroshima
University, Japan), C. Kaiser (Department of Biology,
Massachusetts Institute of Technology, Cambridge,
MA, USA) and the Yeast Genetic Resource Center
(Osaka University, Japan) for providing plasmid and
yeast strains. This work was supported by a grant to
H.T. from the Program for Promotion of Basic
Research Activities for Innovative Biosciences (PRO-
BRAIN).
References
1 Jungmann J, Reins HA, Schobert C & Jentsch S (1993)
Resistance to cadmium mediated by ubiquitin-depen-
dent proteolysis. Nature 361, 369–371.
2 Seufert W & Jentsch S (1990) Ubiquitin-conjugating
enzymes UBC4 and UBC5 mediate selective degrada-
tion of short-lived and abnormal proteins. EMBO J 9,
543–550.
3 Fisk HA & Yaffe MP (1999) A role for ubiquitination
in mitochondrial inheritance in Saccharomyces cerevisi-
ae. J Cell Biol 145, 1199–1208.
4 Kohlmann S, Scha
¨
fer A & Wolf DH (2008) Ubiquitin
ligase Hul5 is required for fragment-specific substrate
degradation in endoplasmic reticulum-associated degra-
dation. J Biol Chem 283, 16374–16383.
5 Tu D, Li W, Ye Y & Brunger AT (2007) Structure and

function of the yeast U-box-containing ubiquitin ligase
Ufd2p. Proc Natl Acad Sci USA 104, 15599–15606.
6 Lee DH & Goldberg AL (1996) Selective inhibitors of
the proteasome-dependent and vacuolar pathways of
protein degradation in Saccharomyces cerevisiae. J Biol
Chem 271, 27280–27284.
7 Hoshikawa C, Shichiri M, Nakamori S & Takagi H
(2003) A nonconserved Ala401 in the yeast Rsp5 ubiqu-
itin ligase is involved in degradation of Gap1 permease
and stress-induced abnormal proteins. Proc Natl Acad
Sci USA 100, 11505–11510.
8 Haitani Y, Shimoi H & Takagi H (2006) Rsp5 regulates
expression of stress proteins via post-translational modi-
fication of Hsf1 and Msn4 in Saccharomyces cerevisiae.
FEBS Lett 580, 3433–3438.
9 Haitani Y & Takagi H (2008) Rsp5 is required for the
nuclear export of mRNA of HSF1 and MSN2 ⁄ 4 under
stress conditions in Saccharomyces cerevisiae . Genes
Cells 13, 105–116.
10 Springael JY & Andre
´
B (1998) Nitrogen-regulated
ubiquitination of the Gap1 permease of Saccharomyces
cerevisiae. Mol Biol Cell 9, 1253–1263.
11 Gwizdek C, Hobeika M, Kus B, Ossareh-Nazari B,
Dargemont C & Rodriguez MS (2005) The mRNA
nuclear export factor Hpr1 is regulated by Rsp5-medi-
ated ubiquitylation. J Biol Chem 280, 13401–13405.
12 Huibregtse JM, Yang JC & Beaudenon SL (1997) The
large subunit of RNA polymerase II is a substrate of

the Rsp5 ubiquitin–protein ligase. Proc Natl Acad Sci
USA 94, 3656–3661.
13 Wiedmann B, Sakai H, Davis TA & Wiedmann M
(1994) A protein complex required for signal-sequence-
specific sorting and translocation. Nature 370, 434–440.
14 Fu
¨
nfschilling U & Rospert S (1999) Nascent polypep-
tide-associated complex stimulates protein import into
yeast mitochondria.
Mol Biol Cell 10, 3289–3299.
15 Rospert S, Dubaquie
´
Y & Gautschi M (2002) Nascent-
polypeptide-associated complex. Cell Mol Life Sci 59,
1632–1639.
16 Shi X, Parthun MR & Jaehning JA (1995) The yeast
EGD2 gene encodes a homologue of the aNAC subunit
of the human nascent-polypeptide-associated complex.
Gene 165, 199–202.
17 Parthun MR, Mangus DA & Jaehning JA (1992) The
EGD1 product, a yeast homolog of human BTF3, may
be involved in GAL4 DNA binding. Mol Cell Biol 12,
5683–5689.
18 Hu GZ & Ronne H (1994) Yeast BTF3 protein is
encoded by duplicated genes and inhibits the expression
of some genes in vivo. Nucleic Acids Res 22, 2740–2743.
19 Reimann B, Bradsher J, Franke J, Hartmann E,
Wiedmann M, Prehn S & Wiedmann B (1999) Initial
characterization of the nascent polypeptide-associated

