Tài liệu Báo cáo khóa học: The lysozyme of the starfishAsterias rubens A paradigmatic typei lysozyme docx

The lysozyme of the starfish
Asterias rubens
A paradigmatic type
i
lysozyme
Sana Bachali
1
, Xavier Bailly
2
, Jacqueline Jolle
`
s
3
, Pierre Jolle
`
s
3,
* and Jean S. Deutsch
1
1
E
´
quipe De
´
veloppement et E
´
volution, UMR 7622 ‘Biologie du de
´
veloppement’, CNRS et Universite
´
P & M Curie, Paris, France;

2
Station Biologique, Roscoff, France;
3
Laboratoire des Prote
´
ines, Universite
´
Paris V, France
On the basis of a partial N-terminal sequence, Jolle
`
s
and Jolle
`
s [Jolle
`
s, J., & Jolle
`
s, P. (1975) Eur. J. Biochem. 54,
19–23] previously proposed that the lysozyme from the
starfish Asterias rubens represents a new form of lysozyme,
called type i (invertebrate) lysozyme. Indeed, it differed from
both the types c (chicken) and g (goose) known in other
animals, as well as from plant and phage lysozymes.
Recently, several proteins belonging to the same family have
been isolated from protostomes. Here we report the com-
plete mature protein sequence and cDNA sequence of the
lysozyme from Asterias. These sequences vindicate the
previously proposed homology between the starfish, a
deuterostome, and protostome lysozymes. In addition, we
present a structural analysis that allows us to postulate upon

the function of several conserved residues.
Keywords: cDNA; invertebrates; lysozyme; starfish; struc-
ture.
During recent years, interest in a new type of lysozyme, the
invertebrate-type (i-type), has been growing. In 1996 Jolle
`
s
et al. [1] published the N-terminal sequences of lysozymes
from two coastal bivalves belonging to the genus Mytilus
and of four deep-sea bivalves belonging to the genera
Bathymodiolus and Calyptogena. This lysozyme represented
a model for the digestion of bacteria by the deep-sea
bivalves [2]. A similar lysozyme was then described in other
bivalves, Tapes japonica [3], and Chlamys islandica [4,5].
These authors noticed the striking similarity between the
bivalve lysozyme and another protein, the so-called desta-
bilase identified in the medicinal leech Hirudo medicinalis
[6,7]. It was then determined that the leech destabilase also
has lysozyme activity [8,9].
In a previous work [10], we reported the cDNA
sequence of several bivalve lysozymes. We showed that,
in addition to bivalve lysozymes, homologous sequences
can be found in the genome of the nematode Caenorhab-
ditis elegans and that of the fly Drosophila melanogaster,as
well as expressed sequences tags from penaeid shrimps,
indicating that these species possess putative proteins akin
to the lysozyme i type. We performed a phylogenetic
analysis of all of these sequences together with those of the
more conventional lysozyme c type; the results suggested
that these two lysozymes originate from a common gene

ancestor, at least in the central exon coding for the active
lysozyme domain [10].
In fact, the existence of a new type of lysozyme, lysozyme
i, was proposed as early as 1975, on the basis of the N-
terminal sequence of a lysozyme extracted from the starfish
Asterias rubens [11]. All recently described type-i lysozymes,
including putative proteins derived from nucleic acid
sequences, belong to protostome species. Thus, it seems
worthwhile to revisit the lysozyme i from the deuterostome
invertebrate in which it has been described for the first time.
In the present work, we present the protein sequence and the
complete cDNA sequence of the lysozyme i from A. rubens.
In addition, we present putative models of its secondary and
tertiary structure.
Material and methods
Biological material
The starfish A. rubens was collected near Roscoff (Brittany,
France). For RNA extraction, samples were preserved in
RNAlater
TM
solution (Ambion) to inactivate RNAases.
Protein sequencing
The A. rubens lysozyme was prepared according to Jolle
`
s
and Jolle
`
s [11]. The lysozyme was reduced according to
Jolle
`

