Tài liệu Báo cáo khoa học: N-terminal extension of the yeast IA3 aspartic proteinase inhibitor relaxes the strict intrinsic selectivity ppt

N-terminal extension of the yeast IA
3
aspartic proteinase
inhibitor relaxes the strict intrinsic selectivity
Tim J. Winterburn
1
, Lowri H. Phylip
1
, Daniel Bur
2
, David M. Wyatt
1
, Colin Berry
1
and John Kay
1
1 School of Biosciences, Cardiff University, UK
2 Actelion Pharmaceuticals Ltd, Allschwil, Switzerland
Gene-encoded inhibitors of aspartic proteinases are
rather rare in nature. Thus, there is a need to under-
stand the mechanisms of action of the few that are
known, in order to exploit their therapeutic potential
[1]. We have described previously one such inhibitor:
the IA
3
protein from Saccharomyces cerevisiae [1–4].
This remarkable polypeptide not only is a highly
potent inhibitor of its target enzyme, saccharopepsin,
but also appears to be completely specific for this sole
target proteinase [1,2]. Crystal structures solved for
complexes of IA

3
with saccharopepsin revealed an
unprecedented mechanism of action [2,3]. IA
3
from
S. cerevisiae consists of 68 residues but all of the inhib-
itory activity towards saccharopepsin resides within the
N-terminal half or segment of the polypeptide [2,3].
The free inhibitor is essentially unstructured [5,6] but,
upon contacting its target enzyme, residues 2–32
become ordered and adopt an alpha helical conforma-
tion occupying the active site cleft of the proteinase
[2,3]. This absolute selectivity for saccharopepsin was
shown to be conferred by a combination of the K18
and D22 residues in the S. cerevisiae IA
3
sequence
Keywords
aspartic proteinase inhibition; IA
3
; inhibitor
engineering; Pichia aspartic proteinase;
specificity relaxation
Correspondence
J. Kay, School of Biosciences, Cardiff
University, Museum Avenue, Cardiff CF10
3US, UK
Fax: +44 029 20 87 41 16
Tel: +44 029 20 87 41 24
E-mail:

(Received 30 March 2007, revised 23 May
2007, accepted 25 May 2007)
doi:10.1111/j.1742-4658.2007.05901.x
Yeast IA
3
aspartic proteinase inhibitor operates through an unprecedented
mechanism and exhibits a remarkable specificity for one target enzyme, sac-
charopepsin. Even aspartic proteinases that are very closely similar to
saccharopepsin (e.g. the vacuolar enzyme from Pichia pastoris) are not sus-
ceptible to significant inhibition. The Pichia proteinase was selected as the
target for initial attempts to engineer IA
3
to re-design the specificity. The
IA
3
polypeptides from Saccharomyces cerevisiae and Saccharomyces castellii
differ considerably in sequence. Alterations made by deletion or exchange
of the residues in the C-terminal segment of these polypeptides had only
minor effects. By contrast, extension of each of these wild-type and chimaer-
ic polypeptides at its N-terminus by an MK(H)
7
MQ sequence generated
inhibitors that displayed subnanomolar potency towards the Pichia enzyme.
This gain-in-function was completely reversed upon removal of the exten-
sion sequence by exopeptidase trimming. Capture of the potentially posi-
tively charged aromatic histidine residues of the extension by remote,
negatively charged side-chains, which were identified in the Pichia enzyme
by modelling, may increase the local IA
3
concentration and create an

anchor that enables the N-terminal segment residues to be harboured in clo-
ser proximity to the enzyme active site, thus promoting their interaction. In
saccharopepsin, some of the counterpart residues are different and, consis-
tent with this, the N-terminal extension of each IA
3
polypeptide was with-
out major effect on the potency of interaction with saccharopepsin. In this
way, it is possible to convert IA
3
polypeptides that display little affinity
for the Pichia enzyme into potent inhibitors of this proteinase and thus
broaden the target selectivity of this remarkable small protein.
Abbreviations
Nph,
L-nitrophenylalanine; PpPr, vacuolar aspartic proteinase from Pichia pastoris;Z,L-norleucine.
FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3685
coupled with the requirement for an alanine residue to
be present at position 213 in saccharopepsin [1].
A wide range of other aspartic proteinases of plant,
parasite, vertebrate and fungal origin has been shown
previously to be resistant to inhibition by IA
3
[2].
Included among these enzymes are a number with
sequences that are very closely related to that of sac-
charopepsin (e.g. the vacuolar aspartic proteinase from
P. pastoris; PpPr) [1]. This shares a sequence identity
of 77% with saccharopepsin and essentially all of the
active site residues of saccharopepsin that contact the
helical IA

3
inhibitor are identical in PpPr. PpPr also
has the crucial Ala residue present at position 213 in
its sequence. Despite this close relatedness, the two
enzymes differ drastically in their susceptibility to inhi-
bition by IA
3
. Accordingly, it was of considerable
interest to examine whether IA
3
could be adapted to
loosen its stringent specificity and, in this way, begin
the process of engineering it to target aspartic protein-
ase(s) other than saccharopepsin. Since PpPr is not
inhibited effectively by IA
3
yet is so closely related to
saccharopepsin, it was an obvious choice as the initial
new target enzyme. In the present study, we show that,
inter alia, inhibitors with subnanomolar potency
against PpPr, can be generated by simply attaching a
histidine-rich extension at the N-terminus of the IA
3
polypeptide. This dramatic alteration in behaviour
may be explained by the positively ionisable histidine
residues initiating additional contacts outside the active
site that promote occupation of the active site of the
target proteinase by the inhibitory segment.
For ease of interpretation, residues in the inhibitors
are denoted by single letter abbreviations while those

from the proteinase are indicated in the three-letter code.
Results and Discussion
Wild-type IA
3
and PpPr
We have reported previously that, at the standard pH
of 4.7 that we have justified and used consistently in
all of our earlier studies [1–4], wild-type IA
3
from
S. cerevisiae has an inhibitory potency against saccha-
ropepsin that is so tight that the K
i
value lies at or
beyond the limits of accurate determination using the
assay methodology available. It has thus been esti-
mated as < 0.1 nm [1–4] and, in comparative terms,
S. cerevisiae IA
3
is ineffective against PpPr (1; Fig. 1).
1
2
3
4
5
6
7
8
9
10