complex in yeast. Yeast 15 , 397–407.
20 George R, Beddoe T, Landl K & Lithgow T (1998) The
yeast nascent polypeptide-associated complex initiates
protein targeting to mitochondria in vivo. Proc Natl
Acad Sci USA 95, 2296–2301.
21 Bloss TA, Witze ES & Rothman JH (2003) Suppression
of CED-3-independent apoptosis by mitochondrial
bNAC in Caenorhabditis elegans. Nature 424, 1066–
1071.
22 Deng JM & Behringer RR (1995) An insertional muta-
tion in the BTF3 transcription factor gene leads to an
early postimplantation lethality in mice. Transgenic Res
4, 264–269.
23 Markesich DC, Gajewski KM, Nazimiec ME & Beck-
ingham K (2000) bicaudal encodes the Drosophila beta
NAC homolog, a component of the ribosomal transla-
tional machinery. Development 127, 559–572.
24 Panasenko O, Landrieux E, Feuermann M, Finka A,
Paquet N & Collart MA (2006) The yeast Ccr4–Not
complex controls ubiquitination of the nascent-associ-
Ubiquitination of Egd2 by Rsp5 under stress conditions H. Hiraishi et al.
5296 FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS
ated polypeptide (NAC–EGD) complex. J Biol Chem
281, 31389–31398.
25 Ghislain M, Udvardy A & Mann C (1993) S. cerevisiae
26S protease mutants arrest cell division in G
2
⁄ meta-
phase. Nature 366, 358–362.
26 Epstein AC, Gleadle JM, McNeill LA, Hewitson KS,

O’Rourke J, Mole DR, Mukherji M, Metzen E, Wilson
MI, Dhanda A et al. (2001) C. elegans EGL-9 and
mammalian homologs define a family of dioxygenases
that regulate HIF by prolyl hydroxylation. Cell 107,
43–54.
27 Glickman MH & Ciechanover A (2002) The ubiquitin–
proteasome proteolytic pathway: destruction for the
sake of construction. Physiol Rev 82, 373–428.
28 Yoshida Y, Tokunaga F, Chiba T, Iwai K, Tanaka K
& Tai T (2003) Fbs2 is a new member of the E3 ubiqu-
itin ligase family that recognizes sugar chains. J Biol
Chem 278, 43877–43884.
29 McClellan AJ, Tam S, Kaganovich D & Frydman J
(2005) Protein quality control: chaperones culling
corrupt conformations. Nat Cell Biol 7, 736–741.
30 Kaganovich D, Kopito R & Frydman J (2008) Misfold-
ed proteins partition between two distinct quality
control compartments. Nature 454, 1088–1095.
31 Olzmann JA & Chin LS (2008) Parkin-mediated K63-
linked polyubiquitination: a signal for targeting misfold-
ed proteins to the aggresome–autophagy pathway.
Autophagy 4, 85–87.
32 Cyr DM, Ho
¨
hfeld J & Patterson C (2002) Protein
quality control: U-box-containing E3 ubiquitin ligases
join the fold. Trends Biochem Sci 27, 368–375.
33 Gardner RG, Nelson ZW & Gottschling DE (2005)
Degradation-mediated protein quality control in the
nucleus. Cell 120, 803–815.

