Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx

Transient silencing of Plasmodium falciparum
bifunctional glucose-6-phosphate dehydrogenase)
6-phosphogluconolactonase
Almudena Crooke
1,
*, Amalia Diez
1
, Philip J. Mason
2,†
and Jose
´
M. Bautista
1
1 Department of Biochemistry and Molecular Biology IV, Universidad Complutense de Madrid, Facultad de Veterinaria, Madrid, Spain
2 Haematology Department, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London, UK
Malaria is a major health hazard in tropical and sub-
tropical areas around the world. In Africa alone, every
year over a million children under the age of 5 years
die of malaria and around 300–500 million people are
infected by the parasite [1,2]. Added to this, the
appearance of parasites resistant to antimalarial drugs
is on the increase and it is not proving easy to develop
an efficient vaccine against Plasmodium falciparum.
There is thus a need for new therapeutic targets.
The sequencing of the P. falciparum genome [3–5]
has revealed a large amount of molecular information.
This information, coupled to microarray mRNA ana-
lysis [6,7] and specific expression proteomic analysis of
the parasite’s developmental stages [8], is allowing the
molecular exploration of new strategies to fight against
malaria.

Based on their equivalent functions in other organ-
isms, the search for genes thought to be essential for
Keywords
antisense RNA; dsRNA; gene silencing;
glucose-6-phosphate dehydrogenase;
malaria; Plasmodium falciparum
Correspondence
J.M. Bautista, Departamento de Bioquı
´
mica
y Biologı
´
a Molecular IV, Universidad
Complutense de Madrid, Facultad de
Veterinaria, Ciudad Universitaria, 28040
Madrid, Spain
Fax: +34 91 3943824
Tel: +34 91 3943823
E-mail:
*Present address
Department of Biochemistry and Molecular
Biology IV, Universidad Complutense de
Madrid, Escuela de O
´
ptica, Madrid, Spain
†Present address
Division of Hematology, Department of
Internal Medicine, Washington University
School of Medicine, St Louis, USA
(Received 5 August 2005, revised 2 February

2006, accepted 10 February 2006)
doi:10.1111/j.1742-4658.2006.05174.x
The bifunctional enzyme glucose-6-phosphate dehydrogenase-6-phospho-
gluconolactonase (G6PD-6PGL) found in Plasmodium falciparum has
unique structural and functional characteristics restricted to this genus.
This study was designed to examine the effects of RNA-mediated PfG6PD-
6PGL gene silencing in cultures of P. falciparum on the expression of para-
site antioxidant defense genes at the transcription level. The highest degree
of G6PD-6PGL silencing achieved was 86% at the mRNA level, with a
recovery to almost normal levels within 24 h, indicating only transient
diminished expression of the PfG6PD-6PGL gene. PfG6PD-6PGL silencing
caused arrest of the trophozoite stage and enhanced gametocyte formation.
In addition, an immediate transcriptional response was shown by thiore-
doxin reductase suggesting that P. falciparum G6PD-6PGL plays a physio-
logical role in the specific response of the parasite to intracellullar oxidative
stress. P. falciparum transfection with an empty DNA vector also promoted
intracellular stress, as determined by mRNA up-regulation of antioxidant
genes. Collectively, our findings point to an important role for this enzyme
in the parasite’s infection cycle. The different characteristics of G6PD-
6PGL with respect to its homologue in the host make it an ideal target for
therapeutic strategies.
Abbreviations
C
T
, cycle threshold; FeSOD, iron superoxide dismutase; G6PD-6PGL, glucose-6-phosphate dehydrogenase-6-phosphogluconolactonase; GPx,
glutathione peroxidase; GR, glutathione reductase; PPP, pentose phosphate pathway; TrxR, thioredoxin reductase.
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1537
the functions of the malaria parasite and for structural
differences with respect to their human homologues, is
a research strategy aimed at finding potential specific

antimalaria targets [9–12].
P. falciparum G6PD-6PGL is a bifunctional enzyme
exclusive to Plasmodium species [13] that probably
arose from the fusion of two genes in a common
ancestor [14]. The deduced protein has a subunit
molecular mass of 107 kDa, in agreement with the
tetramer molecular weight calculated by size exclusion
chromatography [15]. Its C-terminal half (residues
311–911) is clearly homologous to other described
G6PDs (with glucose 6-phosphate dehydrogenase
activity), though sequence similarity is interrupted by a
62 amino acid stretch with no similarity found to date.
It has been nevertheless experimentally shown that this
62 amino acid insertion is essential for the activity of
the bifunctional enzyme [16]. In contrast, the 310
amino acid protein sequence of the N-terminal region
clearly differs from most eukaryotic and prokaryotic
G6PDs, and shows 6-phosphogluconolactonase activ-
ity; thus G6PD-6PGL catalyses the first two steps of
the pentose phosphate pathway [13]. The occurrence of
large insertion sequences that differ with respect to
their homologous proteins in other species has been
often observed in many gene products of P. falciparum
and other Plasmodium species, but their structural
functions and origins are unknown [16,17].
In both the host and parasite, the pentose phosphate
pathway (PPP) is essential for neutralizing reactive
oxygen species during red blood cell infection with the
malaria parasite. Accordingly, PPP activity is greatly
increased in infected red blood cells compared to non-

infected ones, and the parasite PPP is responsible for
82% of this activity [13,18].
Plasmodium falciparum G6PD-6PGL could therefore
be a potential therapeutic target not only because of
its structural characteristics that make it different from
its human equivalent, but also because of the import-
ance of this enzyme in the parasite’s intraerythrocyte
stage [16]. The present paper describes the effects of
G6PD-6PGL silencing in P. falciparum, confirming the
key role of this enzyme in the intraerythrocyte stage of
infection.
Results
Effects of PfG6PD-6PGL gene silencing on growth
and parasite development
In a first attempt at silencing the G6PD-6PGL gene,
erythrocytes infected with ring-stage P. falciparum 3D7
(pyrimethamine-sensitive clone) were electroporated
with pHC1G6 PD-AS (expressing antisense RNA) and
the empty vector pHC1 as control. In addition, silen-
cing by dsRNA was also attempted by transfecting
ring-stage parasites with a dsRNA–G6PD duplex using
water and dsRNA–Rab5a as controls. Figure 1 shows
the parasite’s morphology in the different transfected
cultures.
After 24 h, all electroporated P. falciparum cultures
(wild-type, pHC1, pHC1G6 PD-AS, dsRNA-G6PD
and dsRNA–Rab5a) showed a 77–83% reduction in
parasitaemia, in agreement with previously reported
data [19]. As shown in Fig. 1A, control cultures elec-
troporated with water were apparently normal, with

