Tài liệu Báo cáo khoa học: Fatty acid desaturases from the microalga Thalassiosira pseudonana pptx

Fatty acid desaturases from the microalga Thalassiosira
pseudonana
Thierry Tonon
1,
*, Olga Sayanova
2
, Louise V. Michaelson
2
, Renwei Qing
1,
†, David Harvey
1
,
Tony R. Larson
1
,YiLi
1
, Johnathan A. Napier
2
and Ian A. Graham
1
1 CNAP, Department of Biology, University of York, Heslington, York, UK
2 Rothamsted Research Institute, Harpenden, UK
The algae, as a group, represent the third largest aqua-
culture crop (after freshwater fish and molluscs) in the
world today [1,2]. In recent years, considerable atten-
tion has been directed at marine microalgae for the
production of oils and fatty acids, in particular the use
of algal oils containing long chain polyunsaturated
fatty acids (LCPUFAs). The most prominent of these
are the health beneficial omega-3 eicosapentaenoic acid

(EPA, 20:5
D5,8,11,14,17
) and docosahexaenoic acid
(DHA, 22:6
D4,7,10,13,16,19
). Among the alga groups iden-
tified as producers of high levels of LCPUFAs, di-
atoms are able to produce and accumulate EPA and
DHA in triacylglycerols (TAGs) [3]. For biotechno-
logical applications, these organisms are regarded as
Keywords
desaturases; long chain polyunsaturated
fatty acids; sphingolipids; Thalassiosira
pseudonana; yeast expression
Correspondence
I. A. Graham, Department of Biology
(area 7), University of York, PO Box373, UK
Fax: +44 1904 328762
Tel: +44 1904 328750
E-mail:
Present addresses
*UMR 7139, CNRS-GOEMAR-UPMC,
Station Biologique, BP 74, 29682 Roscoff
cedex, France
College of Life Science, Sichuan University,
Chengdu, China
Note
The sequences reported in this paper have
been submitted to GenBank database under
the accession number AY817152 (TpdesO),

AY817153 (TpdesA), AY817154 (TpdesB),
AY817155 (TpdesI) and AY817156 (TpdesK)
(Received 13 March 2005, revised 22 April
2005, accepted 9 May 2005)
doi:10.1111/j.1742-4658.2005.04755.x
Analysis of a draft nuclear genome sequence of the diatom Thalassiosira
pseudonana revealed the presence of 11 open reading frames showing
significant similarity to functionally characterized fatty acid front-end
desaturases. The corresponding genes occupy discrete chromosomal loca-
tions as determined by comparison with the recently published genome
sequence. Phylogenetic analysis showed that two of the T. pseudonana
desaturase (Tpdes) sequences grouped with proteobacterial desaturases that
lack a fused cytochrome b5 domain. Among the nine remaining gene
sequences, temporal expression analysis revealed that seven were expressed
in T. pseudonana cells. One of these, TpdesN, was previously characterized
as encoding a D
11
-desaturase active on palmitic acid. From the six remain-
ing putative desaturase genes, we report here that three, TpdesI, TpdesO
and TpdesK, respectively encode D
6
-, D
5
- and D
4
-desaturases involved
in production of the health beneficial polyunsaturated fatty acid DHA
(docosahexaenoic acid). Furthermore, we show that one of the remaining
genes, TpdesB, encodes a D
8

-sphingolipid desaturase with strong preference
for dihydroxylated substrates.
Abbreviations
ARA, arachidonic acid; DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid; EST, expressed sequence tag; FAME, fatty acid methyl
ester; gDNA, genomic DNA; LCB, long chain base; LCPUFA, long chain polyunsaturated fatty acid; PUFAs, polyunsaturated fatty acids;
RACE, rapid amplification of cDNA ends; TAG, triacyglycerol; Tpdes, Thalassiosira pseudonana desaturase.
FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3401
potentially good sources for the cloning of genes enco-
ding the enzymes required for LCPUFA biosynthesis.
Different routes of LCPUFA synthesis have developed
in nature. The production of EPA and DHA in marine
bacteria and some marine fungi relies on anaerobic
polyketide synthase systems, which are encoded by sev-
eral large polypeptides [4]. More generally, biosynthe-
sis of these fatty acids requires aerobic desaturases and
elongases that catalyse a consecutive series of desatura-
tion and elongations of the fatty acyl chain to generate
EPA and DHA from a-linolenic acid (18:3
D9,12,15
).
Besides the main routes leading to DHA via D
6
-desatu-
ration, some algae display an alternate pathway for
C20-PUFA production involving a D
9
-elongase [5] and
a D
8
-desaturase [6].

To date, at least one enzyme corresponding to each
of the front-end desaturases and elongases necessary
to convert a-linolenic acid to EPA has been isolated
from diverse origins [7]. ‘Front-end’ desaturation can
be defined as desaturation between a pre-existing dou-
ble bond and the C-terminal end of a fatty acid, as
opposed to the much more prevalent (in plants)
methyl-directed desaturation. Reconstitution of EPA
biosynthesis has been achieved in yeast [8,9] and in
plants [10,11], with encouraging levels of C20-
LCPUFA production. Moreover, the D
4
-desaturase
gene encoding the last step in DHA biosynthesis has
recently been isolated from a number of marine organ-
isms [12–14]. The final elongation step [of C20 polyun-
saturated fatty acids (PUFAs) to C22] catalysed by a
D
5
-elongase was the last outstanding step remaining to
be functionally characterized at the molecular level.
Very recently, characterization of such an activity has
been described in the microalgae Pavlova lutheri [15],
Ostreococcus tauri and Thalassiosira pseudonana [16].
These novel fatty acid elongases were used to success-
fully reconstitute DHA synthesis in yeast. Therefore,
all the activities are now available to engineer plants to
produce this nutritionally important fatty acid. How-
ever, all these enzymes have been isolated from a
diverse array of organisms, for instance several marine