Identity Residue number
M
M
M
M
(H)
ZQ
(H)
ZQ
N K D E
34242218 681 81
K (nM)
55 ± 11
15 ± 3
100 ± 20
NI
3 ± 0.5
4 ± 0.5
15 ± 5
280 ± 30
2 ± 0.2
10 ± 1
SMK H
E
N K D
H
N K D
SMK
SZK
SZK

KDS
SZK
SZK
2
Fig. 1. Inhibition at pH 4.7 of PpPr by wild-type and chimaeric forms of IA
3
from S. cerevisiae and S. castellii. Sequences of IA
3
from S. cere-
visiae and S. castellii (detailed in Fig. 2) are depicted schematically by dark-shaded and open boxes respectively, with residues at positions
1, 2, 18, 22 and 68/81 identified individually. Inhibitors 1-3 and 5 were recombinant proteins containing an additional LE(H)
6
sequence
attached to the C-terminal residue (E68 for 1 & 5; H81 for 2 & 3). Inhibitors 4 and 6-10 were synthetic peptides of the indicated length. In
these forms of IA
3
, L-norleucine (Z) was substituted for methionine. NI = no inhibition at 2 lM.
N-terminal extension of IA
3
T. J. Winterburn et al.
3686 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS
We have also reported previously that our constant
searching of the sequence databases for orthologues of
S. cerevisiae IA
3
enabled us to identify the counter-
part polypeptide from Saccharomyces castellii [1]. To
determine whether the S. castellii polypeptide might
be a more effective inhibitor of PpPr upon which
to base initial protein engineering studies, it was

produced in recombinant form in Escherichia coli
and purified to homogeneity as described in the
Experimental procedures. The S. castellii IA
3
was,
however, only marginally more effective as an inhibitor
of PpPr than its S. cerevisiae counterpart (cf. 2 and 1;
Fig. 1).
The effect of C-terminal segment residues on the
inhibitory activity of the N-terminal segment
The sequences of IA
3
from S. castellii and S. cerevisiae
are aligned in Fig. 2. These show only 45% identity in
the N-terminal ‘segment’ (residues 2–32) that has been
demonstrated previously to contain the inhibitory
activity towards saccharopepsin [1–4]. Residues 33–35
are identical in both sequences and form a link
between the inhibitory N-terminal ‘segment’ and resi-
dues of the C-terminal ‘segment’. The C-terminal seg-
ment (residues 36–81; Fig. 2) from S. castellii IA
3
is
considerably longer than its counterpart (residues
36–68) in the S. cerevisiae polypeptide and differs sub-
stantially in sequence (Fig. 2). To establish whether the
respective C-terminal segments might have an influence
(beneficial or detrimental) on any inhibitory activity
that might be intrinsic to the N-terminal segments,
chimaeric proteins were engineered in which residues

35–81 and 35–68 in the respective polypeptides were
replaced by their counterparts from the other
sequence. The chimaera that consisted of residues 1–34
from S. cerevisiae IA
3
fused to residues 35–81 from the
S. castellii sequence remained as poor an inhibitor of
PpPr as the wild-type S. cerevisiae IA
3
(cf. 3 and 1;
Fig. 1). A shorter variant of the S. cerevisiae poly-
peptide which terminated at residue 34 and so was
completely devoid of any residues whatsoever to
correspond to positions 35–68 ⁄ 81, did not inhibit PpPr
either (4; Fig. 1). Thus, the N-terminal segment of
S. cerevisiae IA
3
does not have any significant effect
on PpPr, irrespective of the absence, presence or
nature of the residues contributing the C-terminal
segment.
Against saccharopepsin, S. cerevisiae-based inhibi-
tors 3 and 4 both had K
i
values of < 0.1 nm at
pH 4.7, just as reported previously for the full-length,
wild-type S. cerevisiae polypeptide (inhibitor 1) [2–4].
Entirely in keeping with these earlier findings, the nat-
ure and indeed presence or absence of residues beyond
position 34 in this sequence would appear to have no

influence on inhibition of saccharopepsin.
The reciprocal chimaera, which consisted of residues
1–34 from S. castellii IA
3
fused to residues 35–68 from
the S. cerevisiae polypeptide, was slightly more effect-
ive as an inhibitor of PpPr than the wild-type
S. castellii IA
3
(cf. 5 and 2; Fig. 1), with the measured
K
i
falling into the single digit nanomolar range. Since
these two polypeptides differ only in the nature of
their C-terminal segments, it would appear that the
C-terminal segment (residues 35–81) from S. castellii
IA
3
has a slight detrimental effect on the inhibitory
activity against PpPr that is intrinsic to its own N-ter-
minal segment. This interpretation was examined by
producing a shorter variant of the S. castellii sequence
that lacked any C-terminal segment and so consisted
only of residues 2–34. This had a comparable inhibi-
tory potency to that of the chimaera (cf. 6 and 5;
Fig. 1). The detrimental effect of S. castellii residues
35–81 may result from adverse interaction(s) occurring
either within the full-length S. castellii polypeptide
(residues 1–81) itself or between the C-terminal seg-
ment of the polypeptide and PpPr at a remote site far

removed from the active site cleft where the N-terminal
segment might be expected to bind. Furthermore,
because the chimaeric inhibitor 5 had a comparable
potency to that of inhibitor 6 which was devoid of any
C-terminal segment, the C-terminal segment (residues
35–68) from S. cerevisiae IA
3
would appear, once
again, to be inert, this time being without influence on
the inhibitory activity against PpPr that is intrinsic to
the N-terminal segment of the S. castellii polypeptide.
Against saccharopepsin, the S. castellii N-terminal
segment (inhibitor 6) is a potent inhibitor (K
i
¼
0.4 ± 0.1 nm at pH 4.7) and the interactions of this
type of inhibitor variant within the active site cleft of
the enzyme have been documented previously [4]. The
counterpart N-terminal segment (residues 2–34) from
Species Sequence
S. cerevisiae
S. castellii
Fig. 2. Alignment of the sequences of IA
3
from S. cerevisiae and S. castellii. Identical residues are boxed in black.
T. J. Winterburn et al. N-terminal extension of IA
3
FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3687
S. cerevisiae IA
3