Fig. 1. Effects of PfG6PD-6PGL gene silencing on parasite develop-
ment. Parasites from different cultures were stained with Giemsa
and examined by light microscopy at the indicated time points.
Wild-type 3D7 (WT) parasites transfected with water not subjected
(A) or subjected (B) to 72 h of pyrimethamine pressure; parasites
transfected with pHC1 (empty vector control) (C) and pHC1G6 PD-
AS vectors (D) subjected to 96 h of pyrimethamine pressure; WT
parasites transfected with water (E), dsRNA–Rab5a (dsRNA control)
(F) and dsRNA-G6PD (G) 24 h post-transfection. Black and red
arrows point to pyknotic parasites and gametocytes, respectively.
Transient silencing of G6PD-6PGL A. Crooke et al.
1538 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS
no pyknotic parasite forms or gametocytes appearing
throughout the entire protocol. This indicates the
recovery of the parasites after electroporation, with no
loss in their capacity for multiplication, as the three
stages of the intraerythrocyte cycle were detected.
In control cultures transfected with water but treated
with 100 ngÆmL
)1
of pyrimethamine, pyknotic forms
appeared (Fig. 1B) as a consequence of the complete
absence of live parasites after three days of pyrimeth-
amine pressure, demonstrating that sensitivity to pyri-
methamine in this strain is an adequate selection
method of identifying parasites transfected with pHC1.
Unlike the case in electroporated control cultures
not exposed to pyrimethamine, in which mainly ring-
stage forms and few mature or stress forms such as
gametocytes were observed, parasites from both the

pHC1 and pHC1G6 PD-AS electroporated cultures
subjected to pyrimethamine pressure mainly appeared
to be at the trophozoite or gametocyte stage (Fig. 1C–
D; Table 1). Although this effect is most probably
attributable to pyrimethamine acting on the nontrans-
fected parasite population [20,21], we cannot preclude
the possibility of some abnormal stage forms due to
the presence of the vector itself.
As shown in Table 2, parasitaemia levels of the
pHC1 and pHC1G6 PD-AS parasites exposed to pyri-
methamine determined at 48 h, indicated that 23–25%
of the parasites had acquired resistance to pyrimeth-
amine mediated by the transfected vectors. This resist-
ance decreased to 5–6% at 96 h without further
reduction.
In the P. falciparum cultures electroporated with
dsRNA or water (control culture), in the absence of
pyrimethamine pressure, similar parasitaemia levels
were observed in the course of one complete intra-
erythrocyte cycle (Table 3). Alterations to the cycle
were not observed in any of the dsRNA electroporated
cultures whose growth was synchronized for the entire
24 h (Table 3). In addition, as shown in Fig. 1E–F, no
morphological changes were observed in control cul-
tures electroporated with water or with the duplex
dsRNA–Rab5a. In contrast, the cultures electro-
porated with dsRNA-G6PD (Fig. 1G) showed clear
morphological changes in about 50% of the parasites,
mostly abnormal trophozoites, whereas the morphol-
ogy of the remaining 50% trophozoites was apparently

normal.
Quantification of mRNA expression in
pHC1G6 PD-AS and dsRNA-G6PD transfected
parasite cultures
Under pyrimethamine pressure, expression of the
selectable marker and complementary mRNA strand
from the G6PD-6PGL gene were determined by RT-
Table 1. Effect of pHC1G6 PD-AS on the stage-specific development of P. falciparum. The results of the parasitaemia, ring, trophozoite and
gametocyte assays are the means and standard deviations of three independent experiments.
Culture
Incubation time with
pyrimethamine (h) Parasitaemia (%)
a
Rings (%) Trophozoites (%) Gametocytes (%)
Wild-type 48 13.03 ± 0.82 99.05 ± 0.55 0.95 ± 0.55 nd
96 4.54 ± 0.33 90.00 ± 14.14 10 ± 14.14 nd
pHC1 48 1.99 ± 0.53 nd 100 nd
96 0.52 ± 0.16 nd 99.0 ± 1.00 0.7 ± 0.10
pHC1G6 PD-AS 48 2.16 ± 0.19 nd 100 nd
96 0.47 ± 0.06 nd 96.7 ± 1.00 3.1 ± 0.16
a
To determine parasitaemia, about 10 000 erythrocytes were examined and the number of infected erythrocytes was reported as a percent-
age of the total. Stage-specific development was assessed by counting the fractions of rings, trophozoites and schizonts (asexual stages).
No schizonts were detected at the indicated time points. The fraction of gametocytes (sexual stage) was calculated as the percentage
detected in 10 000 erythrocytes. nd, not detected.
Table 2. Multiplication rates and efficiency of plasmid segregation
in pHC1 and pHC1G6 PD-AS transfected parasites. The results of
the parasitaemia assays represent the means and standard deviat-
ions of three independent experiments.
Culture