microalgal species. For the purposes of metabolic
engineering and in order to achieve optimal synthesis
in a heterologous host, it may be advantageous to use
a complementary set of desaturase and elongase
enzymes from the same organism. This may be partic-
ularly relevant for the metabolic engineering of a com-
pound such as DHA in a heterologous host such as
linseed which would require the introduction of three
desaturase and two elongase steps in order to convert
the endogenous fatty acid a-linolenic acid to DHA.
Gene discovery-based strategies such as targeted
expressed sequence tag (EST) databases or PCR
amplification using degenerate primers typically do not
provide sufficient coverage to enable identification of
complete sets of genes for a particular process from a
single organism. Bioinformatics-based analysis of com-
plete genome sequences potentially allow an exhaustive
approach to gene discovery from a single organism if
the process in question is sufficiently understood in
terms of enzymes and other proteins involved at the
biochemical level. Such a situation now exists for dis-
covery of genes involved in PUFA biosynthesis follow-
ing the completion of the genome sequence of the EPA
and DHA producing diatom T. pseudonana [17]. Levels
of EPA and DHA in this organism are in the range of
17 and 5%, respectively, when in the exponential phase
of growth [3]. Two elongases involved in LCPUFA
biosynthesis from T. pseudonana have been recently
characterized [16] and analysis of a draft genome
sequence of this organism prior to publication of the

complete genome sequence revealed the presence of a
family of putative front-end desaturases that are obvi-
ous candidates for enzymes involved in the synthesis of
EPA and DHA [18]. However, rather surprisingly, the
first of these genes to be functionally characterized was
found to encode a cytochrome b5 fusion desaturase
exhibiting D
11
-desaturase activity. Here we report the
cloning and characterization of the three desaturases
involved in DHA synthesis, i.e. a D
6
-, a D
5
- and a
D
4
-desaturase. Moreover, heterologous expression of
an additional cytochrome b5 fusion desaturase has
allowed the identification of a new D
8
-sphingolipid
desaturase from Thalassiosira.
Results
Phylogenetic and expression analysis of
T. pseudonana genes with similarity to front-end
desaturases
A recent phylogenetic analysis of the draft genome
sequence of T. pseudonana [18] reported the presence
of 12 sequences showing significant similarity to func-

tionally characterized front-end desaturases, i.e. a
fused cytochrome b5 binding domain at their N-termi-
nus and three histidine boxes [19]. Now that contigs
have been built for the entire genome and most
assigned to 24 nuclear chromosomes [17], we re-exam-
ined these 12 putative desaturase sequences based on
cDNA characterization and genome analysis. In our
previous analyses, two partial desaturase coding
sequences present near the ends of two distinct contigs
were designated as unique genes, TpdesB and TpdesD.
TpdesB encoded an N-terminus region and TpdesD
encoded a C-terminus region. Our subsequent cDNA
Microalgal front-end desaturases T. Tonon et al.
3402 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS
analysis of these sequences has revealed that they actu-
ally represent a single gene present on chromosome 4
that is from now on referred to as TpdesB. Compar-
ison of the full-length TpdesB cDNA with the genomic
sequence demonstrated that no introns are present in
the gene. The TpdesB ORF gives a predicted protein
of 493 amino acids. A further annotation update
relates to TpdesH which, based on EST sequence ana-
lysis, appears to contain three characteristic histidine
boxes but lacks the N-terminal cytochrome b5 domain.
TpdesL is a close homolog of TpdesH that also lacks
the cytochrome b5 domain. Both these genes share
higher overall sequence similarity with putative proteo-
bacterial desaturases that typically contain three histi-
dine boxes but also lack the cytochrome b5 fusion
domain; for this reason they were excluded from the

functional analysis described in this present study.
Based on information contained in the GenBank data-
base we have allocated 10 of the 11 T. pseudonana
Tpdes sequences to specific chromosomes (Fig. 1A).
These 10 Tpdes sequences are distributed among six of
the 24 chromosomes, with three sequences on chromo-
some 5, two on chromosomes 4 and 6, and one each on
chromosomes 3, 7 and 21. Material used to sequence
the T. pseudonana genome was derived from a single
diploid founder and this revealed the presence of two
haplotypes with on average 0.75% polymorphism at
the nucleotide level [17]. However, the Tpdes genes
occupy distinct chromosomal positions and therefore
even the pairings with highest sequence similarity such
AB
Fig. 1. Evolutionary relationship of T. pseudonana putative desaturases (TpDES) with known front end desaturases and expression analysis
of corresponding genes. T. pseudonana sequences were arbitrarily designated TpDESA to TpDESO. (A) The phylogenetic tree of TpDES and
functionally characterized front-end desaturases was established using the
PHYLIP 3.5c software package and based on 148 alignable amino
acid residues [18]. Percentage bootstrap values above 60 are indicated above the nodes. Chromosome location and availability of cDNAs for
each gene is shown after the gene name. (B) For RT-PCR based gene expression analysis, cells were harvested at various time of incubation
and growth stage monitored by measuring the percentage of nitrogen degraded (inset table). PCR analysis was performed with gene speci-
fic primers on undiluted (lane 1) and five-fold serial dilutions (lanes 2–4) of cDNA. Size of the expected cDNA amplified fragment is indicated
in brackets below the gene name. Inset PCR products from genomic DNA are shown in order to validate the TpdesG and TpdesM primer
pairs. M, DNA molecular size ladder.
T. Tonon et al. Microalgal front-end desaturases
FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3403
as TpdesO-TpdesM, TpdesN-TpdesG and TpdesH-
TpdesL are not due to haplotype variation.
The phylogenetic tree of TpDES sequences was

