Tài liệu Báo cáo khoa học:Symmetric fluoro-substituted diol-based HIV protease inhibitors Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly improve the antiviral activity and preserve binding efficacyy docx

Symmetric fluoro-substituted diol-based HIV protease inhibitors
Ortho-fluorinated and meta-fluorinated P1/P1¢-benzyloxy side groups significantly
improve the antiviral activity and preserve binding efficacy
Jimmy Lindberg
1
, David Pyring
2
, Seved Lo¨ wgren
1
,A
˚
sa Rosenquist
2
, Guido Zuccarello
2
,
Ingemar Kvarnstro¨m
2
, Hong Zhang
3
, Lotta Vrang
3
, Bjo¨ rn Classon
3,4
, Anders Hallberg
5
,
Bertil Samuelsson
3,4
and Torsten Unge
1

1
Department of Cell and Molecular Biology, BMC, Uppsala University, Sweden;
2
Department of Chemistry, Linko
¨
ping University,
Sweden;
3
Medivir AB, Huddinge, Sweden;
4
Department of Organic Chemistry, Arrhenius Laboratory, Stockholm University, Sweden;
5
Department of Organic Pharmaceutical Chemistry, Uppsala University, BMC, Sweden
HIV-1 protease is a pivotal enzyme in the later stages o f the
viral life cycle which is r esponsible for the processing and
maturation of the virus particle into an infectious virion. As
such, HIV-1 pro tease has become an important target for the
treatment of AIDS, and e fficient drugs have been developed.
However, negative side effects and fast emerging resistance
to the current drugs have necessitated t he development of
novel chemical entities in ord er to exploit different phar-
macokinetic properties as well as new interaction patte rns.
We have used X-ray crystallography to decipher the s truc-
ture–activity relationship of fluoro-substitution as a strategy
to improve the antiviral activity and the protease inhibition
of C2-symmetric diol-based inhibitors. In total we present six
protease–inhibitor complexes a t 1.8–2.3 A
˚
resolution, which
have been structurally characterized with r espect to their

antiviral a nd inhibitory activities, in order to evaluate t he
effects of different fluoro-substitutions. These C 2-symmetric
inhibitors comprise mono- and difluoro-substituted benzyl-
oxy side groups in P 1/P1¢ and indanoleamine side groups in
P2/P2¢. The ortho- an d meta-fluorinated P1/P1¢-benzyloxy
side groups proved to have the most cytopathogenic effects
compared with the nonsubstituted analog and related
C2-symmetric diol-based inhibitors. The different fluoro-
substitutions are well accommodated in the protease S1/S1¢
subsites, a s observed by an increase in favorable Van der
Waals c ontacts and surface area buried by the inhibitors.
These data will be used in the development of potent
inhibitors with different pharmacokinetic profiles towards
resistant protease mutants.
Keywords: AIDS; aspartic protease; crystal structure; fluor-
ine; HIV.
Human immunodeficiency virus 1 ( HIV) is the causative
agent of AIDS [1–3]. The single-stranded RNA genome of
HIV encodes a dimeric aspartyl protease (protease) which
processes the viral gag and gag-pol precursor polyproteins
into structural and f unctional proteins. The HIV protease
has been shown to be essential in the production of mature
and infectious virions [4,5], hence inhibition of this enzyme
has b ecome an attractive ta rget for effective a ntiviral agent s;
several protease inhibitors are currently in clinical trials.
Despite t he initial success o f the FDA approved protease
inhibitors (saquinavir [6], ritonavir [7], indinavir [8], nelfin-
avir [9], amprenavir [10], lopinavir [11] and atazanavir [12]),
there is an urgent need for improved drugs against HIV
protease because of increasing viral resistance and unfavor-

able pharmacokinetic profiles [13–16].
Our research group has utilized carbohydrates as building
blocks in the design an d synthesis of C2-symmetric protease
inhibitors. T he applied method of syn thesis p roduces a
symmetry core unit w ith the C2-symmetry axis in the center
of an asymmetric inhibitor using
L
-mannaric a cid as the
building block [17–20]. Subsequent benzylation and coup-
ling w ith amino acid or amines gave a series of symmetric or
asymmetric diol-based inhibitors which were f urther opti-
mized on the P1/P1¢ and P2/P2¢ side groups, providing a
variety of inhibitors with efficient antiviral profiles [21–26].
This class of protease inhibitors has p reviously been
associated with poor absorption profiles in cell assays and
unsatisfactory pharmacokinetics in rats, which led us to
investigate the effect of fluoro-substituted inhibitors on cell
absorption. The substitution of fluorine for hydrogen
introduces a minor increase in molecu lar mass and minimal
steric changes accompanied by increased lipophilicity
(Table 1) [27–29]. Previously, these properties of fluorine
have been utilized successfully in the development of
receptor-subtype-selective cholinergic and adrenergic drugs
[30–32]. To study these e ffects of fluorine on s ymmetric diol-
based protease inhibitors, we synthesized a series of fluoro
inhibitors, w ith e ither m ono- or di-substituted P1/P1¢-
benzyloxy side groups [33].
Correspondence to T. Unge, Department of Cell and Molecular
Biology, BMC, Box 596, Uppsala University, SE- 751 24, Uppsala,
Sweden. Fax: +46 18 530396, Tel.: +46 18 4714985,

E-mail:
Enzyme: HIV-1 protease, POL_HV1B1 (P03366) (EC 3.4.23.16).
Note: The refined coo rdinates and assoc iated struc ture factors of
HIV-1 protease in complex with inhibitors 1–6 have been deposited
in the RCSB Protein Data Bank wi th accession codes: 1EBY, 1EC0,
1W5V, 1W5W, 1W5X, and 1W5Y.
(Received 20 August 2004, revised 28 September 2004,
accepted 12 October 2004)
Eur. J. Biochem. 271, 4594–4602 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04431.x
Herein we have used X-ray crystallography to decipher
the structure–activity relationship for this series of fluoro
inhibitors. In general, fluoro-substitution results in efficient
utilization of a ccessible v olume in the subsites, associated
with increased number of Van der Waals contacts and
surface area buried by the inhibitors. This is reflected in
moderate to good protease inhibition (K
i
values), albeit
poorer than the nonsubstituted analog. The general reduc-
tion in binding efficacy associated with fluoro-substitution is
contradictory with respect to the increase in number of Van
der Waals contacts and favorable electrostatic contacts. It is
possible that the presence of two binding configurations of
the fluoro-substituted benzyloxy side groups in the S1/S1¢
subsites may account for the general reduction in bind ing
efficacy t hat w e obser ved for the fluoro inhibitors compared
with the nonsubstituted analog. Structural and biochemical
data suggest that difluoro-substitutions at the ortho and
meta positions on P1/P1¢-benzyloxy side groups of sym-
metric diol-based protease inhibitors preserve the b inding