Incubation time for
pyrimethamine (h)
Parasitaemia
(%)
a
Segregation
(%)
b
pHC1 0 8.05 ± 0.62 100 ± 7.66
48 1.99 ± 0.53 25 ± 6.00
96 0.52 ± 0.16 6 ± 2.22
pHC1G6 PD-AS 0 9.73 ± 0.54 100 ± 5.59
48 2.16 ± 0.19 23 ± 8.12
96 0.47 ± 0.06 5 ± 1.33
a
To determine parasitaemia, about 10 000 erythrocytes were
examined and the number of infected erythrocytes was reported as
percentage of the total.
b
The level of parasitaemia after (48 and
96 h) and before (0 h) pyrimethamine pressure was used as a
quantitative measure of plasmid segregation (expressed as a per-
centage).
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1539
PCR (Fig. 2). Also, the effect of the presence of intra-
cellular pHC1G6 PD-AS was analyzed by quantitative
mRNA expression analysis of G6PD-6PGL and of
several key genes involved in defense against oxidative
stress after 48 or 96 h of pyrimethamine pressure:

glutathione reductase (GR), iron superoxide dismutase
(FeSOD), thioredoxin reductase (TrxR) and glutathi-
one peroxidase (GPx). Biochemical characterization of
recombinant PfGPx indicates that this enzyme has a
strong preference for Trx over GSH, and could be
considered a thioredoxin dependent peroxidase [22]. At
48 h, a 60% reduction in G6PD-6PGL gene expression
was detected (Fig. 3). This reduction also caused a
generalized down-regulation of the expression of the
other antioxidant genes analyzed. The expression of
TrxR and GR, both NADPH dependent enzymes, was
reduced by four- and fivefold, respectively (Fig. 3).
FeSOD and GPx, which remove the superoxide anion
and hydrogen peroxide, respectively, showed five- and
threefold down-regulation. After 96 h of incubation in
the presence of pyrimethamine, levels of G6PD-6PGL
expression were still reduced by 40%, while expression
levels of the other antioxidant response genes were
restored, returning to levels close to those recorded in
cultures transfected with the control pHC1 vector.
However, it should be noted that, at 96 h, parasites
transfected with pHC1 showed the up-regulation of
most of the antioxidant genes except G6PD-6PGL
compared with wild-type transfected parasites
(Fig. 4B). Thus, GR levels increased sixfold and TrxR,
FeSOD and GPx doubled their wild-type levels. This
effect was also apparent for TrxR at 48 h (Fig. 4A).
Hence, we must carefully interpret this silencing
through antisense RNA produced by pHC1, due to
the effect per se that the presence of pHC1 has on the

parasite antioxidant response.
Table 3. Multiplication rate and stage-specific development of parasites transfected with dsRNA. The results of the parasitaemia, ring and
trophozoite assays are expressed as the means and standard deviations of three independent experiments. nd, not detected.
Culture Time post-transfection (h) Parasitaemia (%)
a
Rings (%) Trophozoites (%)
b
Wild-type 3 2.82 ± 1.36 96.03 ± 5.61 3.97 ± 5.61
24 3.82 ± 0.69 6.63 ± 9.38 93.37 ± 9.38
dsRNA–Rab5a 3 1.64 ± 1.55 98.35 ± 2.33 1.65 ± 2.33
24 2.50 ± 2.11 nd 100
dsRNA-G6PD 3 2.31 ± 2.06 98.54 ± 2.06 1.46 ± 2.06
24 3.34 ± 0.83 3.32 ± 4.69 96.69 ± 4.69
a
To determine parasitaemia, about 10 000 erythrocytes were examined and the number of infected erythrocytes was reported as
percentage of the total. Stage-specific development was assessed by counting the fractions of rings, trophozoites and schizonts. No
schizonts were detected at the indicated time points.
b
Fifty percent of trophozoites detected in the dsRNA-G6PD cultures were abnormal
(but not pyknotic).
200 bp
100 bp
200 bp
M
AB123
100 bp
M 1234
Fig. 2. High intracellular expression capacity of the pHC1G6 PD-AS vector. Total RNA from WT and pHC1G6 PD-AS parasites were RT-PCR
amplified and the products examined on ethidium bromide-stained agarose gels. (A) Expression of the PfG6PD-6PGL gene noncoding strand:
lane M, 100 basepair ladder molecular weight marker; lane 1, pHC1G6 PD-AS parasites subjected to 48 h of pyrimethamine pressure; lane

2, pHC1G6 PD-AS parasites subjected to 96 h of pyrimethamine pressure; lane 3, pHC1G6 PD-AS vector PCR product (positive control). (B)
TgDHFR-TS gene expression: lane M, 100 basepair ladder molecular weight marker; lane 1, pHC1G6 PD-AS parasites subjected to 48 h of
pyrimethamine pressure; lane 2, pHC1G6 PD-AS parasites subjected to 96 h of pyrimethamine pressure; lane 3, WT parasites (negative con-
trol); lane 4, pHC1G6 PD-AS vector PCR product (positive control). RT-PCR amplification yielded bands of the expected size: 152 basepair
(antisense PfG6PD-6PGL mRNA) and 160 basepair (TgDHFR-TS mRNA).
Transient silencing of G6PD-6PGL A. Crooke et al.
1540 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS
In preliminary experiments performed on cultures
after 24, 48, 72 and 96 h of electroporation with
dsRNA, a transient effect was observed lasting not
longer than 48 h. Aliquots for qRT-PCR analysis were
taken at 3 and 24 h after electroporating with dsRNA-
G6PD. Three hours after electroporation, G6PD-
6PGL silencing at the mRNA level was 86%, while
FeSOD and GPx expression levels were normal
(Fig. 5). Nevertheless, this diminished G6PD-6PGL
expression effect was accompanied by a sevenfold up-
regulation of TrxR and a threefold down-regulation of
GR (Fig. 5). After 24 h, normal G6PD-6PGL expres-
sion levels were restored. In parallel, the expression
levels of the other antioxidant genes, stabilized at sim-
ilar levels to those observed in electroporated cultures
without dsRNA (Fig. 5).
To test this G6PD-6PGL specific knockdown by
dsRNA-G6PD, we then determined G6PD-6PGL
transcript levels in cultures transfected with dsRNA–
Rab5a. Our results indicated no appreciable differences
in G6PD-6PGL expression between dsRNA–Rab5a or
wild-type parasites, thus confirming the specificity of
dsRNA-G6PD (data not shown).