re-constructed with the updated Tpdes sequences noted
above in combination with front-end desaturases from
a range of organisms. The resulting tree shows three
major groupings containing TpDES sequences
(Fig. 1A). The first group, containing TpDESL,
TpDESH and four proteobacterial sequences, is char-
acterized by the lack of a fused cytochrome b5
domain. None of these genes have been functionally
characterized and we did not include TpDESL or
TpDESH in our functional analysis. The remaining
nine Tpdes genes show significant similarity to other
functionally characterized desaturases. As a first step
to characterizing the Tpdes genes we analysed temporal
expression analysis throughout the growth phases of
the algal cell culture using semiquantitative RT-PCR
(Fig. 1B). The second phylogenetic group contains
TpDESO, TpDESM, TpDESK, TpDESG and
TpDESN together with previously characterized
D
5
- and D
4
-desaturases. TpDESO and TpDESM group
with the diatom Phaeodactylum tricornutum D
5
-desatu-
rase PtDEL5 (Fig. 1A). Comparison of genomic
sequences of TpDESO and TpDESM showed 72%
identity, and one intron could be detected in each
sequence. RT-PCR analysis revealed that of these two

genes only TpdesO is transcribed (Fig. 1B). The
TpdesO ORF is 1425 bp long and encodes a protein of
474 amino acids. Alignment with the corresponding
genomic sequence confirmed the presence of a 99 bp
intron in the TpdesO gene. The amino acid sequence
of PtDEL5 and TpDESO exhibited 63% identity, sug-
gesting that TpDESO could catalyse the D
5
-desatura-
tion step in the PUFA biosynthetic pathway. The
TpDESK gene sequence forms a subgroup with func-
tionally characterized D
4
-desaturases from Thrausto-
chytrium sp. and Euglena gracilis (Fig. 1A). TpDESK
is expressed at a low level relative to TpdesO during
the exponential phase of growth. TpDESN and
TpDESG do not group with functionally characterized
front-end desaturases from other organisms. TpDESN
has already been characterized as a 16:0 specific
D
11
-desaturase [18]. Alignment of the TpdesG genomic
sequence with other desaturases showed that although
it contains a cytochrome b5 domain and three histidine
boxes a start methionine cannot be determined by
in silico analyses alone, indicating that it may represent
a pseudogene. RT-PCR based expression analysis sug-
gested that the gene is not expressed during the growth
phase and we have not investigated it further. In the

third major group, TpDESE, TpDESI, TpDESB and
TpDESA are separated on four branches (Fig. 1A).
The TpdesE ORF is incomplete in the draft genome
sequence in comparison to other desaturases, and
5¢-RACE experiments failed to produce full-length
cDNA for this gene despite the fact that it shows relat-
ively high mRNA expression levels throughout the
growth phases. TpdesI is similarly highly expressed and
the corresponding full length amino acid sequence has
70% sequence identity and groups with the Phaeod-
actylum tricornutum PtDEL6 D
6
-desaturase. TpdesI
contains an intron of 149 bp, and the corresponding
cDNA contains a 1455 bp ORF giving a predicted
polypeptide of 484 amino acids. The remaining two
TpDES sequences, TpDESB and TpDESA, showed
only 25% identity at the amino acid level. Comparison
of TpdesA genomic and cDNA sequences revealed that
the gene contains three introns of 84, 88 and 68 nucle-
otides. The 1548 bp cDNA of TpdesA gives a predicted
polypeptide of 515 amino acids. No function could be
predicted for these enzymes from comparison of their
primary structure with other front-end desaturases as
they do not cluster with any functionally characterized
desaturases with significant confidence.
Incorporation of intron presence and positional
information in genomic sequences does not shed any
further light on the phylogenetic relationship of the
cytochrome b5 containing T. pseudonana desaturase

genes. TpdesB and TpdesN do not contain introns,
TpdesK, TpdesO and TpdesI each have a single intron
and TpdesA contains three introns. Full-length cDNAs
are not available for TpdesG and TpdesE therefore
definite information on intron position is not available
for these two genes. Intron ⁄ exon junction is not con-
served between any pair of the Tpdes genes analyzed
and our analysis suggests that introns appear to have
evolved independently in each case.
Characterization of PUFAs front-end desaturases
To establish the function of the different putative
front-end desaturases, the full-length cDNAs of
TpdesA, TpdesB, TpdesI, TpdesK and TpdesO were
cloned into the vector pYES2, under the control of an
inducible galactose promoter, to produce the constructs
pYDESA, pYDESB, pYDESI, pYDESK and pYDES-
O. They were first expressed in the Saccharomyces cere-
visiae strain Invsc1 (or W303A1 for pYDESK).
Transformants were incubated in the presence of a
range of potential fatty acid substrates (18:2
D9,12
,
18:3
D9,12,15
, 20:2
D11,14
, 20:3
D11,14,17
, 20:3
D8,11,14