efficacy and significantly improve the antiviral potency.
Materials and methods
Expression of HIV-1 protease
The expression and purification of HIV-1 protease w as
adapted from Andersson et al. [21]. The protease gene was
isolated by PCR with the upstream primer GAACA
TATGGCCGATAGACAAGGAACTGTATCC and the
downstream primer AGGGGATCCCTAAAAATTTAA
AGTGCAACCAATCTG. The annealing s ite f or the
upstream primer corresponds to 12 amino acids before the
protease sequence. These extra amino a cids were added to
facilitate the autocatalytic processing of the precursor
protein and thereby ensure a correct N-terminus. Through
the PCR step, the protease DNA fragment was provided
with an NdeI restriction site at the 5¢ end and a BamHI site
at the 3¢ end. These sites were used for ligation to the
pET11a expression vector. Escherichia coli st ra ins XL-1 and
HB101 were used as hosts for cloning.
Protein e xpression was performed in E. coli strain
BL21(DE3). Bacteria were grown in Luria–Bertani medium
to an A
550
of 1.0 before induction by the addition of 0.5 m
M
isopropyl b-
D
-thiogalactoside. Cells were harvested after 3 h
of induction.
Purification of HIV-1 protease
Cells were suspended in lysis buffer (20 m

M
Tris/HCl,
pH 7.5, 10 m
M
dithiothreitol, 1 m
M
phenylmethanesulfonyl
fluoride) and lysed in a French press. The lysate was
centrifuged for 30 min at 12 100 g. The insoluble inclusion
body fraction, which contained more than 90% of the
expressed material, was dissolved in buffer (8
M
urea, 20 m
M
Tris/HCl, pH 8.5, 10 m
M
NaCl, 10 m
M
dithiothreitol,
1m
M
EDTA) and incubated for 1 h at room temperature
followed by centrifugation for 20 min at 48 200 g.
The chromatographic steps were performed at 5 °C.
ThesupernatantwasappliedtoaPOROSQ
TM
column
(Perspective Biosystems, Cambridge, CA, USA). The flow-
through fraction was collected and diluted to a final
protein c oncentration of 0.3 mgÆmL

)1
. R efolding was
performed by dialysis against 20 m
M
sodium phosphate
buffer, pH 6.5, containing 10 m
M
dithiothreitol and 1 m
M
EDTA, at room temperature for 60 min. The r efolded
protein was diluted with an equal volume of buffer (50 m
M
MES, pH 6.5, 1 m
M
dithiothreitol, 1 m
M
EDTA), applied
to a POROS HS column (Centricon, Billeric a, CA, USA),
and eluted with a linear gradient of 0–0.6
M
NaCl in MES
buffer. The pooled fractions were precipitated with
(NH
4
)
2
SO
4
. The precipitate was collected by low-speed
centrifugation and dissolved in 50 m

M
MES, pH 6.5,
containing 10 m
M
dithiothreitol, 100 m
M
2-mercaptoetha-
nol, and 1 m
M
EDTA. The solution was desalted on a
PD-10 column (AP Biotech AB, Uppsala, Sweden) and
concentrated by ultrafiltration with CentriconÒ Centrifugal
Filter Units to 2 mgÆmL
)1
.
Enzyme activity/inhibition studies
Enzyme activity/inhib ition studies were performed as des-
cribed by Nillroth et al. [34]. Briefly, a fluorimetric assay
was used t o d etermine the effects of the inhibitors on HIV-1
protease. This assay used an internally quen ched fluorescent
peptide substrate, DABSYL- c-Abu-Ser-Gln-Asn-Tyr-Pro-
Ile-Val-Gln-EDANS (Bachem, B ubendorf, Switzerland).
The measurements were performed in 96-well plates with a
Fluoroscan plate reader (Labsystems, Helsinki, Finland).
Excitation and emission wavelengths were 355 nm and
500 nm, respectively.
Anti-HIV activity was assayed in vitro in MT4 cells with
the vital dye XTT (Sigma-Aldrich, Steinheim, Germany) to
monitor the cytopathogenic effects [35].
Crystallization

Crystallization was pe rformed at 4 °C with the hanging-
drop vapour-diffusion method. Drops were prepared by
mixing 5 lL protein inhibitor s olution with an equal v olume
of reservoir solution. The protein inhibitor solution con-
tained 2 mgÆmL
)1
protein in 50 m
M
MES, pH 6.5, con-
taining 10 m
M
dithiothreitol and 1 m
M
EDTA, and 7 m
M
inhibitor in 10% (v/v) dimethyl sulfoxide. The reservoir
solution contained 50 m
M
MES, pH 5.5, and 0.5
M
NaCl.
The drops were microseeded a fter 2 days. Crystals appeared
after 1 week, and grew to the final size of 0 .3 ·
0.3 · 0.05 mm in 3–4 weeks.
Data collection and processing
X-ray data were r ecorded on MAR-imaging plates on the
synchrotron beam lines 9.5 DRAL at the Daresbury
Table 1. Physicochemical properties of the carbon–fluorine bond.
Values used in the evaluation of intermolecular c ontacts among the
protease–inhibit or com plexes.

Element
Electro-
negativity
Bond length
(CH
2
X, A
˚
)
Van der Waals
radius (A
˚
)
H 2.1 1.09 1.2
F 4.0 1.39 1.4
C 2.5 1.42 1.7
O (OH) 3.5 1.43 1.6
Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4595
Laboratory, D aresbury, Cheshire, UK, DL41 and DW32 at
Lure, France, and I711 at MAX-lab, Lund, Sweden. The
programs
DENZO
and
SCALEPACK
were used for processing
and scaling [36,37]. A summary of data collection s tatistics is
giveninTable2.
Structure refinement
Refinement was performed using the program package
CNS

[38]. The protease model coordinates from 1EBW
were used for molecular replacemen t calculations. The
starting model was refined with r igid-body r efinement
and simulated annealing. The difference Fourier map
(F
o
–F
c
) clearly showed the position and orientation of
inhibitor together with many water molecules. The
inhibitor was b uilt into the electron density with the
molecular visu alization program
O
[39]. Water molecules
were added to the structures determined from the
difference Fourier maps a t chemically acceptable sites.
Only solvent molecules with B values less than 50 A
˚
2
were accepted. Several cycles of minimization, simulated
annealing, and B factor refinement were performed for
each complex, accompan ied with manual rebuilding. The
R
cryst
and R
free
factors were used to monitor the
refinement [40]. The refinement statistics are shown in
Table 2.
Results

Inhibitor properties
The linear C2-symmetric inhibitors in this study encompass
a six-carbon chiral center derived from
L
-mannaric acid.
The five P1/P1¢ fluoro-substituted C2-symmetric inhibitors
2–6 were synthesized based on the nonsubstituted analog; 1
with benzyloxy side groups in P1/P1¢ and i ndanolamine side
groups in P2/P2¢ [33]. All inhibitors have K
i
values within
the nanomolar to picomolar range, and antiviral activity
expressed as E D
50
values varying from 100 to 20 n
M
(Table 3) .
Table 2. Crystallographic s tructure determination statistics for protease–inhibitor complexes 1–6. Statistics for reflections in h ighest resolution shells
are indicated in parentheses.
123456
PDB accession number 1EBY 1EC0 1W5V 1W5W 1W5X 1W5Y
Data collection details
Space group P2
1
2
1
2P2
1
2
1