s et al. [12], using iodoacetamide for alkylation. Diges-
tion by trypsin or carboxypeptidase (Worthington, Lake-
wood, NJ, USA)
1
or by Staphylococcus aureus V8 proteinase
(Miles) was performed for 18 h at 37 °Cin0.1
M
ammo-
nium bicarbonate with an enzyme/substrate ratio of 1 : 50.
Cyanogen bromide (Merck) cleavage was performed in
Correspondence to J. S. Deutsch, E
´
quipe De
´
veloppement et E
´
volution,
UMR 7622 ‘Biologie du de
´
veloppement’, CNRS et Universite
´
P&M
Curie, 9 quai St-Bernard, case 241, 75252 Paris cedex 05, France.
Fax: +33 14427 3253, Tel.: +33 14427 2576,
E-mail:
Note: The nucleotide sequence of the Asterias lysozyme i cDNA is
available in the GenBank database under accession number
AY390770.
*Present address: MNHN, Paris and Mine
´

ralogie Cristallographie
(LMCP) UMR 7590, Universite
´
P & M Curie, Paris (France),
pl. Jussieu, case 115, 75252 Paris cedex 05, France.
(Received 22 September 2003, revised 4 November 2003,
accepted 11 November 2003)
Eur. J. Biochem. 271, 237–242 (2004) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03915.x
70%formicacidfor48hat20°C. HPLC of the peptides
was performed with a Waters chromatograph (model ALC/
GPC-204) using a Brownlee RP 300 column (22 · 4.6 cm)
and absorbance at 220 and 280 nm was followed. Each
peptide (0.2 nmol) was submitted to automated Edman
degradation in an Applied Biosystems 470A protein
sequencer. The phenylthiohydantoins of amino acids were
identified by an on-line Applied Biosystems 120A PTH
analyser.
Synthesis of cDNA
Total RNA was extracted using the RNeasy Mini Kit
(Qiagen) according to the manufacturer’s instructions. It
was treated with RNAase-free DNAase I (Pharmacia) for
30 min at 37 °C. cDNA was synthesized by reverse
transcription from DNAase-treated RNA using Moloney
murine leukaemia virus reverse transcriptase (Stratagene)
and an oligo-dT primer.
RACE/PCR, cloning and sequencing
A3¢ RACE/PCR was performed using this cDNA as a
template, an oligo-dT primer and a degenerate primer (AS1,
Table 1) designed from the N-terminal sequence of the
A. rubens lysozyme determined by Jolle

`
s and Jolle
`
s[11].
This yielded too short a fragment to represent the complete
3¢ end of the lysozyme cDNA. Yet, its sequence showed a
clear homology with other lysozyme i sequences [10]. We
thought that this was due to inappropriate priming of the
oligo-dT primer. The specific (nondegenerated) primer AS3
(Table 1) was determined from this first sequence fragment.
Then a second PCR step was performed using AS3 and the
oligo-dT.
PCR were performed on cDNA in 20-lL reaction mix
containing 5¢- and oligo-dT primers at 20 and 4 pmol,
respectively, dNTP 10 m
M
and 5 U Qbiotaq DNA poly-
merase (Q-Biogene). PCR cycles were as follows: 3 min at
94 °C followed by 30–40 cycles of 1 min at 94 °C, 1 min at
56–59 °C (depending on the primers), 1 min at 72 °Cand
finally 10 min at 72 °C.
After amplification, the PCR products were analysed by
electrophoresis through 1% agarose gels and purified using
the Jetsorb Kit (Genomed). They were cloned in a
T-overhang vector derived from pBlueScript KS+ (Strata-
gene), prepared according to Holton [13]. Sequencing was
performed on both strands with the thermosequenase
fluorescent-labelled primer cycle sequencing kit and
7-deaza-dGTP (Amersham Pharmacia).
To expand the cDNA on its 5¢ side, the specific antisense

primers AS3R and AS4R (Table 1) were used for reverse
transcription. The cDNA was extended by terminal trans-
ferase A (Biolabs). Two amplification steps were performed
using AS3R/oligo-dT and AS4/oligo-dT at the annealing
temperature of 57 °Cand58°C, respectively. The 5¢ RACE
fragment was purified, cloned and sequenced as described
above.
Computer structural analysis
The signal peptide and cleavage site of the putative Asterias
lysozyme i protein were determined using the following
software:
SIGNAL P
/>and
PSORT II
Hydrophobic Cluster
Analysis (HCA plots) [14] was performed using the
DRAW-
HCA
software available online at />hca/. To get three-dimensional representations of catalytic
centres of lysozyme i and compare it with that of lysozymes
c, the primary sequences of Asterias and of Mytilus
lysozymes i were submitted to the automated Protein Fold
Recognition server 3
D-PSSM
at />3dpssm/ [15,16] and successfully yielded putative three-
dimensional structures. The figures were drawn using
SWISS
-
PDBVIEWER
[17].