,
20:4
D8,11,14,17
, 22:4
D7,10,13,16
, 22:5
D7,10,13,16,19
) of desatu-
rases involved in the PUFA biosynthesis pathway.
After addition of such substrates, no new peaks were
detected for pYDESA and pYDESB, indicating that
Microalgal front-end desaturases T. Tonon et al.
3404 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS
these desaturases were not involved in production of
LCPUFAs. However, comparison of fatty acid profiles
derived from yeast transformed with pYES2 and
pYDESI showed two new peaks in the TpdesI trans-
formants even in the absence of exogenous fatty acids
in the medium. These new peaks corresponded to
16:2
D6,9
and 18:2
D6,9
(Fig. 2). These fatty acids are pro-
duced by D
6
-desaturation of 16:1
D9
and 18:1
D9

, respect-
ively, the two major fatty acids found in yeast. When
linoleic (18:2
D9,12
) and a-linolenic (18:3
D9,12,15
) acids
were added to the culture medium, 18:3
D6,9,12
and
18:4
D6,9,12,15
were detected (Fig. 2), confirming that
TpdesI encodes a D
6
-desaturase. Analysis of the fatty
acid composition in the pYDESI transformants after
6 days of incubation showed the percentage conversion
of the 16:1
D9
and 18:1
D9
substrates were 29 and 38%,
respectively. For the exogenous substrates 18:2
D9,12
and 18:3
D9,12,15
, TpDESI exhibited a slight preference
for the omega-3 fatty acid, as 68 and 80% of these
substrates were converted to their corresponding

D
6
-products.
Fatty acid profiling of extracts from TpDESO
S. cerevisiae transformants detected new peaks when
the culture medium was supplemented with 20:3
D8,11,14
and 20:4
D8,11,14,17
(Fig. 3A). These new FAMEs were
identified as 20:4
D5,8,11,14
(arachidonic acid, ARA) and
20:5
D5,8,11,14,17
(EPA), respectively. These results dem-
onstrate that pYDESO introduces a double bond at
position 5 from the C-terminus of 20:3
D8,11,14
and
20:4
D8,11,14,17
, indicating it is a D
5
-desaturase. Analysis
of cells harvested after incubation for 6 days in the
presence of both fatty acid substrates showed 16–19%
conversion of each to their corresponding D
5
fatty

acids, suggesting that pYDESO does not have a
Fig. 2. GC analysis of FAMEs from yeast transformed with the
empty plasmid pYES2 or the plasmid containing TpDESI. Yeast
cells transformed with either pYES2 (bottom chromatogram) or
pYDESI (top chromatogram) were induced for six days in the pres-
ence of 18:2
D9,12
and 18:3
D9,12,15
exogenously fed before sampling
for fatty acid analysis. New fatty acids are underlined. I.S., internal
standard (17:0). The experiment was repeated twice and results of
a representative experiment are shown.
Fig. 3. GC analysis of FAMEs from yeast transformed with the
empty plasmid pYES2 or the plasmid containing TpDESO. Yeast
cells transformed with either pYDESO (top chromatograms) or
pYES2 (bottom chromatograms) were induced for six days in the
presence of 20:3
D8,11,14
and 20:4
D8,11,14,17
(A), 20:3
D11,14,17
(B), and
20:2
D11,14
(C) exogenously fed before sampling for fatty acid analy-
sis. New fatty acids are underlined. The experiment was repeated
twice and results of a representative experiment are shown.
T. Tonon et al. Microalgal front-end desaturases

FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3405
preference for one substrate over the other. The Cae-
norabditis elegans D
5
-desaturase is capable of inserting
double bonds in a nonmethylene interrupted pattern
into 20:2
D11,14
and 20:3
D11,14,17
as well as in a methy-
lene interrupted pattern into fatty acids with a D
8
dou-
ble bond [20]. TpdesO transformants were incubated in
the presence of 20:3
D11,14,17
and 20:2
D11,14
to establish
if the T. pseudonana enzyme exhibited similar charac-
teristics. Profiling of extracts of TpdesO transformants
fed with 20:3
D11,14,17
and 20:2
D11,14
revealed the pres-
ence of new peaks in both corresponding to
20:4
D5,11,14,17

(juniperonic acid) and 20:3
D5,11,14
(podo-
carpic acid), respectively (Fig. 3B,C). The percentage
conversion of 20:2
D11,14
and 20:3
D11,14,17
to their D
5
-de-
saturated products was 4.7 and 8.4, respectively, which
was significantly less than the percentage conversion
determined for D
5
-desaturation of the D
8
-desaturated
fatty acids 20:3
D8,11,14
and 20:4
D8,11,14,17
.
Heterologous expression of TpDESK in S. cerevisiae
identified this enzyme as a D
4
-desaturase, as feeding of
transformants with 22:5
D7,10,13,16,19
resulted in the

appearance a new peak identified as 22:6
D4,7,10,13,16,19
(Fig. 4). The quantities of both D
4
-desaturated FAs
detected were low but significant, with a conversion
value of 3.0% for DHA. These were the only unique
peaks detected in the TpDESK transformants fed with
the full range of fatty acids compared to the empty
vector pYES2 controls.
Characterization of sphingolipid related front-end
desaturase(s)
Previous data have demonstrated that sphingolipid
long chain base (LCB) desaturases have a paralogous
relationship to front-end PUFA desaturases. To deter-
mine if any of the five T. pseudonana cytochrome b5
fusion candidate desaturases (TpdesA, TpdesB, TpdesI,
TpdesK and TpdesO) functioned as sphingolipid
desaturases, LCBs were extracted from S. cerevisiae
cells after galactose-induced expression of the heterolo-
gous gene. Total LCBs (i.e. both free LCBs and those
deacylated from sphingolipids) were extracted and ana-
lysed using previously reported methodology [21]. LCB
desaturation was determined by separation of deri-
vatized LCBs by HPLC and LC-MS as previously
described [22], with candidate T. pseudonana enzymes
tested for activity using both trihydroxy (i.e. phyto-
sphingosine) and dihydroxy (i.e. sphinganine) sub-
strates. Of the five candidate desaturases tested by
expression in S. cerevisiae, only one, TpdesB, displayed