2P2
1
2
1
2P2
1
2
1
2P2
1
2
1
2P2
1
2
1
2
Wavelength (A
˚
) 1.386 1.386 0.976 0.976 0.976 0.976
No of crystals 156444
Cell dimensions (A
˚
)
a ¼ 59.2 58.4 58.5 58.3 58.5 59.2
b ¼ 86.9 86.3 86.1 85.9 86.3 87.0
c ¼ 47.2 46.8 46.6 46.8 46.6 47.2
d
min
(A

˚
) 2.3 1.8 1.8 1.8 1.8 1.9
No. of observations 28849 52852 97169 102338 86063 49671
No. of unique reflections 10685 21005 21224 21819 21258 16080
Completeness (%) 93.8 (93.0) 88.2 (84.1) 94.1 (90.8) 97.7 (89.3) 95.3 (95.0) 82.9 (83.0)
R
merge
a
(%) 4.6 (22.2) 12.6 (31.2) 3.4 (16.0) 7.0 (25.2) 4.8 (23.0) 11.4 (31.9)
Reflections I > 2 r (%)847686889090
Reflections I > 2 r in
highest resolution shell (%)
74 50 66 64 61 78
Bin resolution (A
˚
) 2.40–2.30 2.00–1.80 1.90–1.80 1.83–1.80 1.83–1.80 2.02–1.90
Refinement statistics
Resolution range (A
˚
) 24.0–2.3 25.0–1.8 25.0–1.8 28–1.8 25.0–1.8 30.0–1.9
R
cryst
b
(%) 18.1 19.0 19.9 19.9 18.8 18.8
R
free
c
(%) 20.0 22.0 21.8 21.8 20.7 21.8
No. of atoms 1662 1668 1684 1691 1690 1669
Mean B factor (A

˚
2
)
All 20.2 19.1 21.9 21.3 20.1 22.3
Solvent 34.5 42.0 33.4 34.9 35.4 46.0
Deviation from ideality
d
Bond lengths (A
˚
) 0.008 0.007 0.005 0.005 0.006 0.006
Angles (°) 1.2 1.3 1.2 1.2 1.2 1.2
Dihedrals (°) 25.4 25.3 25.2 25.1 25.1 25.2
Impropers (°) 0.77 0.69 0.70 0.69 0.70 0.90
a
R
merge
¼ S |I
i
) <I>|/SI
i
, where I
i
is an observation of the intensity of an individual reflection and <I> is the average intensity over
symmetry equivalents.
b
R
cryst
¼ S||F
o
|)|F

c
||/S|F
o
|, where F
o
and F
c
are the observed and calculated structure factor amplitudes, respect-
ively.
c
R
free
is equivalent to R
cryst
but calculated for a randomly chosen set of reflections that were omitted from the refinement process.
d
Ideal parameters are those defined by Engh & Huber [47].
4596 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Structure of the complexes
The crystal structures of the six protease–inhibitor com-
plexes have been solved and refined down to 1.8–2.3 A
˚
resolution with R
cryst
and R
free
of 18.1–19.9% and 20.0–
22.5%, respectively (Table 2). All complexes were crystal-
lized in the orthorhombic space group P2
1

2
1
2withthe
complete protease molecule in the asymmetric unit. This
twofold symmetry arrangement of the crystal packing does
not impose symmetry restraints on the protease dimer–
inhibitor complex. All six inhibitors bind in an asymmetric
manner to t he protease, with t he hydroxyls of the chiral
center in staggered and gauche positions with respect to the
catalytic aspartates and the strong interaction with one of
the hydroxyls, which i nvolves short distance h ydrogen
bonds with strong polar components. The geometric
restraints of the hydroxyls cause the asymmetric bin ding.
The asymmetry of the central h ydroxyls is present in all
inhibitor s tructures, propagating significant differences in
the d istances between the inhibitor side g roups and
respective s ubsites. T he characteristic structural water
molecule is bridging the m ain-chain a mino groups of
Ile50/Ile50¢ to the carbonyls of the i nhibitor and is observed
in all complexes. The difference Fourier m aps, 2F
o
–F
c
and
F
o
–F
c
, unambiguously indicate the conformation of the
inhibitors and t he position of the fluorine s ubstitutions in

P1/P1¢ (Fig. 1).
Structural accommodations in response to ortho-, meta-
and para-fluoro-substituted P1/P1¢-benzyloxy side groups
Overall. The mono- and di-substituted inhibitors 2–6 bind
to the active site of the protease w ith specific accommoda-
tions of the residues lining the S1/S1¢ subsites, as compared
with the nonsubstituted analog 1. The rmsd of Ca atoms of
S1/S1¢-lining r esidues range from 0.12 to 0.33 A
˚
for the
different protease–inhibitor complexes. I n Fig. 2 an over-
view of the accommodation of S1 subsite lining residues is
presented with r espect to mono- and difluoro-substituted
benzyloxy side groups. The rmsd of all atoms from residue
side chains that are within 3.9 A
˚
of the P1-benzyloxy side
groups (Arg8, Leu23, Gly48, Gly49, Ile50, Val32, Pro81 and
Ile84) are plotted pairwise for the protease–inhibitors
complexes 1–6. Generally, the most pronounced side-chain
accommodations in re sponse to the fluoro-substitution in
ortho, meta and p ara positions on the P1-benzyloxy side
groups are in the range of 0.3–0.4 A
˚
, and are mainly
observed for residues Arg8, Leu23, Gly48, V al32 and P ro81.
The conformation of the remaining S1-lining residues
remains u naffected by the panel of fluoro-substitutions.
The protease inhibitor complex with inhibitor 6 exhibited
the most pronounced shifts in side-chain position, partic-

ularly for residues Arg8 and Leu23, which are displaced
 0.5 A
˚
with respect to inhibitors 1–5.
2- and 3-Fluorobenzyloxy side groups. The mono-substi-
tuted inhibitors 2 and 3 are fluoro-substituted in the ortho
(2-fluoro) and meta ( 3-fluoro) positions of the benzyloxy
side groups, respectively. Table 4 summarizes the binding
characteristics of the fluoro inhibitors. For the P1/P1 ¢
mono-substituted inhibitors, 2 and 3, the accessible volume
of the s ubsites is utilized more efficiently in relation to
the surface area buried by the inhibitors compared with the
nonsubstituted a nalog, as evid enced by an increase in the
number of favorable Van der Waals contacts. Superimpo-
Table 3. Binding characteristics of the fluoro inhibitors to the protease active site.
Inhibitor
Molecular
mass (Da)
Buried surface
area (A
˚
2
)
a
No. of inhibitor–
protease contacts
b
No. of
hydrogen bonds
c