Results and discussion
Determination of the primary structure of the protein
The primary structure of the lysozyme from A. rubens was
determined by amino acid sequence analysis of the intact
carboxy-methylated protein and of constituent peptides
obtained through digests by trypsin, S. aureus V8 protein-
ase, carboxypeptidase and cyanogen bromide treatment (see
Material and methods). The results are summarized by the
sequence shown on Fig. 1.
cDNA cloning and sequencing
cDNA was prepared from soft tissues of a single A. rubens
specimen. As a starting point, we used degenerate primers
designed from the N-terminal sequence determined by Jolle
`
s
and Jolle
`
s [11] (Table 1). The complete cDNA sequence was
determined on PCR products after several rounds of 3¢ and
5¢ RACE/PCR (see Material and methods and Table 1).
Thus, the cDNA sequence was determined independently
of the biochemically determined protein sequence described
in the above paragraph.
The cDNA sequence agreed with the protein sequence
without ambiguity (Fig. 2) and allowed confirmation of the
data from the biochemical analysis in two cases when an
overlapping peptide was missing. The predicted ORF from
the cDNA is slightly longer than the biochemically deter-
mined protein sequence. Computer analysis (see Material
and methods) permitted us to postulate a signal peptide of

16 amino acids and its cleavage site. Ten more amino acids
are found in the predicted translated protein upstream of the
serine that is found to be the N-terminal residue of the
extracted protein. This could be due to an artefactual
cleavage at the fragile S–S peptide bound (Fig. 2) during the
purification of the protein. Alternatively, this could be the
physiological form of the protein, taking into account that
the bivalve type i lysozymes have approximately the same
Table 1. Primer sequences.
Primer (5¢fi3¢)
Corresponding
peptide
AS1 GGTTGCCTGAGRTGYATHTG
a
GCLRCIC
AS3 GGGCTATTGGTCAGACGCTACACTC GYWSDATL
AS3R GAGTGTAGCGTCTGACCAATAGCC GYWSDATL
AS4R GATCTGATACGGTCCACACGACAG LSCGPYQI
a
H ¼ A or C or T; R ¼ AorG;Y¼ CorT.
238 S. Bachali et al. (Eur. J. Biochem. 271) Ó FEBS 2003
length at their N-terminal side [3,4,10]. The coding sequence
is followed by a 3¢ noncoding tail of 172 nucleotides and is
preceded by a 5¢ noncoding leader of 101 nucleotides.
Up to now, complete protein sequences of i-type
lysozymes were only available from protostome species.
We aligned the Asterias lysozyme sequence with type i
proteins for which a lysozyme activity has been demonstra-
ted (Fig. 3). This alignment supports the homology of the
starfish lysozyme with protostome proteins as proposed in

our previous work [10]. Comparison between the lysozyme
of the starfish, a deuterostome species, with the previously
known lysozymes i provides the opportunity to reveal
conserved residues over about 600 million years. Of about
120 amino acids, as many as 35 are identical, and 13 are
similar (Fig. 3). The starfish lysozyme is less rich in cysteines
than the protostome lysozymes i (10 vs. 13). Relative to the
other known i lysozymes, it presents a four-residue insertion
(residues 55–58 on Fig. 3). Comparison with the second
exon of the human lysozyme c that comprises the active site
reveals both similarities between the two types of lysozymes
and residues specific to the i-type (Fig. 3).
A
BLAST
search with the lysozyme sequence of A. rubens
in the sequence database of the National Center for
Biotechnology Information (NCBI) shows significant
sequence similarities with the destabilase of the medicinal
leech H. medicinalis [7], with the bivalve lysozyme sequences
determined in our previous work [10], with the lysozyme of
the bivalve Tapes japonica [3], with the so-called chlamysin
of Chlamys islandica [4,5], and also with a hypothetical
secreted protein of the nematode Caenorhabditis elegans and
with putative gene products retrieved from the genomes
of the fly Drosophila melanogaster and of the mosquito
Fig. 1. Chemically determined primary struc-
ture of the A. rubens lysozyme. Phenylalanine
112 is drawn in low case (f) because it was
ambiguous. >, Amino acid determined by
automated Edman degradation; <, amino