(inhibitor 4) is even more effective
than inhibitor 6 against saccharopepsin (K
i
< 0.1 nm)
[1–4]. This behaviour stands in stark contrast to that
observed against PpPr where inhibitor 6 was > 500-
fold more effective than inhibitor 4 (Fig. 1). Conse-
quently, the effect of exchanging residues within the
inhibitory sequence of 6 was examined. Replacement
of the S. castellii residues 24–34 by the corresponding
residues from S. cerevisiae IA
3
had only a small (three-
to four-fold) adverse effect on inhibitory potency
against PpPr (cf. 7 and 6; Fig. 1). However, when the
key residues K18 and D22 that have been shown to be
so important in restricting the activity of S. cerevisiae
IA
3
to saccharopepsin as its sole target proteinase were
introduced into the S. castellii sequence in place of the
intrinsic M18 ⁄ K22 pair, the inhibitory activity against
PpPr was essentially destroyed (cf. 8 and 6; Fig. 1).
Thus, it would appear that the residues at positions 18
and 22 again play a decisive role, allowing effective
inhibition of PpPr by the S. castellii polypeptide.
Changes in other locations, including the ‘remote’
attachment of residues 35–81 from its own C-terminal
segment, cause only minor perturbation of the inhibi-
tory potency intrinsic to the N-terminal segment.

The effect of extending the N-terminal segment
Since the above-described adaptations in the C-ter-
minal segment were without major influence, the
effect of extending the inhibitory segment (residues
2–34) at its N-terminal end was investigated next.
Careful consideration was given to the design of the
N-terminal extension sequence that was to be intro-
duced. Insufficient amounts of PpPr were produced
for crystallization attempts to be a realistic possibility;
thus, the design process was informed by a 3D model
for PpPr that was generated based on the crystal
structures that have been reported previously for
saccharopepsin complexed with different variants of
S. cerevisiae IA
3
[2,3]. The two proteinases share 77%
sequence identity, and they are likely to have closely
similar 3D structures. Inspection of the PpPr model
identified a patch of negatively ionisable amino acids
on the surface of the enzyme, adjacent to the end of
the active site cleft where the N-terminal residues of
an inhibitory IA
3
helix would be expected to bind
(Fig. 3A). Extension of the inhibitory sequence of IA
3
at its N-terminus by four amino acids (residues X8–
X11, Fig. 3B) was estimated to generate a polypeptide
that would make few beneficial contacts, whereas a
seven amino acid extension (consisting of residues

X5–X11, Fig. 3B) would be long enough to make
some of the predicted contacts with the side-chains of
residues such as Asp161, Asp164 and Glu17 on the
surface of PpPr; and an extension of nine amino
acids (residues X3–X11) would exploit the potential
binding site offered by this patch to the full (Fig. 3B).
Consequently, IA
3
variants with four (HHZQ) and
seven (HHHHHZQ) residue extension sequences,
respectively, were designed initially to introduce the
appropriate number of potentially positively charged
(at the experimental pH of 4.7) histidine residues (at
positions X8–X9 or positions X5–X9, respectively)
followed by a norleucine residue (indicated by Z, at
position X10) and a glutamine (residue X11) in place
of the naturally occurring N-terminal (methionine)
A
B
Fig. 3. Representation of PpPr and the extension residues of IA
3
.
(A) Negatively ionisable surface residues (red) adjacent to the edge
of the active site of PpPr; the active site is occupied by a putative
helical IA
3
inhibitor with the residue at its N-terminus serving as a
potential attachment point for an extension; (B) potential interac-
tions of the indicated negatively ionisable surface residues (red)
of PpPr with several positively ionisable amino acids of the

MK(H)
7
MQ extension sequence (residues X1–X11, respectively).
The C-alpha representation of the helical inhibitory segment occu-
pying the active site of the proteinase is depicted in yellow.
N-terminal extension of IA
3
T. J. Winterburn et al.
3688 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS
residue of IA
3
which has been shown previously to
be unimportant for inhibitory activity [1,2]. The logic
for introduction of the Q residue is explained below;
inspection of the PpPr model revealed an additional
pocket that might accommodate the side-chain of
straight-chained residues such as norleucine (in syn-
thetic peptides) or methionine (in recombinant pro-
teins) at position X10 (Fig. 3B).
These two extension sequences were introduced at
the N-terminus of inhibitor 7. This inhibitor was selec-
ted initially because it consists only of residues 2–34
and was thus free of any potential ‘complications’ that
might have been contributed to binding by the pres-
ence of residues 35–68 ⁄ 81. Since it was also only a
weak inhibitor of PpPr, any improvement in inhibitory
potency should be readily quantifiable. The polypep-
tide containing the short, four-residue (HHZQ) exten-
sion had a comparable potency to that of its parent
(i.e. non-extended inhibitor 7) (cf. 9 and 7; Fig. 1).