No. of
repelling contacts
d
K
i
(n
M
)
ED
50
e
(l
M
)
1 652.7 1394.6 57 10 – 1.2 0.10
2 671.7 1440.1 71 10 – 3.2 0.05
3 671.7 1398.3 78 10 2 7.1 0.06
4 690.7 1435.8 70 11 – 1.6 0.11
5 690.7 1433.5 84 10 2 4.0 0.03
6 690.7 1456.3 69 10 – 3.3 0.02
a
Buried surface area was calculated with programs in the
CNS
package [38].
b
An atom-pair distance of less than 3.9 A
˚
was used as criterion
for a close contact.
c

Hydrogen bonds were calculated with a maximum distance of 3.2 A
˚
between acceptors and donors.
d
An atom-pair
distance of less then 3.5 A
˚
between atom with same polarity was used as a criterion for a repelling contact.
e
ED
50
for reference substances
tested in the same assay: ritonavir (ED
50
0.06 l
M
), indinavir (ED
50
0.06 l
M
), saqinavir (ED
50
0.01 l
M
), nelfinavir (ED
50
0.04 l
M
).
Fig. 1. Conformation of the C2-symmetr ic inhibitor 4 in the protease

active site. The 2F
o
–F
c
difference electron-density m ap unambiguously
shows a unique orientation of the inhibitor and the fluorine substitu-
ents on the P1/P1¢ side groups. The electron density maps were ca l-
culated at 1.8 A
˚
resolution with the inhibitor omitted, employing the
omit option in
CNS
[38]. Map contouring is at 0.4 eÆA
˚
3)1
(1 r).
The figure was drawn with the program
SWISS
-
PDBVIEWER
[45]
( and 3D-rendered with
POV
-
RAY
( />Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4597
sition of the two inhibitors on the nonsubstituted a nalog
revealed that the position of 2-fluoro; 2 and 3-fluoro; 3
benzyloxy side g roups in the S1/S1¢ subsites are similar, and
slightly closer to Arg8/Arg8¢ than in the non-substituted

analog. For inhibitor 2, this position prevents steric clashes
between the 2 -fluoro substituents and Ile50/Ile50¢ side
chains and puts the 2-fluoro in range of Van der Waals
contacts to the Cc1 c arbons. In contrast, the 3-fluoro-
benzyloxy side groups of inhibitor 3 have no contacts with
the i soleucines. I nstead, there are V an der Waals contacts to
Gly48/Gly48¢ and Pro81/Pro81¢ where the former contacts
display unfavorable electrostatic interactions between the 3-
fluoro atoms and the glycine backbone carbonyls (Table 4).
2,3-, 2,4- and 2,5-Difluorobenzyloxy side groups. The
changed size and chemical character of the difluoro-
substituted benzyloxy side groups is accommodated for by
the S1/S1¢ subsites. I t is e vident by sligh t changes i n
position of the P1/P1¢ side groups and residue side-chain
adaptations. In Fig. 3 inhibito rs 2 and 6 are superimposed
on to the nonsubstituted analog to show the difference in
position of the benzyloxy side groups associated with
2-fluoro and 2,5-difluoro-substitutions compared with the
nonsubstituted analog. The 2,5-difluoro-substitution in
inhibitor 6 changes the position of the benzyloxy side
groups 0.8 A
˚
towards t he C f-carbon of Arg8/Ar g8¢,
accompanied by 0.3/0.4 A
˚
shifts in side-chain positions
compared with inhibitors 1–5. The conformations of the
arginine side chains are stabilized by hydrogen bonds from
Asp29/Asp29¢ resulting in a restrained repositioning of the
2,5-difluorobenzyloxy side groups in proximity of the Cf

carbon. Notably, the 5-fluoro s ubstituents are observed
within dipole–dipole interaction range of the partially
charged C f carbon of the arginines. The presence of an
electrostatic interaction is supported by quantum mechan-
ical calculat ions of the partial charges for Cf carbon
(+ 0.3 4) a nd the 5-fluoro substituents ()0.11) in vacuu m
(unpublished observations). In addition, the repositioning
of the benzyloxy side groups results in lost Van der Waals
contacts between the 2-fluoro substituents and Ile50/Ile50¢
side chains. Fu rthermore, the crystal structure of inhibitor
6 reveals increased flexibility (higher B values) and reduced
quality of the electron density for the isoleucine side chains
compared with the i nhibitor 2 complex. In Fig. 4,
inhibitors 4 (2,4-difluoro) and 2 (2-fluoro) are superim-
posed on the nonsubstituted analog 1. In contrast with the
structural adaptation required for the 2,5-difluoro-substi-
tutions, the 2,4-difluoro-substituted benzyloxy side groups
(4) accommodate well in the S1/S1¢ subsites. Thus, the
4-fluoro substituents act a s proton acceptors in two
hydrogen bonds to the nitrogen atoms of Arg8/Arg8¢ side
chains, and the 2-fluoro substituen ts are within Van der
Waals distance of Ile50/Ile50¢.
Enzyme activity/inhibition studies
The present series of fluoro-substituted inhibitors shows
satisfactory protease inhibition with K
i
values in the
picomolar to nanomolar range, albeit poorer than the
nonsubstituted analog 1. Notably, for P1/P1¢ fluoro-substi-
tutions, the antiviral activity (as measured by ED

50
values)
were m arkedly improved compared with the nonsubstituted
analog and other related C2-symmetric diol-based protease
inhibitors [23,26], and comparable to the reference com-
pounds indinavir, ritonavir, nelfinavir, and saquinavir. The
inhibitory efficacy ( as measured by K
i
values) on enzyme
activity of the P1/P1¢-fluorinated analogs differs depending
on the position of fluoro-substitution on the benzyloxy side
group, par a being greater than ortho and ortho greater than
meta. Among the fluoro-substituted inhibitors, the most
potent was the disubstituted inhibitor 4 (2,4-difluoro).
However, the effect on the antiviral activity is more c omplex
(Table 3) .
Benzyloxy side groups disubstituted in the ortho and
meta position exhibit the highest antiviral potency
(Table 3). Among the d isubstituted analogs, the most
potent was inhibitor 6 (2,5-difluoro), but the difference in
antiviral activity a mong the mono- and d i-substituted fluoro
inhibitors was minor. H owever, not surprisingly, t he
significant increase in volume of the P1/P1¢ side group
affects the inhibitory efficacy. Fo r example, inhibitor 6 (2,5-
difluoro) has an ED
50
of 0.02 l
M
, albeit it has a moderate K
i