acid determined by carboxypeptidase
degradation; +, trypsin cut; +, trypsin
peptide sequenced by the Edman technique;
¼¼ ¼ ¼, S. aureus V8 protease peptide,
sequenced by the Edman technique; ––––,
cyanogen bromide (BrCN) peptide, sequenced
by the Edman technique.
Fig. 2. cDNA sequence of the A. rubens lysozyme. Noncoding nucleotides (nt.) are shown in small case letters and the coding sequence is shown in
upper case letters. Putative polyadenylation signals are boxed
3
. The N-terminal amino acid of the mature protein is boxed. The predicted signal
peptide is in grey.
Ó FEBS 2003 Lysozyme of Asterias rubens (Eur. J. Biochem. 271) 239
Anopheles gambiae. On the other hand, no significant
similarity was found when
BLAST
searches were performed
on the complete or near-complete genome sequences of
deuterostome species, such as the mamalians Homo sapiens
and Mus musculus, the teleost fishes Takifugu rubripes and
Danio rerio and the urochordate Ciona intestinalis.
The presence of type i genes in the three branches of the
metazoan tree [18], the protostome Ecdysozoa (including
arthropods and nematodes) and Lophotrochozoa (inclu-
ding molluscs and annelids) and deuterostomes (starfish)
brings evidence that a lysozyme i gene was present in the
bilaterian ancestor. Given the present genomic data, it must
Fig. 3. Alignment of the A. rubens lysozyme sequence with other lysozymes. The complete mature starfish protein was aligned with all protostome
i-type proteins for which a lysozyme activity has been demonstrated. Aru, A. rubens; Med, Mytilus edulis; Cis, Chlamys islandica; Tja, Tapes
japonica; Hme, H. medicinalis. Numbering is that of the starfish lysozyme. For comparison, the second exon of the human lysozyme-c (Has, Homo

sapiens) is also aligned. Below are noted secondary structure elements: h marks a residue involved in an a-helix, b a residue involved in a beta-turn.
Residues conserved in all c-type lysozymes [21] are underlined. The two active acidic residues of the c-type lysozymes are boxed. Conserved residues
in all i-type lysozymes are in grey. Conserved cysteines are noted by s above the Asterias sequence.
Fig. 4. Hydrophobic cluster analysis. The primary sequence is represented on a roll mimicking a-helices. The primary sequence is drawn twice. A
dashed line follows one of these primary sequences. Prolines (P) and glycines (G) that break a-helices are represented as w and r, respectively. The
hydrophilic residues serines (S) and threonines (T) are represented by h. Residues that are distant on the primary sequence may appear close to each
other on this type of diagram, thus revealing hydrophobic clusters (boxed). (A) HCA plot of the Asterias lysozyme; hydrophobic residues conserved
in all lysozymes i are in grey. (B) Second exon of the human lysozyme c. Conserved hydrophobic residues between lysozymes i and c are in grey.
240 S. Bachali et al. (Eur. J. Biochem. 271) Ó FEBS 2003
have been lost in several deuterostome lineages. Compar-
ative genomics is developing rapidly. Complete genomes of
a greater panel of species will be soon available. This will
allow us to assess whether or not the lysozyme i gene has
been lost from the origin of the whole vertebrate or even the
whole chordate lineages. If this is true it this would fully
justify the name given of ‘invertebrate’ lysozyme.
Hydrophobic cluster analysis
Primary structure comparison between such distantly related
proteins as i-type and c-type lysozymes provides significant
yet insufficient data on functionally important residues. To
understand this issue further, we performed a hydrophobic
cluster analysis [14]. This analysis permits one to relate
residues that are not close to each other along the linear
sequence, but may come close under secondary structure,
forming hydrophobic clusters or pouches (Fig. 4A). The
N-terminal half of i lysozymes is homologous to the second
exon of vertebrate c-type lysozymes (Fig. 3 and [10]). Fig. 4B
shows the HCA plot of this part of the human lysozyme. A
number of hydrophobic residues overlap between this plot
and the corresponding part of the HCA plot of the Asterias

lysozyme. The same overlap is obtained when comparing
the human lysozyme and/or the chicken lysozyme with
the protostome lysozymes i listed in Fig. 3 (data not shown).
In the C-terminal half other hydrophobic residues are
conserved among the i-type lysozymes (Fig. 4A).
The natural substrate of lysozymes is a polymer of
N-acetyl-glucosamine and of N-acetyl-muramic acid. Up to
six sugar rings get into the cleft of the lysozyme c at subsites
called A–F. The D subsite is the active site where the sugar
chain is cleaved. In the chicken and human lysozymes c the
hydrophobic cluster IYW (IWW in chicken) (Fig. 4B) is
involved in interactions with sugar rings [19]. This hydro-
phobic cluster is very well conserved in lysozymes i (Fig. 3
and Fig. 4A,B). We postulate that this function is conserved
in i-type lysozymes. It is likely that the other conserved
hydrophobic clusters are involved in similar interactions.
Three-dimensional modelling
A partial three-dimensional structure of the starfish lyso-
zyme i model was successfully generated by the 3
D
-
PSSM
software program (see Material and methods). In this
model, some links remain uncertain. They correspond to
variable parts of the proteins among the various i-type
lysozymes. They probably represent loosely structured
loops between more structured helices and/or sheets.
Despite these missing parts, this computer-based three-
dimensional model is recognized as a lysozyme with a high
probability score (