However, the longer (H)
5
ZQ-extended variant showed
a seven-fold improvement in potency against PpPr
(cf. 10 and 7; Fig. 1).
Since this seven-residue extension was already suffi-
cient to engender an improvement of inhibitory
potency against PpPr, the extension sequence was
lengthened further to include all seven histidine resi-
dues indicated by the model. The additional two histi-
dine residues (at positions X3 and X4; Fig. 3B) were
introduced downstream from a methionine and a
lysine residue (at positions X1 and X2, respectively),
the logic for which will be substantiated below. These
four MKHH residues were thus introduced upstream
from the (H)
5
-containing extension described above to
generate the sequence MK(H)
7
MQ (Fig. 3B). Coinci-
dentally, this extension contains sufficient histidine res-
idues to enable it to be used as an affinity tag for
purification purposes. In all of our previous studies
with IA
3
[1–4], recombinant protein versions such as
inhibitors 1–3 and 5 (Fig. 1) were purified to homogen-
eity from E. coli lysates by nickel-chelate chromatogra-
phy, facilitated by a LE(H)

6
tag that was positioned
at the C-terminus of each polypeptide. This tag was
shown to have no effect on the potency of inhibition
of saccharopepsin [2,3]. This C-terminal His-tag could
thus be deleted and introduced instead within the
extension sequence at the N-terminus of each desired
polypeptide.
The 11 amino acid-containing sequence MK(H)
7
MQ
was thus introduced as the N-terminal extension
attached to residue 2 of S. castellii IA
3
, as described in
the Methods section. The resultant, recombinant pro-
tein (and the others to be described) were purified
from E. coli cell lysates just as readily as their C-ter-
minally tagged predecessors using exactly the protocol
described previously for the latter [1–4]. The N-termin-
ally extended S. castellii protein showed a potency
against PpPr that was improved by 150-fold compared
to its counterpart with the tag at the C-terminus of the
polypeptide (cf. 11; Fig. 4; 2, Fig. 1). With such a dra-
matic benefit from extension of the inhibitory segment
at its N-terminus, it was clearly of importance to
establish whether this enhanced potency was influenced
to any extent by the presence ⁄ absence and nature of
the amino acid residues contributing the C-terminal
segment to this polypeptide. Consequently, the residues

(35–81; Fig. 2) comprising the C-terminal segment
were systematically deleted, in blocks of 12 ⁄ 13 residues
at a time. Truncation of the N-terminally tagged
S. castellii polypeptide (inhibitor 11) at residue Q68
generated inhibitor 12 which corresponded in overall
length to S. cerevisiae IA
3
. Although this resulted in a
seven-fold weakening in potency against PpPr (cf. 12
with 11; Fig. 4), a subnanomolar K
i
value was still
recorded for inhibitor 12. Further truncation at resi-
dues Y57 and K45, respectively (inhibitors 13 and 14;
Fig. 4) did not cause any further significant loss of
inhibitory potency against PpPr. Thus, in contrast to
the detrimental effect that was described above
when residues 35–81 were attached in the full-length,
C-terminally tagged inhibitor 2, the presence of
residues 69–81 at the C-terminus of the N-terminally
tagged S. castellii polypeptide appears to confer a
benefit to the inhibition of PpPr (cf. inhibitors 11 and
12; Fig. 4). This was substantiated by the data
obtained for the chimaeric inhibitor 15 (Fig. 4) which
was identical in length to inhibitor 12 but contained
residues 35–68 from S. cerevisiae IA
3
as the C-terminal
segment in place of the counterpart S. castellii residues
of inhibitor 12. Both inhibitors had comparable K

i
values against PpPr (15 and 12; Fig. 4). Consequently,
the nature of residues 35–68 at the C-terminus of these
N-terminally tagged polypeptides would appear to be
unimportant for inhibition. Quantitatively, the magni-
tude of the beneficial effect conferred by residues
69–81 from the S. castellii sequence is small compared
to that achieved by location of the full-length extension
at the N-terminal end of the polypeptide. The benefit of
these alterations at each extremity of the polypeptide
chain, must of necessity arise from contacts that are
made outwith the active site of the enzyme.
The effect of removal of the N-terminal extension
The full N-terminal extension sequence, MK(H)
7
MQ,
was designed to consist of an even number of residues
upstream from the Q residue. This enables their
T. J. Winterburn et al. N-terminal extension of IA
3
FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3689
removal by the action of a diamino exopeptidase, cath-
epsin C, which cleaves off dipeptides sequentially from
the N-terminus of a polypeptide [7]. The first methion-
ine (X1) in the extension sequence is necessary for
translation initiation and the lysine is located at
position X2 so that in the event of removal of the
N-terminal methionine residue by an E. coli amino-
peptidase, the new N-terminal lysine residue would
prevent any digestion by cathepsin C [7]; such a

desM(X1)-extended IA
3
would still contain its His-tag
and so could be removed by nickel-chelate chromato-
graphy. Unlike an N-terminal lysine residue, glutamine
(at position X11; Fig. 3) does not in itself constitute a
stop point for cleavage by cathepsin C. However, if
dipeptide removal by cathepsin C is performed in the
presence of an excess of glutamine cyclotransferase,
once an N-terminal glutamine residue is newly exposed,
it is rapidly converted into pyroglutamic acid. Further
digestion by cathepsin C is thus prevented, leaving the
cyclised Q as the N-terminal residue (replacing the nat-
urally occurring Met1) of each IA
3
polypeptide. Appli-
cation of this trimming treatment to the longest and
shortest variants with the wild-type S. castellii sequence
(inhibitors 11 and 14) and to the chimaeric inhib-
itor 15, generated polypeptides 11T, 14T and 15T,
respectively, each with a pyrrolidone carboxylic acid
residue (cyclised Q) at its N-terminal end (Fig. 4). Each
trimmed polypeptide was purified as described in the
Experimental Procedures section by passage through a
nickel-chelate column to remove any residual parent
IA
3
with its intact histidine tag together with the two
enzymes used in the trimming procedure which are also
both C-terminally His-tagged. The purity, identity and