of 3.3 n
M
compared with the reference compound 1 with an
ED
50
of 0.1 l
M
and a K
i
of 1.2 n
M
. However, the most
convincing e vidence on the ability of fluorine substitution to
enhance antiviral activity in cell assay was observed for
inhibitor 3 which has an ED
50
of 0.06 l
M
and a K
i
of
7.1 n
M
.
Fig. 2. Accommodation of S1-lining residues as a result of P1-benzyloxy
fluorination. The root-mean-square deviation (RMSD ) of all side chain
atoms within 3.9 A
˚
of the P1 benzyloxy side groups of inhibitors 1–6
are p lotted pairwise. The expansion of the S 1 subsite is most apparent

for residues L eu23, Gly48 Val32 and Pro81, which show the most
significant accommodations on P1-benzyloxy fluorination compared
with the nonsubstituted analog 1. Inhibitor-specific side-chain
accommodations are most pro nounced for inhibito r 6 where Arg8 and
Leu23 are displaced  0.5 A
˚
with respect to inhibitors 2–5.The
S1-subsite residues Ile50 a nd Ile84 display high flexibility with large
atomic displacements, which correlates with B values above average.
The RMSD values were calculated using
LSQMAN
[46].
4598 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Discussion
Symmetric HIV-1 protease inhibitors comprising the
C2-symmetric diol-based scaffold with v arious P1/P1¢ and
P2/P2¢ side groups were previously found by us to exhibit
poor antiviral activity despite moderate-to-good protease
inhibition [23–26].
As fluoro-substitution is known to modulate pharmaco-
kinetic properties of various compounds, we decided to
fluorinate the benzyloxy side groups as a strategy for
improving their ce ll absorption by the cell. The series of
fluoro inhibitors based on inhibitor 1 were tested on MT4
cells and showed improved antiviral activity, whereas
fluorinations of P2/P2¢-indanolamine side groups did not
(unpublished observations). It is also remarkable that all
fluoro analogs except inhibitor 4 displayed reduced binding
efficacy with respect to the nonsubstituted analog. The
apparently moderate K

i
values indicate inefficient accom-
modation of fluoro-substituted P1/P1¢ benzyloxy side
groups in the respective subsites. However, the orientation
of the fluoro inhibitors in the active site showed an increased
number of Van der Waals contacts and favorable electro-
static contacts to the p rotease s ubsites, which is evidence for
an improvement i n protease i nhibition. These contradictory
results may mean that the asymmetrically fluoro-substituted
benzyloxy side groups have two binding configurations,
differing by a 180° rotation, with two distinct affinities for
the S1/S1¢ subsites. However, i n the structures of the
complexed forms of the protease, only one configuration is
trapped in the crystal lattices and observed at full occu-
pancy. Computer modeling of the 2- and 3-fluorobenzyloxy
side groups showed that the 180°-rotated configurations
were equally possible; the fluoro substituents filled t he space
in the vicinity of Gly27/Gly27¢ and Leu23/Leu23¢ without
need for s ide-chain adaptation. However, the modeling also
revealed repelling contacts between the fluoro substituents
and the back bone carbonyl o xygen of G ly27/Gly27¢ and
Leu23/Leu23¢, making that confi guration highly unfavora-
ble. Extending the modeling to the disubstituted inhibitors
4–6 showed similar unfavorable binding properties of the
180°-shifted configurations. This is also reflected in a
reduction in binding efficacy (increased K
i
values) for
Table 4. Effect of P1/P1¢ fluoro-substitution on interatomic d istances between inhibitor side groups and subsite-lining residues. Dista nces presented in
bold represent f avorable Van de r Waals and electrostatic contacts, whereas dista nces in italics represent unfavorable charge r epulsions. Hydrogen

bonds were calculated with a m aximum distance of 3.2 A
˚
between acceptors an d donors and are i ndicated by an asterisk. The inh ibitor–residue
distances were measured between the c losest atom pairs with t he macromolecular visualization p rogram
O
[39]. The diol-based scaffold, substituted
with indanolamine in P2/P2¢ positions, is included for clarity.
Inhibitor
P1/P1¢-
side group
Inhibitor–residue distance (A
˚
)
Arg8/Arg8¢ Ile50/Ile50¢ Leu23/Leu23¢ Gly48/Gly48¢
Cf Ne NH
2
Cc1Cd2O
1
3.6/4.0 4.5/4.8 3.5/3.7 4.8/4.7 3.8/3.8 3.9/3.7
2
3.5/3.7 4.3/4.4 3.5/3.4 3.8/3.7 3.6/3.5 3.9/3.9
3
3.5/3.7 4.3/4.5 3.5/3.5 5.0/4.7 3.5/3.6 3.4/3.3
4
3.5/3.8 4.3/4.4 3.5/3.0* 3.9/3.7 3.7/3.4 3.7/3.9
5
3.4/3.6 4.1/4.2 3.4/3.6 3.7/3.5 3.5/3.4 3.3/3.3
6
2.7/2.8 2.9/3.1 3.0/3.0 3.9/3.9 3.4/3.5 4.0/4.1
Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4599

inhibitors fluoro-su bstituted a symmetrically on the benzyl-
oxy side groups compared with symmetric analogs, such as
the nonsubstituted inhibitor (1), 2,6- and 3,5-difluoro-
substituted analogs [33]. However, it cannot be excluded
that other factors are involved in the reduced binding
efficacy f o r the fluoro inhibitors, including decreased
entropy and increased solvation energies.
Modeling of the two possible orientations of the side
groups indicates that the trapped configurations observed in
the X-ray structures should have the highest binding efficacy
compared with the 180°-rotated configurations. Thus, o n
the basis of the physicochemical properties of the fluorine–
carbon bonds (Table 1), the effect from individual fluori-
nations on binding efficacy c ould be discerned by e valuating
the intermolecular contacts among the protease–inhibitor
complexes. The m onosubstituted 2-fluoro s ide groups are
accommodated differently in the S1/S1¢ subsites compared
with the 3-fluoro and nonsubstituted side groups. The
2-fluoro inhibitor utilize s the accessible volume in the
subsites more efficiently, which is reflected as a gain of two
Van der Waals contacts to Ile50/Ile50¢ side chains, contacts
that are not present in the case of the 3 -fluoro inhibitor.
Interestingly, the 1 80°-rotated configuration i s not ob served
in the X-ray structure, but modeling reveals that the
benzyloxy side groups need to adapt their configuration to
prevent steric clashes with Arg8/Arg8¢, which results in lost
contacts to the Ile50/Ile50¢ side chains. This underlines the
importance of p reserved Van der Waals contacts between
the 2-fluoro substituents and the isoleucine side chains. The
lower B values and improved electron-density map quality