34 Eisele F & Wolf DH (2008) Degradation of misfolded
protein in the cytoplasm is mediated by the ubiquitin
ligase Ubr1. FEBS Lett 582, 4143–4146.
35 Rodriguez MS, Gwizdek C, Haguenauer-Tsapis R &
Dargemont C (2003) The HECT ubiquitin ligase
Rsp5p is required for proper nuclear export of
mRNA in Saccharomyces cerevisiae. Traffic 4,
566–575.
36 Kwapisz M, Cholbinski P, Hopper AK, Rousset JP &
Zoladek T (2005) Rsp5 ubiquitin ligase modulates
translation accuracy in yeast Saccharomyces cerevisiae.
RNA 11, 1710–1718.
37 Neumann S, Petfalski E, Bru
¨
gger B, Grosshans H,
Wieland F, Tollervey D & Hurt E (2003) Formation
and nuclear export of tRNA, rRNA and mRNA is
regulated by the ubiquitin ligase Rsp5p. EMBO Rep 4,
1156–1162.
38 Raasi S, Varadan R, Fushman D & Pickart CM (2005)
Diverse polyubiquitin interaction properties of ubiqu-
itin-associated domains. Nat Struct Mol Biol 12, 708–
714.
39 Hoppe T, Matuschewski K, Rape M, Schlenker S,
Ulrich HD & Jentsch S (2000) Activation of a
membrane-bound transcription factor by regulated
ubiquitin ⁄ proteasome-dependent processing. Cell 102,
577–586.
40 Sudol M & Hunter T (2000) NeW wrinkles for an old
domain.

Cell 103, 1001–1004.
41 Saeki Y, Isono E & Toh-e A (2005) Preparation of
ubiquitinated substrates by the PY motif-insertion
method for monitoring 26S proteasome activity. Meth-
ods Enzymol 399, 215–227.
42 Biederer T, Volkwein C & Sommer T (1996) Degrada-
tion of subunits of the Sec61p complex, an integral
component of the ER membrane, by the ubiquitin–pro-
teasome pathway. EMBO J 15, 2069–2076.
43 George R, Walsh P, Beddoe T & Lithgow T (2002) The
nascent polypeptide-associated complex (NAC) pro-
motes interaction of ribosomes with the mitochondrial
surface in vivo. FEBS Lett 516, 213–216.
44 Grallath S, Schwarz JP, Bo
¨
ttcher UM, Bracher A, Hartl
FU & Siegers K (2006) L25 functions as a conserved
ribosomal docking site shared by nascent chain-associ-
ated complex and signal-recognition particle. EMBO
Rep 7, 78–84.
45 Panasenko CC, David FP & Collart MA (2009) Ribo-
some association and stability of the nascent polypep-
tide-associated complex is dependent upon its own
ubiquitination. Genetics 181, 447–460.
46 Petracek ME & Longtine MS (2002) PCR-based engi-
neering of yeast genome. Methods Enzymol 350, 445–469.
47 Howson R, Huh WK, Ghaemmaghami S, Falvo JV,
Bower K, Belle A, Dephoure N, Wykoff DD, Weiss-
man JS & O’Shea EK (2005) Construction, verifica-
tion and experimental use of two epitope-tagged

collections of budding yeast strains. Comp Funct
Genomics 6, 2–16.
48 Wach A, Brachat A, Pohlmann R & Philippsen P
(1994) New heterologous modules for classical or PCR-
based gene disruptions in Saccharomyces cerevisiae.
Yeast 10, 1793–1808.
Supporting information
The following supplementary material is available:
Fig. S1. Stability of Egd2 under stress conditions.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
H. Hiraishi et al. Ubiquitination of Egd2 by Rsp5 under stress conditions
FEBS Journal 276 (2009) 5287–5297 ª 2009 The Authors Journal compilation ª 2009 FEBS 5297