any ability to desaturate sphingolipid LCBs, resulting
in the appearance of one additional (non-native) LCB
(Fig. 5). This activity was more pronounced when the
pYDESB plasmid was expressed in the yeast sur2D
mutant (which lacks the LCB C-4 hydroxylase Sur2p
and hence trihydroxylated LCBs, Fig. 5A), indicating
a preference for dihydroxylated substrates (Fig. 5C).
The molecular ion for the pYDESB-dependent LCB
had an m ⁄ z of 465, consistent with the identification of
this product as a dihydroxylated long chain base of 18
carbons, containing one double bond (data not
shown). The precise regiospecificity of the activity
encoded by TpdesB was further investigated by comi-
gration with authentic standards for desaturated
dihydroxy-LCBS. This indicated that the novel prod-
uct present on expression of pYDESB in sur2D was
not sphingosine (d18:1D
4t
) (Fig. 5D), but instead comi-
grated with the trans-isomer of d18:1D
8
(Fig. 5B) (as
determined by coinjection with LCBs resulting from
expression of the borage sphingolipid D8-desaturase in
sur2D 23,24);. Thus, TpdesB encodes a sphingolipid D
8
-
desaturase with strong preference for dihydroxylated
substrates. In addition, it appears that the TpDESB
desaturase differs from higher plant orthologs, since it

only synthesizes the trans stereoisomer of the D
8
-dou-
ble bond (Fig. 5C, cf. the stereo-unselective borage
Fig. 4. GC analysis of FAMEs from yeast transformed with the
empty plasmid pYES2 or the plasmid containing TpDESK. Yeast
cells transformed with either pYDESK (top chromatogram) or
pYES2 (bottom chromatogram) were induced for six days in the
presence of 22:5
D7,10,13,16,19
exogenously fed before sampling for
fatty acid analysis. New fatty acid is underlined. The experiment
was repeated twice and results of a representative experiment are
shown.
Microalgal front-end desaturases T. Tonon et al.
3406 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS
sphingolipid D
8
-desaturase, Fig. 5B). To provide fur-
ther evidence for the correct assignment of function of
TpdesB as a sphinganine D
8t
-desaturase, we examined
the sphingolipid LCB composition of T. pseudonana.
This indicated that the diatom sphingolipids are com-
posed predominantly of dihydroxylated C
18
-LCBs, of
which the majority are unsaturated: 76% dienine-con-
taining and 17% sphingenine-containing sphingolipids,

compared with 7% sphinganine-containing sphingoli-
pids. Thus, 93% of T. pseudonana LCBs contain one
or more double bonds.
Discussion
Using a combination of molecular cloning and bio-
informatics analysis of the available T. pseudonana
genome, we have been able to identify 11 putative
front-end desaturases. Two lacked cytochrome b5
fusion domain and grouped with functionally unchar-
acterized putative proteobacterial desaturases. Among
the remaining nine cytochrome b5 fusion domain con-
taining desaturase sequences, seven were shown to be
transcriptionally active in T. pseudonana cells based on
semiquantitative RT-PCR. We were unable to obtain a
full-length ORF for TpdesE due possibly to problems
of secondary structure in the mRNA. We previously
showed that despite having significant sequence similar-
ity, TpDESN actually encodes a D
11
-desaturase specific
for 16:0 and so cannot be considered as a member of
the front-end desaturase functional class [18]. Of the
five remaining sequences we expected that at least some
if not all of these would encode desaturases involved in
the biosynthesis of EPA and DHA from stearidonic
acid (18:4
D6,9,12,15
). According to the phylogenetic ana-
lysis, TpdesI, TpdesO and TpdesK were good candidates
for genes encoding D

6
-, D
5
- and D
4
-desaturases, respect-
ively. Results of heterologous expression in yeast of
these genes confirm these predictions. TpDESI introdu-
ces a double bond at position 6 from the C-terminus of
endogenous 16:1
D9
, 18:1
D9
and exogenous fatty acids
18:2
D9,12
and 18:3
D9,12,15
. Production of 16:2
D6,9
and
18:2
D6,9
from yeast fatty acids has already been
observed after transformation with D
6
-desaturase from
the oleaginous fungus Pythium irregulare [25], the moss
Physcomitrella patens [26], the diatoms P. tricornutum
[9] and higher plants [27]. The fatty acid profile of