for the isoleucines in c omplex with inhibitor 2 in contrast
with inhibitor 3 also reflects this. In addition to the
difference in Van der Waals contacts to the S1/S1¢ subsites
of the two inhibitors, the twofold reduction in protease
inhibition for inhibitor 3 is due to charge repulsion between
the 3-fluoro substituents an d the backbone carbonyls of
Gly48/Gly48¢.
The differences in proteas e inhibition for t he 2,3-, 2,4- and
2,5-difluoro-substitutions outlined in Table 3 can be attrib-
uted to a gain or loss of intermolecular contacts to the
S1/S1¢ subsites. Similar to 3-fluoro (3), the 2,3-difluoro side
groups in inhibitor 5 are inefficiently accommodated in the
S1/S1¢ subsites, mainly because of the charge repulsion to
Gly48/Gly48¢. However, the contribution from the 2-fluoro
substituents results in a significant improvement in pro-
tease inhibition (K
i
4.0 n
M
) compared with inhibitor 3
(K
i
7.1 n
M
). The 2 ,4-difluoro-substitutions in inhibitor 4 are
well accommodated by t he S1/S1¢ subsites: the 4-fluoro
substituents acting as proton acceptors in two hydrogen
bonds to Arg8/Arg8¢ and the 2-fluoro substituents are
within Van der Waals distance of Ile50/Ile50¢. The gain in
Gibbs free energy from saturation of two proton acceptors

accounts for the t wofold improvement in protease inhibition
(K
i
1.6 n
M
) compared with the 2-fluoro-substituted analog
(K
i
3.2 n
M
). The 2-fluoro inhibitor 2 and 2 ,5-difluoro
inhibitor 6 were equipotent in terms of protease inhibition
despite the 2,5-difluorobenzyloxy side group repositioning.
This is at tributed to the contacts g ained to Arg8/Arg8¢ by
the 5-fluoro substituents and to contacts lost to Ile50/Ile50¢
by the 2-fluoro substituents. Hence, t he K
i
values are
influenced not only by the number of fluorine substituents
but also by the position of the fluorine on t he benzyloxy s ide
groups.
Antiviral activity, ED
50
Our monofluoro- and difluoro-substituted inhibitors exhibit
significant improvements in antiviral activities in MT4 cell
culture assay co mpared with the nonsubstituted analog 1.
Fig. 4. Superimposition o f the 2,4-difluoro-substituted inhibitor on the
nonsubstituted analog in the S1¢ subsite. Th e 2,4-difluoro-substitution o f
inhibitor 4 fills the accessible volume o f the S1 ¢ subsite more efficiently
than the nonsubstituted a nalog. The 2 -fluoro substituent is in Van der

Waals contact with residue I50 and the 4-fluoro substituent acts as a
proton acceptor in a hydrogen bond to R8¢. The 2,4-difluoro-substi-
tuted i nhibitor 4 is shown in ligh t blue, and the n onsubstitute d analog
in brown. The figure was drawn with the program
SWISS
-
PDBVIEWER
[45] ( and 3D-rendered with
POV
-
RAY
( />Fig. 3. Superimposition of the 2-fluoro- and 2,5-difluoro-substituted
inhibitors on to the nonsubstituted analog in the S1¢ subsite. The 2,5-
difluoro-substitution of in hibitor 6 results in a slightly different adap-
tation of the benzyloxy side groups to the S1/S1¢ subsites compared
with the 2-fluoro (2) and nonsubstituted analogs (1). The 2-fluoro-
substituted inhibitor is shown in light green, the 2,5-difluoro-substi-
tuted i nhibitor in dark gray, and the nonsubstituted analog in
brown. The figure was drawn with the program
SWISS
-
PDBVIEWER
[45] ( and 3D-rendered with
POV
-
RAY
( />4600 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Previously, these symmetric diol-based protease inhibitors
have been associated with a variety of pharmacological and
metabolic distinctions that negatively affect their adminis-

tration, distribution, and toxicity, properties that have been
discussed in a number of different reviews [13,16,41]. It is
noteworthy, however, that ortho-, meta- and fluoro-substi-
tuted benzyloxy side group s had markedly improved ED
50
values than the nonsubstituted analog and related
C2-symmetric diol-based protease inhibitors [23,26]. These
values were comparable to those for the reference drugs
ritonavir, indinavir, saquinavir, and nelfinavir. This ten-
dency can be attributed in part to the higher lipophilicity of
the fluoro-substituted i nhibitors [42]. Fluorine contributes
to overall pharmacological activity by enh ancing bioavail-
ability and retarding metabolic degradation. It thereby
extends the c linical applications for several different drug
candidates [43,44]. In our series of fluoro inhibitors, the
fluorine substitution with most enhanced antiviral activity i n
a cell assay w as observed for inhibitor 3 which had an ED
50
of 0.06 l
M
and a K
i
as high as 7.1 n
M
. In addition to the
improved antiviral effect, fluorination offers pharmacologi-
cal alternatives to co mbat resistance mutations of HIV-1
protease, because it extends th e cont act surf ace and has
polarity d ifferences. This is documented by the threefold
improvement in activity of inhibitors 2 and 6 against the

triple mutant M46I, I82V and V84A compared with the
nonsubstituted analog 1 [33].
Conclusion
We have used X-ray c rystallography to s tudy the s tructure–
activity relationship of a series of fluoro inhibitors com-
plexed to HIV p roteas e. Compared w ith th e nonsubstitut ed
analog, the fluoro inhibitors have improved the antiviral
activity and retained the binding efficacy. The flexibility of
the target molecule complicates the prediction of an effect
caused by a modification on the inhibitor and necessitates
structural analysis of each complex. The P1/P1 ¢ fluoro-
substitutions are a ssociated with efficient u tilization of
accessible volume in the subsites and increased number of
Van der Waals contacts. The general reduction in bind ing
efficacy associated with fluoro-substitution is contradictory
with respect to the efficient binding to the subsites. We
propose that the presence of two binding configurations to
the S1/S1¢ subsites of the fluoro-substituted benzyloxy side
groups accounts for the general reduction in protease
inhibition. Notwithstanding the moderate binding efficacy,
the most active fluoro inhibitor in terms of cytopathogenic
effects in cell-based experiments is ortho- and meta-difluor-
inated on the P1/P1¢ benzyloxy side groups. These data will
be used in th e d evelopment of new inhibitors with i mproved
pharmacokinetic p rofiles directed towards r esistant mu tants
of HIV-1 protease.
Acknowledgements
We than k Terese Bergfors for reading the manuscript and Professor
Alwyn Jones for fruitful discussions. This work was supported by the
Swedish Medical Research Consuil (MFR, K79-16X-09505-07A), the