concentration of each trimmed polypeptide was deter-
mined by MALDI-TOF mass spectrometry and amino
acid analysis. As a representative example, the spectra
for one of these inhibitor pairs (14 ⁄ 14T) are depicted in
Fig. 5. The mass peak observed in the spectrum for the
parent inhibitor 14 (Fig. 5A) corresponds to the theor-
etical value for the N-terminally extended S. castellii
IA
3
variant terminating at K45 as its C-terminus. After
treatment with the cathepsin C ⁄ glutamine cyclotrans-
ferase enzyme combination, this peak was completely
absent in the 14T sample. Instead, a peak with a smal-
ler mass (4983 Da; Fig. 5B) was observed which corres-
ponds to that expected (4983 Da) for the trimmed IA
3
polypeptide devoid of the histidine-rich extension but
with an N-terminal pyroglutamate residue. The compo-
sition of 14T determined by amino acid analysis was
(residues ⁄ mol) Asp 4.9 (5); Thr 1.0 (1); Ser 4.7 (5); Glu
6.7 (8); Gly 1.8 (2); Ala 5.6 (6); Val 1.3 (1); Met 2.3 (5);
Leu 1.0 (1); Phe 1.2 (1); Lys 8.5 (8), with the theoretical
11
11T
12
13
14
14T
15
15T

16
16T
Identity Residue number
*Q
MK(H)
MQ
34
68
1 81
K
i
(nM)
0.1 ± 0.1
30 ± 4
0.7 ± 0.1
K
Saccharopepsin
PpPr
MK(H)
MQ
MK(H)
MQ
0.3 ± 0.2
4 ± 0.3
Q
0.8 ± 0.1
45
57
S
Y

MK(H)
MQ
MK(H)
MQ
MK(H)
MQ
S
SK
S
H
S
H
*Q
S
1.1 ± 0.1 2 ± 0.3
0.9 ± 0.1 0.9 ± 0.4
30 ± 10 10 ± 2
0.4 ± 0.1 0.7 ± 0.2
15 ± 1 1.5 ± 0.2
0.6 ± 0.2
<0.1
100 ± 10
<0.1
E
S
E
S
E
N
2

*Q
*Q
NE
NE
Fig. 4. Inhibition at pH 4.7 of PpPr and S. cerevisiae (saccharopepsin) by variant forms of IA
3
from S. castellii and S. cerevisiae. Sequences
of IA
3
from S. castellii and S. cerevisiae are depicted by open and dark-shaded boxes respectively, with residue 2 and the C-terminal residue
of each length variant identified individually. The MK(H)
7
MQ extension was positioned upstream from residue 2 at the N-terminus of inhibi-
tors 11-16. Inhibitors 11T, 14T, 15T & 16T were generated by removal of this extension by cathepsin C trimming to leave a cyclised Q resi-
due (= *Q) at the N-terminus of each polypeptide.
N-terminal extension of IA
3
T. J. Winterburn et al.
3690 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS
values given in parentheses. Histidine was absent, indi-
cating the purity of the trimmed polypeptide that
resulted from the chromatographic procedures (see
Experimental procedures) and substantiating the
complete absence of His-tagged parent polypeptide or
any partially-processed intermediate. Directly compar-
able results were obtained for all of the other inhibitor
pairs described in Fig. 4 (data not shown for brevity).
For the chimaeric 15 ⁄ 15T pair and the shortest
14 ⁄ 14T pair, removal of the N-terminal extension in
this way resulted in an approximately 35-fold loss in

potency against PpPr (Fig. 4). In the case of the full-
length S. castellii protein, however, an even larger loss
in potency (approximately 300-fold) against PpPr
resulted from trimming off the N-terminal extension
(cf. 11T and 11; Fig. 4). Indeed, the trimmed polypep-
tide showed a potency against PpPr that was compar-
able to that measured for the original S. castellii
protein tagged at its C-terminus (cf. 11T; Fig. 4; 2,
Fig. 1). Inhibitors 11T and 2 differ only in having (1)
a cyclised Q in place of the Met1 residue at the N-ter-
minus and (2) the C-terminal LE(H)
6
tag. It would
thus appear that appending the His-tag at the C-termi-
nus of the authentic S. castellii polypeptide is without
significant effect. By contrast, introduction of the histi-
dine-rich extension at the N-terminal end of the
S. castellii polypeptide transforms it into an inhibitor
with subnanomolar potency against PpPr.
Since IA
3
from S. cerevisiae had been shown above to
be an even poorer inhibitor of PpPr, the effect of extend-
ing this polypeptide at its N-terminus was also exam-
ined. Introduction of the MK(H)
7
MQ extension at the
N-terminal end of wild-type S. cerevisiae IA
3
resulted in

an improvement of approximately 100-fold in inhibitory
potency against PpPr relative to the C-terminally tagged
polypeptide (cf. 16; Fig. 4; 1, Fig. 1). This modification
thus transformed the ineffective polypeptide 1 into a
highly potent inhibitor with a subnanomolar K
i
value
against PpPr (16; Fig. 4). Once again, however, this gain
in potency was completely lost upon removal of the
N-terminal extension by treatment with cathepsin C.
The resultant, trimmed S. cerevisiae IA
3
reverted to
being as mediocre an inhibitor of PpPr as the original
construct with its C-terminal tag (cf. 16T; Fig. 4; 1,
Fig. 1).
Binding effects
An explanation for these effects may be advanced
based on remote interactions that occur outwith the
active site cleft of the target proteinase. Free IA
3
is
predominantly unstructured [5,6]. Neither S. cerevisiae
nor S. castellii IA
3
show any significant intrinsic affin-
ity for PpPr (inhibitors 1 and 16T and 2 and 11T) and
so the E + I « EI equilibrium lies well to the left.
When the extension with its multiple, positively ionisa-
ble histidine residues (at pH 4.7) is attached at the