Discussion
To assess the capacity of a gene or its product to act
as an antimalaria target, its role in the biology of the
parasite needs to be well established. For this purpose,
several systems for the functional analysis of P. falci-
parum genes have been developed including gene silen-
cing by antisense RNA [23], or more recently, by
Fig. 3. Effect of pHC1G6 PD-AS on parasite mRNA. Quantifying
G6PD-6PGL, GR, TrxR, FeSOD and GPx mRNA levels by qRT-PCR
in parasites, transfected with pHC1 and pHC1G6 PD-AS vectors,
obtained at the indicated time points during the course of pyrimeth-
amine pressure. Expression level data for each gene obtained from
parasites transfected with the pHC1G6 PD-AS vector were normal-
ized to the 18S rRNA signal (internal control) and the normalized
values of control parasites (transfected with pHC1) were set at 1.
Error bars represent the standard deviations of the means obtained
in three replicate assays.
A
B
Fig. 4. Oxidative stress gene up-regulation by the presence of
pHC1 derived vectors. Gene expression analysis by real-time RT-
PCR of G6PD-6PGL, GR, TrxR, FeSOD and GPx from pHC1 and
WT water electroporated parasites at 48 and 96 h (pyrimethamine
pressure was only applied to pHC1 transfected parasites). The norm-
alized number of genome equivalents was determined using the
18 s rRNA gene as internal control. In this experiment, a control
culture under pyrimethamine pressure was included in parallel, with
no significant mRNA expression signal detected at 48 and 96 h.
Error bars represent the standard deviations of the means obtained
in three replicate assays.

Fig. 5. Effect of the dsRNA-G6PD duplex on parasite mRNA. (A)
Quantifying G6PD-6PGL, GR, TrxR, FeSOD and GPx mRNA levels
by qRT-PCR in parasites transfected with dsRNA-G6PD, 3 h and
24 h after electroporation. Expression level data for each gene
obtained from parasites transfected with dsRNA-G6PD were nor-
malized to the 18S rRNA signal (internal control) and the normalized
values of control parasites (transfected with water) were set at 1.
Error bars represent the standard deviations of the means obtained
in three replicate assays.
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1541
RNA interference [24,25]. Antisense RNA has been
found in humans, mice, plants and protozoan parasites
such as P. falciparum [26]. The fact that endogenous
antisense RNAs are widespread in P. falciparum, sug-
gests that they could be a natural gene expression reg-
ulatory mechanism [26,27]. Recent studies suggest that
in P. falciparum antisense RNA is synthesized by
RNA polymerase II [26].
In our model, P. falciparum G6PD-6PGL was
silenced in vivo through antisense RNA by construct-
ing the vector pHC1G6 PD-AS according to a previ-
ously established strategy [23]. This vector comprises
two expression cassettes, one to drive the expression of
a selectable marker, which in this case was the Toxo-
plasma gondii dihydropholate reductase thymidylate
synthase gene, and the other to allow expression of the
PfG6PD-6PGL gene noncoding strand (antisense
RNA). This noncoding strand transcription strategy to
produce antisense RNA has been recently successfully

used in other protozoan and mammalian cells [28–30].
In P. falciparum, antisense RNA has also been success-
fully applied to silencing the PfCLAG9 gene [23],
inhibiting PfCLAG9 mRNA translation and diminish-
ing cytoadherence of the protein to melanoma cells (a
function associated with this protein). Since our con-
struct expresses high levels of the selection marker and
the antisense RNA strand, the in vivo activity of both
promoters (P. falciparum calmodulin and Plasmodium
chabaudi dihydropholate reductase) and the stability of
their mRNAs was observed under our experimental
conditions.
Parasites transfected with the antisense RNA-G6PD-
6PGL vector showed reduced mRNA-G6PD-6PGL
expression at 48 h and there was a simultaneous reduc-
tion in TrxR, GR, GPx and FeSOD transcripts. After
96 h, G6PD-6PGL silencing persisted at a slightly
higher level, but the expression of the other four anti-
oxidant genes was restored. This could be the combined
outcome of two effects: a loss or diminished number of
copies of the vector in some parasites due to low segre-
gation competence [31,32], and stress to the parasite
caused by the vector itself. This last effect is suggested
by the up-regulation of these genes observed at 96 h in
control transfections with pHC1 (lacking an insert), as
indicated by reduced parasitaemia levels and increased
levels of mRNA for the antioxidant genes in the pHC1
transfected cultures at 96 h. The discordant effects
detected at 96 h in cultures transfected with vectors
containing or lacking an insert indicate that after 48 h,

other interacting factors could modify the molecular
phenotypic effect of using this vector. This is the first
report of the detection at the molecular level of the
toxic effect of a DNA vector in P. falciparum.
Although mechanisms of RNAi silencing in many
species are not well understood, this technique has
been used to study gene function in a great variety of
organisms including Trypanosoma brucei, Drosophila
melanogaster and a limited number of vertebrates [33–
35]. Despite the fact that, so far, the genes encoding
the required RNAi machinery have not been detected
in any of the currently available Plasmodium databases
[36], RNAi silencing has been achieved in P. falcipa-
rum [24,25]. Thus, it could be that the data reported
for Plasmodium, as well as our results using dsRNA-
G6PD, are the consequence of an antisense RNA
rather than a direct RNAi effect. However, it is also
true that, to date, 60% of the genes predicted for
P. falciparum have no known homologs, and we have
no clues as to their function [5].
Transfection of P. falciparum with dsRNA-G6PD
seems to be a gentle procedure in that no growth
changes were observed in the cultures, allowing obser-
vation of the molecular phenotypic effects of transfec-
tion. Besides the water-transfected parasite control,
dsRNA–Rab5a was used as a second control, since
the silencing target Rab5a belongs to a P. falciparum
multigene family [37] with overlapping functions, as
occurs in other organisms [38,39]. Accordingly, no
morphological changes were observed in either type