PSSM
E-value: 4.67 e-5)
2
.Inparticular,a
Fig. 5. Putative three-dimensional model of the Asterias lysozyme i. These figures were generated with the help of the
SWISS
-
PDBVIEWER
software. (A)
ApartoftheputativestructureoftheAsterias lysozyme, from residues L9 to L50 (according to numbering in Fig. 3). The side chains of E16 and
S34 that we postulate to be the active enzymatic residues (see text) are shown. (B) Homologous part of the human lysozyme from the model
deposited in the SwissProt data bank under the accession number 1IY3 (residues W28–K69, according to the sequence of the human lysozyme). The
side chains of E35 and D53 that are the known active residues in c-type lysozymes are shown.
Ó FEBS 2003 Lysozyme of Asterias rubens (Eur. J. Biochem. 271) 241
part of the three-dimensional structure of the Asterias
lysozyme (Fig. 5A) is very similar to the known structure of
the active site of the human c lysozyme (Fig. 5B). The
putative structure of the Mytilus lysozyme i is almost
identical (data not shown).
The critical glutamate (E) of lysozyme c active site is
conserved in lysozymes i. In contrast, the active aspartate
(D52 according to chicken numbering) is not conserved
(Fig. 3). In a previous paper we postulated that its role
could be played by another D residue [10]. The present
putative three-dimensional structure does not support this
hypothesis. On the other hand, the tertiary structure
supports the homology between the active D of lysozymes
c and a conserved serine (S), as proposed on the basis of
primary structure (Fig. 3). We determined the atomic
distances between the oxygen atom of this S and those of

the active E. They fall (8.1–8.5 A
˚
) within the range of the
distances between active atoms in the lysozyme c active site
(5.9–8.2 A
˚
). We thus propose that the S34 (according to
numbering in Fig. 3) is the active residue for sugar chain
cleavage in lysozymes i. A similar situation is found in
g-type lysozymes, where E73 is an analogue of the active
glutamate of lysozymes c, but no aspartate analogue is
found [20].
Acknowledgements
We are grateful to Prof. A. Toulmond for providing us with the
facilities of the Station Biologique de Roscoff and constant support.
S. Bachali is recipient of a PhD fellowship of the Tunisian government.
We thank three anonymous referees for their comments that helped
improve the manuscript.
References
1. Jolle
`
s, J., Fiala-Medioni, A. & Jolle
`
s, P. (1996) The ruminant
digestion model using bacteria already employed early in evolu-
tion by symbiotic molluscs. J. Mol. Evol. 43, 523–527.
2. Fiala-Medioni, A. & Felbeck, H. (1990) Autotrophic processes in
invertebrate nutrition: bacterial symbiosis in bivalve molluscs.
Comp Physiol. 5, 49–69.
3. Ito, Y., Yoshikawa, A., Hotani, T., Fukuda, S., Sugimura, K. &