T. pseudonana cells [18] suggests the existence of a
D
6
-desaturase that can act on 16:2
D9,12
to produce the
corresponding D
6
fatty acid 16:3
D6,9,12
. TpDESI is a
good candidate for this activity considering its broad
substrate specificity. However, we were unable to test
this hypothesis by direct feeding experiments as, to our
knowledge, 16:2
D9,12
is not commercially available.
TpDESO acts as a D
5
-desaturase on C20 fatty acids
to produce 20:4
D5,8,11,14
and 20:5
D5,8,11,14,17
as predicted
from the clustering of the gene in the phylogenetic tree.
This enzyme is also able to introduce a double bond in
a nonmethylene interrupted pattern at the D
5
-position

of 20:3
D11,14,17
and 20:2
D11,14
but at much lower effi-
ciency than the methylene interrupted pattern of activ-
ity with fatty acids containing a double bond at the
D
8
position. The C. elegans D
5
-desaturase was shown
to exhibit similar activities as found with TpDESO
[20]. The significance of this nonmethylene interrupted
pattern of activity in a biological context is not clear,
as the resulting fatty acids are considered to be ‘dead
end’ metabolites since they do not appear to act as
precursors for signalling molecules such as prostaglan-
dins and they are not present as a major fatty acid
component in T. pseudonana.
Of the three PUFA desaturases characterized in the
heterologous system, TpDESK exhibited the lowest
activity with only 3.0% of 22:5
D7,10,13,16,19
being
desaturated to DHA. Due to the low D
4
-desaturase
activity of TpDESK on what is likely to be the
Fig. 5. HPLC analysis of sphingolipid LCB profiles of yeast trans-

formed with TpdesB. Total LCBs were extracted from yeast sur2D
expressing pYDESB, derivatized and separated as described. (A)
LCB profile from yeast mutant sur2D which synthesizes only
dihydroxylated LCBs (e.g. d18:0 ¼ dihydroxylated 18 carbon LCB,
saturated). (B) LCB profile from sur2D yeast expressing the stereo-
unselective borage sphingolipid D
8
-desaturase: note the presence
of cis and trans D
8
-desaturated dihydroxylated LCBs (inset). (C)
LCB profile from sur2D yeast expressing pYDESB: note the pres-
ence of only the trans isomer of the D
8
-desaturated dihydroxylated
LCB. (D) The LCB profile of pYDESB was coinjected with a deriva-
tized authentic standard for sphingosine (d18:1
D4t
): note that
sphingosine does not coelute with the novel D
8t
-LCB which arises
from pYDESB expression.
T. Tonon et al. Microalgal front-end desaturases
FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3407
preferred substrate it is not possible to reach a conclu-
sion on the substrate preference of this enzyme for
omega-3 vs. omega-6 fatty acids with the current data.
TpDESI and TpDESO displayed almost no selectivity
between the omega-3 and omega-6 fatty acid sub-

strates, being equally active on both substrates. Inter-
estingly the D
6
-desaturase is more active than the
D
5
-desaturase which in turn is more active than the
D
4
-desaturase activity of TpDESK. It is not possible to
conclude if this has any significance as regards rate of
flux through these different enzymes in vivo as the
heterologous expression system could introduce arte-
facts with respect to overall activity. TpDESO and
TpDESI also exhibited additional activities with
TpDESO producing 16:2
D6,9
and 18:2
D6,9
and TpDESI
producing 20:3
D5,11,14
and 20:4
D5,11,14,17
. However,
none of these products were detected in extracts from
T. pseudonana cells [18].
An alternate pathway for PUFA desaturation has
been demonstrated in several lower eukaryotes [28]
and a gene encoding this enzyme has been isolated

from Euglena gracilis [6]. In this alternate pathway, a
front end D
8
-desaturase acts on 20:2
D11,14
(eicosadi-
enoic acid) and 20:3
D11,14,17
(eicosatrienoic acid) to
produce 20:3
D8,11,14
and 20:4
D8,11,14,17
. The E. gracilis
D
8
-desaturase is in the same subgroup as TpDESI and
TpDESE in the phylogenetic tree (Fig. 1). We have
functionally characterized TpDESI in the current work
but have been unable to characterize TpDESE. The
fact that we did not detect eicosadienoic acid in
T. pseudonana cells, and only very low level of eicos-
atrienoic acid were measured suggests the D
8
-desatu-
rase alternate pathway is not present in this organism.
Furthermore, acyl-CoA profiling of T. pseudonana
cells, did not detect 20:2
D11,14
or 20:3

D11,14,17
CoA
(Tonon et al. unpublished data). Therefore it is unli-
kely that TpdesE or any of the other Tpdes genes
encode a PUFA D
8
-desaturase.
As well as the three T. pseudonana cytochrome b5
fusion desaturases confirmed as front-end PUFA
desaturases, we have also identified a sphingolipid
D
8
-desaturase, TpDESB. This is the first example of a
sphingolipid long chain base D
8
-desaturase from a mar-
ine algal species. It has previously been observed that
this class of sphingolipid desaturase displays a paralo-
gous relationship to the PUFA desaturases, though the
evolutionary significance of this is still unclear [29]. In
that respect, the availability of the T. pseudonana gen-
ome sequence may provide further insights into the
ancestry of these cytochrome b5 fusion desaturases, not
least of all as this diatom represents the first example
of an organism which carries out both front-end
LCPUFA desaturation (up to and including the
synthesis of DHA) and sphingolipid D
8
-desaturation.
However, there are several subtle difference between

the TpDESB sphingolipid desaturases and the predom-
inant form of the enzyme found in higher plants.
Firstly, TpDESB has a strong preference for dihydrox-
ylated LCB substrates (i.e. sphinganine), whereas
almost all higher plant sphingolipid D
8
-desaturases dis-
play greater activity towards trihydroxylated LCBs (i.e.
phytosphingosine) [30]. A recent example of a higher
plant sphingolipid desaturase with activity towards
sphinganine was reported from Aquilegia vulgaris [24].
The introduction of the D
8
-desaturation into dihydroxy-
lated substrates may represent the first step in the syn-
thesis of sphingadienine-containing sphingolipids (i.e.
containing d18:2D
4t,8c ⁄ t
LCBs), by the subsequent
D
4
-desaturation of the D
8
-desaturated LCB. This bio-
synthetic route has been invoked to explain the absence
of sphingosine (i.e. D
4
-desaturated dihydroxysphingo-
sine) in many plant species, even though higher plant
LCB D