Swedish N ational Board for Industrial and Technical Development
(NUTEK), the Swedish Research Council for Engineering Sciences
(TFR), and Medivir AB, Huddinge, Sweden.
References
1. Gallo, R .C., Salahuddin, S.Z., Popovic, M., Shearer, G.M.,
Kaplan, M., Haynes, B.F., Palker, T.J., Redfield, R., Oleske, J.,
Safai, B. et al. (1984) Frequent detection and isolation of cyto-
pathic retroviruses (HTLV-III) from patients with AIDS and at
risk for AIDS. Science 224, 500–503.
2. Gallo, R.C., Sarin, P.S., Gelmann, E.P., Robert-Guroff, M.,
Richardson, E., Kalyanaraman, V.S., Mann, D., Sidhu, G.D.,
Stahl, R.E., Zolla-Pazner, S., Leibowitch, J. & Popovic, M. (1983)
Isolation of human T-cell leukemiavirusinacquiredimmune
deficiency synd rome ( AIDS). Science 220, 865–867.
3.Barre-Sinoussi,F.,Chermann,J.C.,Rey,F.,Nugeyre,M.T.,
Chamaret, S., Gruest, J., Dauguet, C., Axler-Blin, C., Vezinet-
Brun, F., Rouzioux, C., Rozenbaum, W. & Montagnier, L. (1983)
Isolation of a T-lymphotropic retrovirus from a p atient at risk f or
acquired immune deficiency syndrome (AIDS). Science 220,868–
871.
4. Peng, C ., Ho, B.K., Chang, T.W. & Chang, N .T. (1989) Role
of human immunodeficiency virus type 1-specific protease in
core protein maturation and viral infectivity. J. Virol. 63, 2550–
2556.
5. Kohl, N.E., Emini, E.A., Schleif, W.A., Davis, L.J., Heimbach,
J.C., Dixon, R.A., Scolnick, E.M. & Sigal, I.S. (1988) Active
human immunodeficiency virus protease is required for viral
infectivity. Proc. Natl Acad. Sci. USA 85, 4686–4690.
6. Roberts, N.A., Martin, J.A., K inchington, D ., Broadh urst, A.V.,
Craig, J.C., Duncan, I.B., G alpin, S.A., Handa, B.K., Kay, J.,

Krohn, A. et al. (1990) Rational design of peptide-based HIV
proteinase inhibitors. Science 248, 358–361.
7. Kempf, D.J., Marsh, K.C., Denissen, J.F., McDonald, E., Vasa-
vanonda, S., Flentge, C.A., Green, B.E., Fino, L., Park, C.H.,
Kong, X.P. et al. (1995) ABT-538 is a potent inhibitor of human
immunodeficiency virus protease an d has h igh oral bioavailability
in humans. Proc.NatlAcad.Sci.USA92, 2484–2488.
8. Vacca, J.P., Dorsey , B.D., S chleif, W .A., Levin, R.B., M cDaniel,
S.L.,Darke,P.L.,Zugay,J.,Quintero,J.C.,Blahy,O.M.,Roth,E.
et al. (1994) L-735,524: an orally bioavailable human immuno-
deficiency virus type 1 protease inhibito r. Proc. Natl Acad. Sci.
USA 91, 4096–4100.
9. Kalish, V., Kaldor, S., Shetty, B., Tatlock, B., Davies, J., Ham-
mond,M.,Dressman,B.,Fritz,J.,Appelt,K.,Reich,S.&Su,K.
(1995) Eur. J. Med. Chem. 30, 201s–214s.
10. Reddy, P. & Ross, J. (1999) Formulary, 567–577.
11. Sham, H.L., Kempf, D.J., Molla, A., Marsh, K.C., Kumar, G.N.,
Chen,C.M.,Kati,W.,Stewart,K.,Lal,R.,Hsu,A.,et al. (1998)
ABT-378, a highly potent inhibitor of the human immunodefi-
ciency virus prote ase. Antim icrob. A gents Chemother. 42, 3218–
3224.
12. Bold, G., Fassler, A., Capraro, H.G., Cozens, R., Klimkait, T.,
Lazdins, J., Mestan, J., Poncioni, B., Rosel, J., Stover, D., Tin-
telnot-Blomley, M., Acemoglu, F., Beck, W., Boss, E., Eschbach,
M., Hurlimann, T., Masso, E., Roussel, S., Ucci-Stoll, K., Wyss,
D. & Lang, M. (1998) New aza-dipeptide analogues as potent and
orally absorbed HIV-1 protease inhibitors: candidates f or clinical
development. J. M e d. Chem . 41 , 3387–3401.
13. Sommadossi, J.P. (1998) Pharmacological considerations in anti-
retroviral therapy. Antivir. Ther. 3, 9–12.

14. Flexner, C. (1998) HIV-protease inhibito rs. N.Engl.J.Med.338,
1281–1292.
15. Molla, A., Granneman, G.R., Sun, E. & Kempf, D.J. (1998)
Recent developments in HIV protease inhibitor therapy. Anti-viral
Res. 39, 1–23.
16. Moyle, G. (2002) Overcoming obsta cles to t he success o f protease
inhibitors in highly active antiretroviral therapy regimens. AIDS
Patient Care STDS 16, 585–597.
Ó FEBS 2004 Fluorine substitution of HIV-1 protease inhibitors (Eur. J. Biochem. 271) 4601
17. Erickson, J. & Ke mpf, D. (1994) Structure-based design of
symmetric inhibitors of HIV-1 protease. Arch. Virol. Suppl. 9,
19–29.
18. Kempf, D.J. (1994) Design of symmetry-based, peptidomimetic
inhibitors of human immunodeficien cy virus protease. Methods
Enzymol. 241, 334–354.
19. Kempf, D.J., Norbeck, D.W., Codacovi, L., Wang, X.C., Kohl-
brenner, W.E., Wideburg, N.E., Paul, D.A., Knigge, M.F.,
Vasavanonda, S., Craig-Kennard, A. et al. (1990) Structure-
based, C2 symmetric inhibitors of HIV protease. J. Med. Chem.
33, 2687–2689.
20. Erickson, J., Neidhart, D.J., VanDrie, J., Kempf, D .J., Wang,
X.C., Norbeck, D.W., Plattner, J.J., Rittenhouse, J.W., Turon,
M., Wideburg, N. et al. (1990) De sign, activity, and 2 .8 A crystal
structure of a C2 symmetric inhibitor complexed to HIV-1 pro-
tease. Science 249, 527–533.
21. Andersson, H.O., Fridborg, K., Lo
¨
wgren, S., Alterman, M.,
Muhlman, A., Bjo
¨

rsne, M., Garg, N., Kvarnstro
¨
m,I.,Schaal,W.,
Classon, B., Karlen, A., Danielsson, U.H., Ahlsen, G., Nillroth,
U., Vrang, L., O
¨
berg, B., Samuelsson, B., Hallberg, A. & Unge, T.
(2003) Optimization of P1–P3 g roups in symmetric an d asym-
metric HIV-1 protease i nhibitors. Eur. J. Bioc hem. 27 0, 1746–
1758.
22. Alterman, M., Bjo
¨
rsne, M., Muhlman, A., Classon, B., Kvarn-
stro
¨
m, I., Danielson, H., Mark gren, P.O., Nillroth, U., Unge, T .,
Hallberg, A. & Samuelsson, B. (1998) Design and synthesis of new
potent C2-symmetric H IV-1 p rotease inh ibitors. Use of 1-man-
naric acid as a peptidomimetic scaffold. J. Med. Ch em. 41 , 3782–
3792.
23. Alterman,M.,Andersson,H.O.,Garg,N.,Ahlsen,G.,Lo
¨
wgren,
S., Classon, B., Danielson, U.H., Kvarnstro
¨
m,I.,Vrang,L.,
Unge, T., Samuelsson, B. & Hallberg, A. (1999) Design and fast
synthesis of C-terminal d uplicated potent C (2)-symmetric P1/P1 ¢-
modified HIV-1 protease inhibitors. J. Med. Chem. 42, 3835–3844.
24. Muhlman, A., Lindberg, J ., Classon, B., Unge, T., Hallberg, A. &