of control cultures, while the cultures transfected with
dsRNA-G6PD showed morphological alterations in
about 50% of the trophozoites, suggesting that what
we are looking at is a genuine effect of inhibited
G6PD-6PGL expression causing cell stress. Moreover,
this effect is appreciable at the stage of highest meta-
bolic activity, the trophozoite stage. In the early
stages (3 h), dsRNA-G6PD was highly effective at
silencing, decreasing mRNA levels by up to 86%.
Nevertheless, this silencing was transient, since after
24 h, mRNA levels had almost recovered. It should
be noted that the G6PD-6PGL silencing experiment-
ally produced at the ring stage corresponds in clinical
isolates to the time at which the highest amounts of
G6PD-6PGL transcripts are shown [42]. Silencing of
parasite G6PD-6PGL in rings caused cell stress, indu-
cing the up-regulation of TrxR by sevenfold. This
induction of the thioredoxin system against oxidative
stress has been previously described in Streptomyces
coelicolor and Bacillus subtilus subjected to oxidative
stress [43,44]. An important role of thioredoxin is to
reduce ribonucleotide reductase. P. falciparum TrxR is
able to reduce thioredoxin, which together with per-
oxyredoxins, transforms peroxides and also helps to
reduce oxidized glutathione [9]. If the lack of G6PD-
6PGL produces lower reduction equivalents, increas-
ing TrxR to counteract this effect would require
Transient silencing of G6PD-6PGL A. Crooke et al.
1542 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS
NADPH from alternative sources, as has been sugges-

ted by other authors [45,46]. Also it seems that at
this early developmental stage in which high mRNA-
G6PD-6PGL levels are normally expressed [46], the
G6PD-6PGL silencing consequence of a threefold
decrease in GR expression would modify the equilib-
rium of the oxidative stress cascade, by strongly indu-
cing TrxR. Thus, TrxR induction would render
reduced thioredoxin, the ribonucleotide reductase sub-
strate, producing deoxynucleotides for normal parasite
replication [9,10,47], and de novo G6PD-6PGL tran-
scription would reestablish expression levels after
24 h.
Experimental procedures
Vector construction and dsRNA design
The oligonucleotides 5¢xg6pd (5¢-CACTGATAAAATATT
A
CTCGAGAAACCATTTGG-3¢) and 3¢xg6pd (5¢-GAC
TTGTTTTTC
CTCGAGTTCCTTAAGTAAAGG-3¢) con-
taining XhoI sites (underlined) were used to PCR amplify a
960 basepair G6PD-6PGL fragment from P. falciparum
3D7 (corresponding to GenBankÔ nt 1803–2763, accession
number X74988). The resultant PCR fragment was excised
with XhoI and ligated into the XhoI site of plasmid pHC1
[48] to produce pHC1G6 PD-AS. Parental pHC1 consists
of a dual cassette in which the mutated T. gondii dihydro-
pholate reductase thymidilate synthase gene, conferring
resistance to pyrimethamine, is flanked by the P. chabaudi
dihydrofolate reductase promoter and P. falciparum histi-
dine-rich protein 2 terminator sequence. The second cas-

sette expresses the inserted antisense mRNA driven by the
P. falciparum calmodulin promoter and terminated by the
3¢-untraslated region of P. falciparum heat shock protein 86
[48]. The antisense direction of the G6PD-6PGL fragment
inserted with respect to the calmodulin promoter, was con-
firmed by plasmid DNA NdeI digestion. Parental plasmid
pHC1, lacking the G6PD-6PGL fragment was used as a
transfection control. Plasmid DNAs were purified (Plasmid
Maxi Kit, Qiagen, Chatsworth, CA, USA) from overnight
Escherichia coli cultures.
A 21 basepair dsRNA (sense: UACAUCAUGCACCAA
CGAAdTdT; antisense: UUCGUUGGUGCAUGAUGUA
dTdT) was designed for the target sequence (UACAUCA
UGCACCAACGAA) of the G6PD-6PGL gene, follow-
ing Dharmacon siDESIGN Center criteria (http://design.
dharmacon.com/). In addition, a dsRNA corresponding to
the PfRab5a gene (GenBankÔ accession number AE001399)
(target sequence: UAUGCAAGUAUUGUCCCAC; sense:
UAUGCAAGUAUUGUCCCACdTdT; antisense: GUGG
GACAAUACUUGCAUAdTdT) was also designed to use
as control. All dsRNAs were obtained from Dharmacon
Research (Lafayette, CO, USA) in annealed and lyophilized
forms and were suspended in RNase-Dnase-free water
before use.
Parasite cultures and electroporation
P. falciparum 3D7 (pyrimethamine-sensitive strain) was
grown and double synchronized using standard procedures
[49,50]. Parasites (ring stage 8–10% parasitaemia) were
transfected by electroporation with 100–150 lg of purified
plasmid DNA or 40 lg of dsRNA as described [19]. The

parasites transfected with pHC1 or pHC1G6 PD-AS were
subsequently cultured for 48 h in 75 cm
2
flasks, after which
they were subjected to a selection pressure of 100 ngÆmL
)1
pyrimethamine for a further 96 h. The level of parasitaemia
after and before pyrimethamine pressure was used as a
quantitative measure of plasmid segregation (expressed as a
percentage). The growth and development of each transfec-
tion was monitored daily by Giemsa staining blood films.
Parasites transfected with dsRNA-G6PD or dsRNA–
Rab5a were kept for 24 h in 75 cm
2
flasks with no selection
pressure.
Isolation of total RNA. RT-PCR and quantitative
RT-PCR
Total RNA was isolated from infected red blood cell cul-
tures using the ABI Prism
Ò
6100 Nucleic Acid Prepstation
(Applied Biosystems, Foster City, CA, USA). Isolated
RNA was reverse transcribed to cDNA using the High-
CapacityÔcDNA Archive Kit (Applied Biosystems) as des-
cribed by the manufacturer using specific reverse primers.
To confirm expression of the T. gondii DHFR-TS gene
(selectable marker) and antisense G6PD-6PGL mRNA syn-
thesis from plasmid pHC1G6 PD-AS, cDNA was obtained
using reverse primers (3¢Tgdhfr-ts,5¢-TGTAGACATGC