4
-desaturases are clearly present, as witnessed by
the high levels of sphinga-4,8-dienine present in plant
sphingolipids. Interestingly, we have detected a pre-
sumptive ortholog of the dihydrosphingosine D
4
-
desaturase [22] in the T. pseudonana genome sequence,
as well as the presence of sphingadienine LCBs
(Michaelson and Napier, unpublished data). It there-
fore seems likely that the biosynthesis of unsaturated
sphingolipids in T. pseudonana occurs in the manner
initially proposed for higher plants, i.e. via D
8
-desatura-
tion of dihydroxy substrates, followed by D
4
-desatura-
tion. This is in contrast to that reported for animal
systems (which lack a sphingolipid D
8
-desaturase),
where D
4
-desaturation occurs on an N-acylated dihy-
droxylated LCB (i.e. dihydroceramide) [31]. Although
TpDESA clustered closely to TpDESB, expression of
TpDESA in either wild-type or sur2D yeast strains
failed to reveal any activity as an LCB desaturase.
The second feature of TpDESB is that this is the

first cloned example of stereo-selective sphingolipid D
8
sphinganine desaturase; previous examples of the
higher plant sphingolipid desaturases with this regio-
specificity are stereo-unselective in terms of the double
bond introduced (i.e. a nonequal mixture of cis and
trans configurations), though a stereo-specific D
8t
phy-
tosphingosine desaturase has been reported from the
yeast Kluyveromyces lactis [32] (see Sperling and Heinz,
2003 [30] for an excellent review of the topic of LCB
desaturation). The enzymatic basis for this higher plant
stereo-unselective is currently unclear, but has been
hypothesized to result from a syn-elimination of two
vicinal hydrogen atoms from two different substrate
conformers, making this form of sphingolipid LCB
desaturation distinct from the D
4
-desaturation which
Microalgal front-end desaturases T. Tonon et al.
3408 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS
yields sphingosine [30]. In that respect, it is perhaps
surprising to find a more ‘precise’ form of stereo-speci-
fic LCB desaturation in the unicellular diatom T. pseu-
donana, which may be due to an as yet unknown role.
It is also currently unclear as to the role of sphingo-
lipid LCB D
8
-desaturation, though it has been hypo-

thesized to be involved in chilling tolerance in some
plant species and we have observed some variation in
T. pseudonana LCB profiles according to culture condi-
tions. Interestingly, the ratio of cis ⁄ trans forms of D
8
-
desaturated LCBs in higher plants varies according to
subcellular location, with a very much enhanced level
of D
8t
-LCBs found in plasma-membranes and deter-
gent-resistant membranes (lipid rafts) [33]. Our obser-
vation of a D
8t
-specific dihydroxy-LCB desaturase in
T. pseudonana may therefore provide an additional
tool with which to investigate the functionality and
importance of sphingolipid LCB heterogeneity [34].
In conclusion, this comprehensive study on the
T. pseudonana front-end desaturases demonstrates the
value of whole genome sequence for gene discovery
programmes. Whether the complete set of PUFA
desaturases from T. pseudonana represent valuable
tools for metabolic engineering of the PUFA biosyn-
thetic pathway into oil crops remains to be established.
The additional activities exhibited by the D
5
- and
D
6

-desaturases could prove problematic as it would be
preferable to limit the introduced enzymatic activities
to those essential for EPA and DHA production in
order to avoid the presence of additional fatty acids in
an end product. Nevertheless, this set of desaturases
along with the recently characterized D
5
-elongase from
the same organism represents an attractive biotechno-
logical resource. As highlighted in recent publications
[10], a critical issue for the development of a commer-
cially viable product will be the final yield of EPA and
DHA in the engineered vegetable oil and this will most
likely require the introduction of additional activities
such as acyltransferases and acyl-CoA synthetases [35].
Further mining of the T. pseudonana genome should
lead to identification of genes encoding these addi-
tional enzyme activities.
Experimental procedures
Cultivation of T. pseudonana, RNA extraction and
RT-PCR analysis of gene expression
T. pseudonana was cultivated as described previously [18].
Total RNA was extracted from cells harvested at different
stages of growth using an RNeasy plant mini kit (Qiagen,
Valencia, CA, USA). First-strand cDNA was synthesized
from three lg of DNAse treated RNA using a Prostar
First-strand RT-PCR kit (Stratagene, La Jolla, CA, USA).
PCR with primer pairs specific to each T. pseudonana
desaturase gene (Table 1) were performed using gDNA, or
undiluted and five-fold serial dilutions of cDNAs as fol-