Samuelsson, B. (2001) Synt hesis of novel, potent, diol-based HIV-
1 protease inhibitors via intermolecular pinacol homocoupling of
(2S)-2-benzyloxymethyl-4-phenylbutanal. J. Med. Chem. 44,
3407–3416.
25. Muhlman, A., Classon, B., Hallberg, A. & S amuelsson, B. (2001)
Synthesis of p otent C(2)-sym metric, d iol-based h iv-1 protease
inhibitors. Investigation of thioalkyl and thioaryl P1/P1¢ substit-
uents. J. Med. Ch em. 44 , 3402–3406.
26. Oscarsson, K., Lahmann, M., Lindberg, J., Kangasmetsa, J.,
Unge, T ., Oscarson, S., Hallberg, A. & Samuelsson, B. (2003)
Design and synthesis of HIV-1 protease inhibitors. Novel tetra-
hydrofuran P2/P2¢-group s interacting with Asp29/30 of the
HIV-1 protease. Determination of binding from X-ray crystal
structure of inhibitor protease complex. Bioorg. Med. Chem. 11,
1107–1115.
27. Lee, K., Jung, W.H., H wang, S.Y. & Lee, S.H. (1999) Fluor-
obenzamidrazone thrombin inhibitors: influ ence o f fluorine on
enhancing oral absorption. Bioorg. Med. Chem. Lett. 9, 2483–
2486.
28. Park, B.K. & Kitteringham, N.R. (1994) Effects of fluorine sub-
stitution on drug metabolism: pharmacological and toxicological
implications. Drug Metab. Rev. 26, 605–643.
29. Park, B.K., Kitteringham, N.R. & O’Neill, P.M. (2001) Metabo-
lism of fluorine-containing drugs. An nu. Rev. Pharmacol. Toxicol.
41, 443–470.
30. Lu, S.F., H erbert, B., Haufe, G., Laue, K.W., Padgett, W.L.,
Oshunleti, O., Daly, J.W. & Kirk, K.L. (2000) Syntheses of (R)-
and (S)-2- and 6 -fluoronore pinephrine and ( R)- and (S)-2- and
6-fluoroepinephrine: effect of stereochemistry on fl uorine-indu ced
adrenergic selectivities. J. Med. Chem. 43, 1611–1619.

31. Bravo,P.,Resnati,G.,Angeli,P., Frigerio, M., Viani, F., Arnone,
A., Marucci, G. & Cantalamessa, F. (1992) Synthesis and phar-
macological evaluation of enantiomerically pure 4-deoxy-4-fluor-
omuscarines. J. Med. Chem. 35, 3102–3110.
32. Tewson,T.J.,Stekhova,S.,Kinsey,B.,Chen,L.,Wiens,L.&
Barber, R. (1999) Synthesis and biodistribution of R-andS-iso-
mers of [
18
F]-fluoropropranolol, a lipophilic ligand for the b eta-
adrenergic receptor. Nucl Med. Biol. 26, 891–896.
33. Pyring, D., Lindberg, J., Rosenquist, A., Zuccarello, G., Kvarn-
strom,I.,Zhang,H.,Vrang,L.,Unge,T.,Classon,B.,Hallberg,
A. & Samuelsson, B. (2001) Design and synthesis of potent
C(2)-symmetric diol-based HIV-1 protease inhibitors: effects of
fluoro-substitution. J. M ed. Ch em. 44 , 3083–3091.
34. Nillroth, U., Vrang, L., Markgren, P.O., Hulten, J., Hallberg, A.
& D anielson, U.H. (1997) Human i mmunode ficiency virus type 1
proteinase resistance to symmetric cyclic urea inhibitor analogs.
Antimicrob. Agents Chemother. 41, 2383–2388.
35. Weislow,O.S.,Kiser,R.,Fine,D.L.,Bader,J.,Shoemaker,R.H.
& Boyd, M.R. (1989) New soluble-formazan assay for HIV-1
cytopathic effects: application to high-flux screening of synthetic
and n atural pr oducts for AIDS- anti-viral activity. J. Natl Cancer
Inst. 81, 577–586.
36. Otwinowski, Z. & Minor, W. (1997) X-ray diffraction data c ol-
lected in oscillation mode. Methods Enzymol. 276, 307–326.
37. Gewirth, D. & Otwinowski, Z. (1995) The SCALEPACK Manual.
Yale University,NewHaven,CT.
38. Brunger, A.T., Adams, P.D., Clore, G.M., DeLano, W.L., Gros,
P., Grosse-Kunstleve, R.W., Jiang, J.S., Kuszewski, J., Nilges, M.,

Pannu, N.S., Read, R.J., Rice, L.M., Simonson, T. & Warren,
G.L. (1998) Crystallography & NMR system: a new software suite
for macromolecular structure determination. Acta Crystallogr. D
Biol. Crystallogr. 54, 905–921.
39. Jones, T.A., Zou, J Y., Cowan, S.W. & Kjeldgaard, M. (1991)
Improved methods for b uilding protein models in electron d ensity
maps and the location of errors in th ese models. Acta Crystallogr.
A 47 , 110–119.
40. Kleywegt, G.J. & Brunger, A.T. (1996) Checking your imagina-
tion: applications of the free R value . Structure 4, 897–904.
45. Guex, N. & Peitsch, M .C. (1997) SWISS-MODEL and the Swiss-
PdbViewer: an environment for comparative p rotein modeling.
Electrophoresis 18, 2714–2723.
41. Moyle, G.J. & Back, D. (2001) Principles and practice of
HIV-protease inhibitor pharmacoenhancement. HIV Med. 2,
105–113.
42. Welch, J. (1987) Advances in the preparation of biologically active
fluorinated compoun ds. Tetrahedron 43, 3123–3197.
43. Resnati, G. (1990) Aspects of the medicinal chemistry of fluoro-
organic compounds. Part I. Farmaco. 45, 1043–1066.
44. Bryskier, A. & Chantot, J.F. (1995) Classification and structure-
activity relationships of fluoroquinolon es. Drugs 49, 16–28.
46. Kleywegt, G.J. & Jones, T.A. (1997) Detecting folding m otifs and
similarities in protein structures. Methods Enzymol. 525–545.
47. Engh, R.A. & Huber, R. (1991) Accurate bond and angle para-
meters for X-ray p rotein structure refinement. Acta Crystallogr.
A47, 392–400.
4602 J. Lindberg et al.(Eur. J. Biochem. 271) Ó FEBS 2004