Imoto, T. (1999) Amino acid sequences of lysozymes newly puri-
fied from invertebrates imply wide distribution of a novel class in
the lysozyme family. Eur. J. Biochem. 259, 456–461.
4. Nilsen, I.W., Overbo, K., Sandsdalen, E., Sandaker, E., Sletten, K.
& Myrnes, B. (1999) Protein purification and gene isolation of
chlamysin, a cold-active lysozyme-like enzyme with antibacterial
activity. FEBS Lett. 464, 153–158.
5. Nilsen, I.W. & Myrnes, B. (2001) The gene of chlamysin, a marine
invertebrate-type lysozyme, is organized similar to vertebrate but
different from invertebrate chicken-type lysozyme genes. Gene 269,
27–32.
6. Fradkov, A., Berezhnoy, S., Barsova, E., Zavalova, L., Lukyanov,
S., Baskova, I. & Sverdlov, E.D. (1996) Enzyme from the
medicinal leech (Hirudo medicinalis) that specifically splits endo-
epsilon (-gamma-Glu)-Lys isopeptide bonds: cDNA cloning and
protein primary structure. FEBS Lett. 390, 145–148.
7. Zavalova, L., Lukyanov, S., Baskova, I., Snezhkov, E., Akopov,
S., Berezhnoy, S., Bogdanova, E., Barsova, E. & Sverdlov, E.D.
(1996) Genes from the medicinal leech (Hirudo medicinalis)coding
for unusual enzymes that specifically cleave endo-epsilon (gamma-
Glu)-Lys isopeptide bonds and help to dissolve blood clots. Mol.
Gen. Genet. 253, 20–25.
8. Zavalova, L.L., Baskova, I.P., Lukyanov, S.A., Sass, A.V.,
Snezhkov, E.V., Akopov, S.B., Artamonova, I.I., Archipova,
V.S., Nesmeyanov, V.A., Kozlov, D.G., Benevolensky, S.V.,
Kiseleva, V.I., Poverenny, A.M. & Sverdlov, E.D. (2000) Desta-
bilase from the medicinal leech is a representative of a novel family
of lysozymes. Biochim. Biophys. Acta 1478, 69–77.
9. Zavalova, L.L., Artamonova, I.I., Berezhnoy, S.N., Tagaev, A.A.,
Baskova, I.P., Andersen, J., Roepstorff, P. & Egorov Ts, A. (2003)

Multiple forms of medicinal leech destabilase-lysozyme. Biochem.
Biophys. Res. Commun 306, 318–323.
10. Bachali, S., Jager, M., Hassanin, A., Schoentgen, F., Jolle
`
s, P.,
Fiala-Medioni, A. & Deutsch, J.S. (2002) Phylogenetic analysis of
invertebrate lysozymes and the evolution of lysozyme function.
J. Mol. Evol. 54, 652–664.
11. Jolle
`
s, J. & Jolle
`
s, P. (1975) The lysozyme from. Asterias rbens.
Eur. J. Biochem. 54, 19–23.
12. Jolle
`
s, J., Van Leemputten, E., Mouton, A. & Jolle
`
s, P. (1972)
Amino acid sequence of guinea-hen egg-white lysozyme. Biochim.
Biophys. Acta 257, 497–510.
13. Holton, T.A. (1991) A simple and efficient method for direct
cloning of PCR products using ddT-tailed vectors. Nucleic. Acids
Res. 19, 1156.
14. Callebaut, I., Labesse, G., Durand, P., Poupon, A., Chomilier, J.,
Henrissat, B. & Mornon, J. (1997) Deciphering protein sequence
information through hydrophobic cluster analysis (HCA): Cur-
rent status and perspectives. Cell Mol. Life Sci. 53, 621–645.
15. Kelley, L.A., MacCallum, R.M. & Sternberg, M.J. (2000)
Enhanced genome annotation using structural profiles in the

program 3D-PSSM. J. Mol. Biol. 299, 499–520.
16. MacCallum, R.M., Kelley, L.A. & Sternberg, M.J. (2000) SAW-
TED: structure assignment with text description – enhanced
detection of remote homologues with automated SWISS-PROT
annotation comparisons. Bioinformatics 16, 125–129.
17. Guex, N. & Peitsch, M.C. (1997) SWISS-MODEL and the Swiss-
PdbViewer: an environment for comparative protein modeling.
Electrophoresis 18, 2714–2723.
18. Adoutte, A., Balavoine, G., Lartillot, N. & de Rosa, R. (1999)
Animal evolution. The end of the intermediate taxa? Trends Genet.
15, 104–108.
19. Imoto, T. (1996) Lysozymes: Model Enzymes in Biochemistry and
Biology. (Jolle
`
s, P., ed.), pp. 163–181. Birkha
¨
uer, Basel.
20. Weaver, L.H., Grutter, M.G. & Matthews, B.W. (1995) The
refined structures of goose lysozyme and its complex with a bound
trisaccharide show that the ‘goose-type’ lysozymes lack a catalytic
aspartate residue. J. Mol. Biol. 245, 54–68.
21. Prager, E.M. & Jolle
`
s, P. (1996) Lysozymes: Model Enzymes in
Biochemistry and Biology. (Jolle
`
s, P., ed.), pp. 9–31. Birkha
¨
user,
Basel.

242 S. Bachali et al. (Eur. J. Biochem. 271) Ó FEBS 2003