N-terminus of these polypeptides, the potential capture
by the residues of the largely negatively charged
surface adjacent to the edge of the active site cleft
(Fig. 3A) may increase the local inhibitor concentra-
tion and help to locate the residues of each N-terminal
IA
3
segment in closer juxtaposition to the active site of
the enzyme. This anchoring function of the extension
residues may allow inhibitory sequences, which, by
A
B
Fig. 5. MALDI-TOF mass spectrometry analysis of S. castellii IA
3
terminating at K45 before (A) and after (B) removal of the N-ter-
minal extension by cathepsin C ⁄ glutamine cyclotransferase. (A) The
peak at 6327 Da corresponds to that expected theoretically
(6334 Da); the 3168 Da peak is most likely the doubly charged ion.
(B) The observed mass peak coincides with that predicted
(4983 Da) for the trimmed polypeptide. The 2496 Da peak is prob-
ably the doubly charged ion and no peak is present at 6327 Da cor-
responding to the parent, untrimmed peptide.
T. J. Winterburn et al. N-terminal extension of IA
3
FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3691
themselves are suboptimal, to reside long enough in
the vicinity of the enzyme matrix to consolidate the
helical arrangement that ensures a successful, tight
interaction with the enzyme. Whereas two histidine
residues (X8 and X9; Fig. 3B) were insufficient for this

purpose, five residues (X5–X9) resulted in an increase
in potency of almost an order of magnitude against
PpPr, with the X5 and X6 histidine residues potentially
establishing contacts with Asp164 and Glu17, respect-
ively, of the enzyme (Fig. 3B). Addition of a further
two histidine residues (X3 and X4) and a lysine at X2
consolidated this effect even more, resulting in a
further, more substantial gain in potency.
Since neither Glu17 nor Asp164 is conserved in the
sequence of saccharopepsin, the validity of this inter-
pretation was examined by determination of inhibition
constants for the interaction of the N-terminally exten-
ded inhibitors with saccharopepsin. The potencies of
inhibitors 9 (containing two histidines) and 10 (five his-
tidines) against this enzyme were closely similar and
comparable to that of the parent inhibitor 7 ( K
i
¼
0.4 ± 0.1, 0.3 ± 0.1 and 0.8 ± 0.1 nm, respectively).
Further lengthening to include all seven histidine resi-
dues of the MK(H)
7
MQ sequence resulted in extended
inhibitors that were only two- to ten-fold more potent
against saccharopepsin than their respective, trimmed
counterparts (cf. 15T and 15, 14T and 14 and 11T and
11; Fig. 4). Indeed, the trimmed S. castellii polypeptide
(inhibitor 11T; Fig. 4) had a potency against saccharo-
pepsin that was identical to that reported previously
[1] for the C-terminally histidine-tagged counterpart

(inhibitor 2) of this sequence (K
i
¼ 4 ± 0.1 nm).
Saccharomyces castellii IA
3
is thus a weaker inhibitor
of saccharopepsin than S. cerevisiae IA
3
(K < 0.1 nm)
[1–4]. From this evidence, it would appear that Glu17
and Asp164 may be responsible, at least in part, for
facilitating the substantially increased binding of N-ter-
minally extended inhibitors to PpPr because these two
are among the few amino acids in this region with a
number of negative-ionisable residues, that are not
conserved in saccharopepsin. Site-directed mutagenesis
to introduce each of these residues, separately and
together, in place of their wild-type counterparts in
saccharopepsin would enable further substantiation of
this interpretation. Consistent with this conclusion,
however, the N-terminally extended and trimmed vari-
ants of S. cerevisiae IA
3
were both potent inhibitors of
saccharopepsin, to the extent that each K
i
value was
too tight for accurate quantitation (inhibitors 16 ⁄ 16T;
Fig. 4). For this pair of proteins, the interactions made
by residues 2–34 of S. cerevisiae IA

3
upon encounter-
ing the active site of saccharopepsin, are already opti-
mized and so are sufficient by themselves to facilitate
tight, specific binding of this helical N-terminal seg-
ment of IA
3
. The E + I « EI balance thus lies far to
the right and the addition of further residues at the
N-terminus or beyond residue 34 of the inhibitory
segment is superfluous. However, in the case of PpPr,
the serendipitous positioning of negatively ionisable
residues in a patch adjacent to but remote from the
active site provides a capture site for positively ionisa-
ble residues in the N-terminal extension. By this
device, it is thus possible to transform IA
3
polypep-
tides with little intrinsic affinity for PpPr into inhibi-
tors with subnanomolar potency against this enzyme
as a target proteinase. For aspartic proteinases that do
not possess this fortuitous surface feature and which
are more distantly-related to saccharopepsin, including
those of clinical ⁄ agricultural relevance, it would appear
likely that changes will need to be made within the
inhibitory sequence of the N-terminal segment itself in
order to re-target the inhibitory activity of IA
3
.
Experimental procedures

Saccharopepsin and the vacuolar aspartic proteinase from
P. pastoris (PpPr) were produced in recombinant form and
purified from each culture medium, as described previously
[1]. The N-terminal sequence determined for the purified
PpPr was Ala-Ser-His-Asp-Ala-Pro-Leu-Thr-Asn-Tyr-Leu-
Asn, which corresponds to that of the mature form of the
proteinase predicted by the DNA sequence.
Wild-type IA
3
polypeptides from S. cerevisiae and S. cas-
tellii were produced in E. coli with an additional LE(H)
6
sequence attached at the C-terminus and purified to homo-
geneity by nickel-chelate chromatography, as described pre-
viously [1–4]. Chimaeric and N-terminally extended IA
3
variants were produced by engineering cassette versions of
the DNA encoding S. cerevisiae IA
3
in the pET-22b expres-
sion plasmid (Novagen, Milton Keynes, UK). An unwanted
SacI site near the 3¢-end of the IA
3
coding sequence was
removed and an NheI site was introduced as a silent muta-
tion in the codons for Ala34–Ser35 (GCT AGT fi GCT
AGC) by separate site-directed mutageneses using the
Quikchange Kit (Stratagene, Amsterdam, the Netherlands),
as described previously [1]. Digestion of the resultant plas-
mid (J35-pET22b) with NdeI–NheI enabled removal of the