GTGTTCCCC-3¢;3¢Pfg6pd,5¢-GGTTGTGAAGAAAT
GGAAGAAGTAC-3¢) for further PCR amplification by
adding forward primers (5¢Tgdhfr-ts,5¢-GAAGGAGCTG
TCGTGCATCAT-3¢;5¢Pfg6pd,5¢-GATTCATACAATT
CCTCGTCTGAG-3¢). For real-time transcript quantifica-
tion by molecular beacons, cDNA was obtained using spe-
cific reverse primers and qRT-PCR was performed in an
ABI Prism 7000 Sequence Detector (Applied Biosystems).
Sequence design of molecular beacons and primers for
G6PD-6PGL, Fe-SOD, GR, TrXR, GPx and 18S-rRNA
quantitative transcription analysis was performed according
to a previously published procedure [51]; these designs are
provided in Table 4. The qRT-PCR involved 1 cycle each
of 50 °C ⁄ 2 min and 95 °C ⁄ 10 min, followed by 45 cycles of
57 °C ⁄ 1 min, 95 °C ⁄ 30 s, and 45 °C ⁄ 29 s. All analyses were
run in triplicate. An 18S-rRNA signal was used as endo-
genous control to normalize mRNA relative expression
[42,51–54]. Cycle threshold (C
T
) was defined as the frac-
tional PCR cycle number at which the fluorescent signal is
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1543
greater than the minimal detection level. Standard curves
were prepared for all targets and endogenous references,
using genomic DNA concentrations and their correspond-
ing C
T
. For each experimental sample, the amounts of
target and 18S-rRNA were calculated from the standard

curves. Then the target amount was divided by the endo-
genous reference amount to obtain a normalized target
value. To generate the relative expression levels, each
normalized target value of interest was divided by the
calibrator normalized target from the nontreated sample.
Statistical analysis
Results are expressed as mean ± SD. All the experiments
were repeated on at least three different cultures. Statistical
analysis was performed using graphpad software (Prism
4.0) at P < 0.05. The standard deviation of the C
t
s values
among triplicates was always < 0.30 C
T
.
Acknowledgements
We are indebted to Nuria Trinidad for her excellent
technical assistance with the parasite cultures and to
Alan Cowman for his generous gift of the pHC1.
Thanks are also due to two anonymous reviewers for
their useful comments. A.C. was awarded a predoctor-
al fellowship by the Comunidad de Madrid. This
research was funded by grants PM1999-0049-CO2-01
and BIO2003-07179 from the Spanish MCYT.
References
1 Sachs J & Malaney P (2002) The economic and social
burden of malaria. Nature 415, 680–685.
2 Weatherall DJ, Miller LH, Baruch DI, Marsh K,
Doumbo OK, Casals-Pascual C & Roberts DJ (2002)
Malaria and the red cell. Hematology (Am Soc Hematol

Educ Program) 35–57.
3 Bowman S, Lawson D, Basham D, Brown D, Chilling-
worth T, Churcher CM, Craig A, Davies RM, Devlin
K, Feltwell T et al. (1999) The complete nucleotide
sequence of chromosome 3 of Plasmodium falciparum.
Nature 400, 532–538.
4 Gardner MJ, Tettelin H, Carucci DJ, Cummings LM,
Aravind L, Koonin EV, Shallom S, Mason T, Yu K,
Fujii C et al. (1998) Chromosome 2 sequence of the
human malaria parasite Plasmodium falciparum. Science
282, 1126–1132.
5 Gardner MJ, Hall N, Fung E, White O, Berriman M,
Hyman RW, Carlton JM, Pain A, Nelson KE, Bowman
S et al. (2002) Genome sequence of the human malaria
parasite Plasmodium falciparum. Nature 419, 498–511.
6 Bozdech Z, Zhu J, Joachimiak MP, Cohen FE, Pulliam B
& DeRisi JL (2003) Expression profiling of the schizont
Table 4. Primers and molecular beacon probe sequences for real-time RT-PCR. All probes were labelled at the 5¢ end with 6-carboxy-fluorescein (FAM). TAMRA was used as the 3¢
quencher. RT-PCR, reverse transcription PCR.
Gene
GenBank
Ò
accession No. Forward Primer (5¢-to3¢) Reverse Primer (5¢-to3¢) Molecular Beacon (5¢-to3¢)
Pf18srRNA (M19172) TGACTACGTCCCTGCCCTT ACAATTCATCATATCTTTCAATCGG GGGGGACACCGCCCGTCGCTCCCCC
PfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCG
PfTrxR (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGG
PfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCG
PfG6PD-6PGL (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG
PfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCG
Transient silencing of G6PD-6PGL A. Crooke et al.