bases encoding S. cerevisiae residues 1–34 whereas digestion
with NheI–XhoI permitted excision of the nucleotides enco-
ding residues 35–68. The respective excised fragments were
replaced with DNA encoding the corresponding residues
1–34 (inhibitor 5) or 35–81 (inhibitor 3) from S. castellii
IA
3
. Each relevant segment was amplified by PCR using
S. castellii IA
3
DNA as template and oligonucleotide pairs
containing the appropriate restriction enzyme sequence
(Table 1). The authenticity of each construct was confirmed
by sequencing. In this way, pET22b plasmids were gener-
N-terminal extension of IA
3
T. J. Winterburn et al.
3692 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS
ated encoding chimaeric polypeptides which consisted,
respectively, of residues 1–34 from S. castellii followed by
residues 35–68 from S. cerevisiae IA
3
(inhibitor 5, Fig. 1)
or residues 1–34 from S. cerevisiae followed by residues
35–81 from S. castellii (inhibitor 3, Fig. 1).
To generate IA
3
polypeptides each extended at its N-ter-
minus and devoid of the LE(H)
6

tag at the C-terminus, a
further cassette vector was engineered by making use of the
XbaI site that is located in the cloning region of pET-22b
upstream from both the NdeI and ribosome binding sites.
pET-22b carrying S. cerevisiae IA
3
DNA as the insert was
digested with XbaI–NdeI and gel purified to remove the
excised 43 bp fragment. It was replaced by a pair of syn-
thetic oligonucleotides (newpet TOP ⁄ BOT; Table 1) which
reconstituted the sequence between the XbaI and NdeI sites
and introduced the additional bases required to encode
most [MK(H)
6
HM] of the desired N terminal extension in
the correct frame, restoring the NdeI site (CAT ATG)
which coincidentally encodes the HM residues (at positions
X9–X10) of the extension sequence. Clone screening was faci-
litated by the introduction of a new HindIII site (AAG
CTT) between the ribosome-binding and NdeI sites and the
new expression vector engineered in this way was called
newpet-22b. To introduce the final Q residue (at position
X11) of the desired extension and to remove the C-terminal
LE(H)
6
tag from the required constructs, oligonucleotide
primers were designed to anneal to the 5¢- and 3¢-ends of
the target DNA encoding S. cerevisiae, S. castellii or
chimaeric IA
3

of each desired length. Each forward primer
consisted of an NdeI consensus sequence followed by a Gln
codon before continuing inframe at the codon for residue 2
of the relevant IA
3
sequence. Each reverse primer encoded
stop codons in all three frames after the final desired IA
3
codon to ensure the appropriate target polypeptide length.
PCRs were performed with the high-fidelity PfuUltra
TM
polymerase (Stratagene). Following gel purification, each
amplicon was treated with NdeI and XhoI, prior to ligation
into the newpet-22b vector that had been similarly digested.
Sequencing confirmed the authenticity of each construct. In
this way, pET-22b plasmids encoding inhibitors 11–16 , each
with an N-terminal MK(H)
6
HMQ extension (Fig. 4) were
generated. The oligonucleotides used for each PCR
employed in this series are listed in Table 1.
Treatment to remove the N-terminal extension from each
extended IA
3
polypeptide was carried out using the TAG-
Zyme
TM
system, first described by Pedersen et al. [7], accord-
ing to the manufacturer’s instructions (Qiagen, Crawley,
UK). Briefly, this involved pretreatment of the DAPase

TM
(cathepsin C; 100 mU) with an equal volume of 20 mm cyste-
amine-HCl for 5 min at room temperature, prior to mixing
with 6 U (120 lL) of Q cyclase
TM
and samples of 1–1.5 mg
of each purified, N-terminally tagged recombinant IA
3
. This
mixture was incubated at pH 7.0 in the presence of 5 m m
EDTA to chelate any free Ni
2+
ions. After 2 h at 37 °C,
DAPase
TM
and Q cyclase
TM
, which are both C-terminally
His-tagged, were removed, together with any residual IA
3
protein with intact tag by absorption onto a nickel-nitrilotri-
acaetic acid agarose column, equilibrated in 20 mm sodium
phosphate buffer, pH 7.0 ⁄ 150 mm NaCl. Flow through
fractions (usually 8 · 0.9 mL) were pooled, concentrated by
centrifugation in a Vivaspin-2 spin concentrator fitted with
a 3000 Da molecular mass cut-off membrane (Vivascience,
Sartorius, Epsom, UK) and the released dipeptide fragments
were removed by gel filtration on a Sephadex G-25 column,
equilibrated in 25 mm sodium phosphate buffer, pH 6.5
containing 50 mm NaCl. Fractions containing trimmed IA

3
Table 1. Construction of mutant forms of IA
3
from S. cerevisiae and S. castellii. The indicated pairs of forward (F) and reverse (R) oligonucle-
otide primers were used to introduce the desired changes in S. castellii or S. cerevisiae IA
3
, thus generating each of the identified variants.
Identity Oligonucleotide sequences (5¢ to 3¢)
3 (F) CTAGCTAGCCCTGAAAGTAAGGAAAAAATGAAGAC
(R) CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG
5 (F) GGAATTCCATATGAGTGATAAAAACGCTAACGTC
(R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC
11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT
(R) CCGCTCGAGCGGCTATCTATCTAATGATCCATCAATTCATCTTTATC
12 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT
(R) CCGCTCGAGCGGCTATCTATCTATTGTTCTTGCTTCCCAGCACC
13 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT
(R) CCGCTCGAGCGGCTATCTATCTAATACGAATCTTGAGCTTTCTTTTC
14 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT
(R) CCGCTCGAGCGGCTATCTATCTATTTTGTCTTCATTTTTTCCTTACTTTC
15 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT
(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC
16 (F) GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG
(R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC
newpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAGCTTATGAAACACCACCACCACCACCACCA
newpetBOT TATGGTGGTGGTGGTGGTGGTGTTTCATAAGCTTATCTCCTTCTTAAAGTTAAACAAAATTATTT
T. J. Winterburn et al. N-terminal extension of IA
3
FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS 3693
were identified by SDS ⁄ PAGE, pooled and concentrated, if