1544 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS
and trophozoite stages of Plasmodium falciparum with a
long-oligonucleotide microarray. Genome Biol 4, R9.
7 Le Roch KG, Zhou Y, Blair PL, Grainger M, Moch
JK, Haynes JD, De La Vega P, Holder AA, Batalov S,
Carucci DJ et al. (2003) Discovery of gene function by
expression profiling of the malaria parasite life cycle.
Science 301, 1503–1508.
8 Lasonder E, Ishihama Y, Andersen JS, Vermunt AM,
Pain A, Sauerwein RW, Eling WM, Hall N, Waters AP,
Stunnenberg HG et al. (2002) Analysis of the Plasmo-
dium falciparum proteome by high-accuracy mass
spectrometry. Nature 419, 537–542.
9 Kanzok SM, Schirmer RH, Turbachova I, Iozef R &
Becker K (2000) The thioredoxin system of the malaria
parasite Plasmodium falciparum. Glutathione reduction
revisited. J Biol Chem 275, 40180–40186.
10 Becker K, Gromer S, Schirmer RH & Muller S (2000)
Thioredoxin reductase as a pathophysiological factor
and drug target. Eur J Biochem 267, 6118–6125.
11 Krnajski Z, Gilberger TW, Walter RD, Cowman AF &
Muller S (2002) Thioredoxin reductase is essential for
the survival of Plasmodium falciparum erythrocytic
stages. J Biol Chem 277, 25970–25975.
12 Akerman SE & Muller S (2003) 2-Cys peroxiredoxin
PfTrx-Px1 is involved in the antioxidant defence of
Plasmodium falciparum. Mol Biochem Parasitol 130,
75–81.
13 Clarke JL, Scopes DA, Sodeinde O & Mason PJ (2001)
Glucose-6-phosphate dehydrogenase-6-phosphoglucono-

lactonase: A novel bifunctional enzyme in malaria para-
sites. Eur J Biochem 268, 2013–2019.
14 Scopes DA, Bautista JM, Vulliamy TJ & Mason PJ
(1997) Plasmodium falciparum glucose-6-phosphate
dehydrogenase (G6PD) – the N-terminal portion is
homologous to a predicted protein encoded near to
G6PD in Haemophilus influenzae. Mol Microbiol 23,
847–848.
15 Kurdi-Haidar B & Luzzatto L (1990) Expression and
characterization of glucose-6-phosphate dehydrogenase
of Plasmodium falciparum. Mol Biochem Parasitol 41,
83–91.
16 Clarke JL, Sodeinde O & Mason PJ (2003) A unique
insertion in Plasmodium berghei glucose-6-phosphate
dehydrogenase-6-phosphogluconolactonase: evolutionary
and functional studies. Mol Biochem Parasitol 127 , 1–8.
17 Pizzi E & Frontali C (2001) Low-complexity regions in
Plasmodium falciparum proteins. Genome Res 11, 218–
229.
18 Atamna H, Pascarmona G & Ginsburg H (1994) Hex-
ose-monophosphate shunt activity in intact Plasmodium
falciparum-infected erythrocytes and in free parasites.
Mol Biochem Parasitol 67, 79–89.
19 Wu Y, Sifri CD, Lei HH, Su XZ & Wellems TE (1995)
Transfection of Plasmodium falciparum within human
red blood cells. Proc Natl Acad Sci USA 92, 973–977.
20 Waterkeyn JG, Crabb BS & Cowman AF (1999) Trans-
fection of the human malaria parasite Plasmodium falci-
parum. Int J Parasitol 29, 945–955.
21 O’Donnell RA, Freitas-Junior LH, Preiser PR, William-

son DH, Duraisingh M, McElwain TF, Scherf A,
Cowman AF & Crabb BS (2002) A genetic screen for
improved plasmid segregation reveals a role for Rep20
in the interaction of Plasmodium falciparum chromo-
somes. EMBO J 21, 1231–1239.
22 Sztajer H, Gamain B, Aumann KD, Slomianny C,
Becker K, Brigelius-Flohe R & Flohe L (2001) The
putative glutathione peroxidase gene of Plasmodium fal-
ciparum codes for a thioredoxin peroxidase. J Biol Chem
276, 7397–7403.
23 Gardiner DL, Holt DC, Thomas EA, Kemp DJ &
Trenholme KR (2000) Inhibition of Plasmodium falci-
parum clag9 gene function by antisense RNA. Mol
Biochem Parasitol 110, 33–41.
24 McRobert L & McConkey GA (2002) RNA interference
(RNAi) inhibits growth of Plasmodium falciparum. Mol
Biochem Parasitol 119, 273–278.
25 Kumar R, Adams B, Oldenburg A, Musiyenko A &
Barik S (2002) Characterisation and expression of a PP1
serine ⁄ threonine protein phosphatase (PfPP1) from the
malaria parasite, Plasmodium falciparum: demonstration
of its essential role using RNA interference. Malar J 1,5.
26 Militello KT, Patel V, Chessler AD, Fisher JK, Kasper
JM, Gunasekera A & Wirth DF (2005) RNA polymer-
ase II synthesizes antisense RNA in Plasmodium falci-
parum. RNA 11, 365–370.
27 Gunasekera AM, Patankar S, Schug J, Eisen G, Kis-
singer J, Roos D & Wirth DF (2004) Widespread distri-
bution of antisense transcripts in the Plasmodium
falciparum genome. Mol Biochem Parasitol 136, 35–42.

28 Bracha R, Nuchamowitz Y & Mirelman D (2000)
Inhibition of gene expression in Entamoeba by the tran-
scription of antisense RNA: effect of 5¢- and 3¢-regula-
tory elements. Mol Biochem Parasitol 107, 81–90.
29 Chen DQ, Kolli BK, Yadava N, Lu HG, Gilman-Sachs
A, Peterson DA & Chang KP (2000) Episomal expres-
sion of specific sense and antisense mRNAs in Leishma-
nia amazonensis: modulation of gp63 level in
promastigotes and their infection of macrophages
in vitro. Infect Immun 68, 80–86.
30 Zhang X, Chen Z, Chen Y & Tong T (2003) Delivering
antisense telomerase RNA by a hybrid adenovirus ⁄ ade-
no-associated virus significantly suppresses the malig-
nant phenotype and enhances cell apoptosis of human
breast cancer cells. Oncogene 22 , 2405–2416.
31 van Dijk MR, Waters AP & Janse CJ (1995) Stable
transfection of malaria parasite blood stages. Science
268, 1358–1362.
32 O’Donnell R, Preiser PR, Williamson DH, Moore PW,
Cowman AF & Crabb BS (2001) An alteration in con-
catameric structure is associated with efficient segrega-
A. Crooke et al. Transient silencing of G6PD-6PGL
FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS 1545
tion of plasmids in transfected Plasmodium falciparum
parasites. Nucleic Acids Res 29, 716–724.
33 Ngo H, Tschudi C, Gull K & Ullu E (1998) Double-
stranded RNA induces mRNA degradation in Trypano-
soma brucei. Proc Natl Acad Sci USA 95, 14687–14692.
34 Misquitta L & Paterson BM (1999) Targeted disrup-
tion of gene function in Drosophila by RNA interfer-

ence (RNA-i): a role for nautilus in embryonic
somatic muscle formation. Proc Natl Acad Sci USA
96, 1451–1456.
35 Wargelius A, Ellingsen S & Fjose A (1999) Double-
stranded RNA induces specific developmental defects in
zebrafish embryos. Biochem Biophys Res Commun 263,
156–161.
36 Ullu E, Tschudi C & Chakraborty T (2004) RNA inter-
ference in protozoan parasites. Cell Microbiol 6, 509–
519.
37 Quevillon E, Spielmann T, Brahimi K, Chattopadhyay
D, Yeramian E & Langsley G (2003) The Plasmodium
falciparum family of Rab GTPases. Gene 306, 13–25.
38 Lazar T, Gotte M & Gallwitz D (1997) Vesicular trans-
port: how many Ypt ⁄ Rab-GTPases make a eukaryotic
cell? Trends Biochem Sci 22, 468–472.
39 Stenmark H & Olkkonen VM (2001) The Rab GTPase
family. Genome Biol 2, reviews 3007.1–3007.7,
doi: 10.1186/gb-2001-2-5-reviews3007.
40 Mohmmed A, Dasaradhi PV, Bhatnagar RK, Chauhan
VS & Malhotra P (2003) In vivo gene silencing in Plas-
modium berghei – a mouse malaria model. Biochem
Biophys Res Commun 309, 506–511.
41 Mundodi V, Kucknoor AS & Gedamu L (2005) Role of
Leishmania (Leishmania) chagasi amastigote cysteine
protease in intracellular parasite survival: studies by
gene disruption and antisense mRNA inhibition. BMC
Mol Biol 6,3.
42 Sodeinde O, Clarke JL, Vulliamy TJ, Luzzatto L &
Mason PJ (2003) Expression of Plasmodium falciparum

G6PD-6PGL in laboratory parasites and in patient iso-
lates in G6PD-deficient and normal Nigerian children.
Br J Haematol 122, 662–668.
43 Paget MS, Kang JG, Roe JH & Buttner MJ (1998) Sig-
maR, an RNA polymerase sigma factor that modulates
expression of the thioredoxin system in response to oxi-
dative stress in Streptomyces coelicolor A3 (2). EMBO
J 17, 5776–5782.
44 Nakano S, Kuster-Schock E, Grossman AD & Zuber P
(2003) Spx-dependent global transcriptional control is
induced by thiol-specific oxidative stress in Bacillus sub-
tilis. Proc Natl Acad Sci USA 100, 13603–13608.
45 Werner C, Stubbs MT, Krauth-Siegel RL & Klebe G
(2005) The crystal structure of Plasmodium falciparum
glutamate dehydrogenase, a putative target for novel
antimalarial drugs. J Mol Biol 349, 597–607.
46 Bozdech Z & Ginsburg H (2005) Data mining of the
transcriptome of Plasmodium falciparum: the pentose
phosphate pathway and ancillary processes. Malar J 4,
17.
47 Campanale N, Nickel C, Daubenberger CA, Wehlan
DA, Gorman JJ, Klonis N, Becker K & Tilley L (2003)
Identification and characterization of heme-interacting
proteins in the malaria parasite, Plasmodium falciparum.
J Biol Chem 278, 27354–27361.
48 Crabb BS, Triglia T, Waterkeyn JG & Cowman AF
(1997) Stable transgene expression in Plasmodium falci-
parum. Mol Biochem Parasitol 90, 131–144.
49 Trager W & Jensen JB (1976) Human malaria parasites
in continuous culture. Science 193, 673–675.

50 Lambros C & Vanderberg JP (1979) Synchronization of
Plasmodium falciparum erythrocytic stages in culture.
J Parasitol 65, 418–420.
51 Bustamante LY, Crooke A, Martinez J, Diez A & Bau-
tista JM (2004) Dual-function stem molecular beacons
to assess mRNA expression in AT-rich transcripts of
Plasmodium falciparum. Biotechniques 36, 488–494.
52 Hermsen CC, Telgt DS, Linders EH, van de Locht LA,
Eling WM, Mensink EJ & Sauerwein RW (2001) Detec-
tion of Plasmodium falciparum malaria parasites in vivo
by real-time quantitative PCR. Mol Biochem Parasitol
118, 247–251.
53 Witney AA, Doolan DL, Anthony RM, Weiss WR,
Hoffman SL & Carucci DJ (2001) Determining liver
stage parasite burden by real time quantitative PCR as
a method for evaluating pre-erythrocytic malaria vac-
cine efficacy. Mol Biochem Parasitol 118, 233–245.
54 Blair PL, Witney A, Haynes JD, Moch JK, Carucci DJ
& Adams JH (2002) Transcripts of developmentally
regulated Plasmodium falciparum genes quantified by
real-time RT-PCR. Nucleic Acids Res 30, 2224–2231.
Transient silencing of G6PD-6PGL A. Crooke et al.
1546 FEBS Journal 273 (2006) 1537–1546 ª 2006 The Authors Journal compilation ª 2006 FEBS