necessary, in a Vivaspin concentrator as above. In this way,
inhibitors 11T, 14T, 15T and 16T were generated from their
respective parents 11, 14, 15 and 16.
Synthetic peptide forms of IA
3
(inhibitors 4, 6–10) were
obtained from Alta Biosciences (Birmingham, UK) and
contained l-norleucine residues in place of methionine,
where appropriate, as described previously [1–4]. Inhibition
assays were performed at pH 4.7 as described previously
[1–3]. The chromogenic peptide substrate used was Lys-
Pro-Ile-Glu-Phe*Nph-Arg-Leu (where the scissile peptide
bond is indicated by the asterisk and Nph represents
l-nitrophenylalanine) and was purchased from Alta Bio-
sciences. N-terminal sequencing was performed by automa-
ted Edman degradation (Alta Biosciences). Samples for
amino acid analysis were hydrolysed in vacuo for 24 h at
110 °Cin6m HCl. No attempt was made to correct the
values obtained for methionine to include the products of
oxidation, methionine sulfoxide and methionine sulfone.
MALDI-TOF mass spectrometry was performed at the
University of Dundee ‘Fingerprints’ Proteomics Facility,
UK. MALDI mass spectra were generated using a Voyager
DE-STR MALDI-TOF MS system (Applied Biosystems,
Foster City, CA, USA) with delayed extraction in positive
ion reflectron mode. Samples (diluted to a final concentra-
tion of 2 pmolÆ l L
)1
) were applied to a MALDI sample
plate and supplemented with 1.0 lLofa5mgÆmL

)1
solu-
tion of a-cyano-4-hydroxy-trans-cinnamic acid matrix (Sig-
ma, Poole, UK) plus 10 mm ammonium di-hydrogen
phosphate in 50% (v ⁄ v) acetonitrile in 0.1% (v ⁄ v) trifluoro-
acetic acid, mixed and allowed to air dry prior to analysis.
The mass spectrometer was internally calibrated using a
matrix ion at 568.13 Da and mass measurement accuracy
was typically ± 0.01%. The resultant data were analysed
using the massXpert computer program [8]. Modelling
calculations were carried out on an SGI Octane work-
station (Silicon Graphics, Geneva, Switzerland) with
dual R12000 processors, using the moloc program (Gerber
Molecular Design, Amden, Switzerland), as reported pre-
viously [1,4].
Acknowledgements
Supported by awards (to J.K.) from the UK Biotech-
nology and Biological Sciences Research Council
(grant numbers 72 ⁄ C13544 and 72 ⁄ 0014846). We are
very grateful to our colleagues Jakob Winther and
Anette Bruun (formerly of the Carlsberg Laboratory,
Copenhagen, Denmark) for help with production of
recombinant PpPr; to John Fox, Alta Biosciences, Bir-
mingham, for provision and analysis of synthetic pep-
tide variants of IA
3
; and to Doug Lamont and Kenny
Beattie, University of Dundee, for carrying out mul-
tiple mass spectrometry analyses of the IA
3

variants.
The endless patience, tolerance and skill of Marian
Williams in the production and revision of the manu-
script is hugely appreciated.
References
1 Winterburn TJ, Wyatt DM, Phylip LH, Bur D, Harrison
RJ, Berry C & Kay J (2007) Key features determining
the specificity of aspartic proteinase inhibition by the
helix-forming IA3 polypeptide. J Biol Chem 282, 6508–
6516.
2 Phylip LH, Lees WE, Brownsey BG, Bur D, Dunn BM,
Winther JR, Gustchina A, Li M, Copeland T, Wlodawer
A & Kay J (2001) The potency and specificity of the
interaction between the IA
3
inhibitor and its target aspar-
tic proteinase from Saccharomyces cerevisiae. J Biol
Chem 276, 2023–2030.
3 Li M, Phylip LH, Lees WE, Winther JR, Dunn BM,
Wlodawer A, Kay J & Gustchina A (2000) The aspar-
tic proteinase from Saccharomyces cerevisiae folds its
own inhibitor into a helix. Nat Struct Biol 7, 113–117.
4 Winterburn TJ, Wyatt DM, Phylip LH, Berry C,
Bur D & Kay J (2006) Adaptation of the behaviour of
an aspartic proteinase inhibitor by relocation of a
lysine residue by one helical turn. Biol Chem 387,
1139–1142.
5 Ganesh OK, Green TB, Edison AS & Hagen SJ (2006)
Characterizing the residue level folding of the intrinsically
unstructured IA

3
. Biochemistry 45, 13585–13596.
6 Green T, Ganesh O, Perry K, Smith L, Phylip LH,
Logan TM, Hagen SJ, Dunn BM & Edison AS (2004)
IA
3
, an aspartic proteinase inhibitor from Saccharomyces
cerevisiae, is intrinsically unstructured in solution. Bio-
chemistry 43, 4071–4081.
7 Pedersen J, Lauritzen C, Madsen MT & Dahl SW (1999)
Removal of N-terminal polyhistidine tags from recombi-
nant proteins using engineered aminopeptidases. Protein
Expr Purif 15, 389–400.
8 Rusconi F & Belghazi M (2002) Desktop prediction ⁄
analysis of mass spectrometric data in proteomic projects
by using massXpert. Bioinformatics 18, 644–645.
N-terminal extension of IA
3
T. J. Winterburn et al.
3694 FEBS Journal 274 (2007) 3685–3694 ª 2007 The Authors Journal compilation ª 2007 FEBS