lows: the reactions were heated to 95 °C for 5 min followed
by 35 cycles at 95 °C for 30 s, 30 s at temperatures ranging
between 50 and 70 °C according to the primer pair used
and 72 °C for 2 min, then a single step at 72 °C for 10 min.
The 18S rRNA gene was used to ensure that the same
quantity of cDNA was used for PCR on the different RNA
samples. Aliquots of PCR reactions were electrophoresed
through a 1% agarose gel. Identity of the diagnostic frag-
Table 1. Primers used in this study. Sequence of the primers is given in the 5¢ to 3¢ orientation. Restriction site used for cloning in the yeast
plasmid pYES2 are in bold.
Gene name Forward Reverse
RT-PCR
18S rRNA GGTAACGAATTGTTAG GTCGGCATAGTTTATG
TpdesA GAGAGGAAGTTCCGTCCTTG CAACGCAATCAATGAACGC
TpdesB GTATGGATGCTACCGATG TGAATGTACAGATTGAACCT
TpdesE GAGTTGATGAAGACATTGCG CTCCAACTGGTATTGCATTC
TpdesG GATACTTCTTCATCTTGCACG CATATCTGAAGTGTGAGCG
TpdesI GAGAATGCCAAGTTGGAG TGTTGCAACACTTCCACGG
TpdesK GTGTGAGTTATGGAACGAAG CTACTCACACTTGGCTTTAC
TpdesM GATTCATCCGTATCATAATAGTAAG TGGAACCTATGCCACCAC
TpdesN GTGAGAGCACTAACCAAGCTT CAATCAGTAGGCTTCGTCG
TpdesO GATGAAGGCTGTTGGAAAG CATCATCCTCAATGCAACGG
Yeast expression
TpdesA GCGGGTACCATGGCTAGAGCTGTTTGGGCATTG GCGGAGCTCTCACGTGTACATGAAAGC
TpdesB GCGGGTACCATGGCTCCACCCTCCATCAAAGAC GCGGAGCTCCTATCCCTGAGCACACAT
TpdesI GCGGGATCCACCATGGCTGGAAAAGGAGGAGAC GCGAATTCTTACATGGCAGGGAAATC
TpdesK GGGATCCATGGGCAACGGCAACCTCCCAG GGTCTAGACTACTCACACTTGGCTTTACC
TpdesO CCCAAGCTTACCATGGCTCCCCCCAACGCCGAT GCTCTAGATTAGGCACTTCCAGACAA
T. Tonon et al. Microalgal front-end desaturases
FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3409

ment for TpdesO, TpdesM, TpdesN and TpdesG was veri-
fied by sequencing after cloning in the pGEM-T EasyVec-
tor (Promega, Madison, WI, USA).
5¢- and 3¢-RACE experiment
The GeneRacer
TM
kit (Invitrogen, Carlsbad, CA, USA)
was used to reverse transcribe T. pseudonana RNA and
cDNA was used to amplify the 5¢-end of TpdesE and the
3¢-end of the TpdesB gene. Fragments generated by nested
PCR were cloned into the pGEM-T EasyVector (Promega)
and sequenced.
Functional characterization of T. pseudonana
putative front-end desaturases in Saccharomyces
cerevisiae
cDNA of the entire desaturase coding region was synthes-
ized from T. pseudonana RNA using the SuperScript
TM
III
RNase H
–
Reverse Transcriptase (Invitrogen) or the
Enhanced Avian Reverse Transcriptase (Sigma) and gene
specific primers pairs (Table 1). Forward primers for
TpdesA, TpdesB, TpdesI and TpdesO gene were designed to
contain an alanine codon (GCT) just downstream of the
start codon not present in the original algal sequences.
Presence of a G at position +4 has been shown to improve
translation initiation in eukaryotic cells [36]. In the case of
TpDesK, activity was detected in S. cerevisiae when a full

length cDNA that did not contain the alanine codon was
used. The Expand High Fidelity PCR system (Roche, Indi-
anapolis, IN, USA) was employed to minimize potential
PCR errors. The amplified product was gel purified and
restricted with KpnI and SacI for TpdesA and TpdesB,
EcoRI and BamHI for TpdesI, HindIII and XbaI for
TpdesO, and BamHI and XbaI for TpdesK. Each desaturase
fragment was then cloned into the corresponding sites
behind the galactose-inducible GAL1 promoter of pYES2
(Invitrogen) to yield the plasmids pYDESA, pYDESB, pY-
DESI, pYDESO, and pYDESK. The fidelity of the cloned
PCR product was checked by sequencing. The vectors con-
taining the T. pseudonana sequences were then transformed
into S. cerevisiae strain Invsc1 (Invitrogen) (or W303A1 for
pYDESK) by a lithium acetate method. Transformants
were selected on minimal medium plates lacking uracil.
In order to monitor LCBs sphingolipids synthesis,
pYDESA, pYDESB, pYDESI, pYDESO, and pYDESK
were also transformed into the yeast mutant sur2D (Euro-
scarf, />index.html). As a positive control for the sphingolipid
D
8
-desaturation of LCBs in both WT and sur2D mutant,
the yeast expression construct containing the borage D
8
-
desaturase was used, as described previously [23,24].
For PUFA feeding experiment, individual transformants
were grown at 25 °C in the presence of 2% (w ⁄ v) raffinose
and 1% (w ⁄ v) Tergitol NP-40 (Sigma, St Louis, MO,

USA). Expression of the transgene was induced at D
600
¼
0.2–0.3 by supplementing galactose to 2% (w ⁄ v). At that
time, the appropriate fatty acids were added to a final con-
centration of 50 lm. Incubation was carried out at 25 °C
for 3 days and then 15 °C for another 3 days. For the co-
feeding experiment, the same conditions were applied,
except that both substrates were added to 25 lm final con-
centration. Each feeding experiment was repeated twice,
and FA analysis was carried out on triplicate samples.
For functional characterization of Tpdes genes in the
sur2D background, cultures were grown at 22 °C with sha-
king in the presence of 2% (v ⁄ v) raffinose and induction
was carried out as previously described [37]. All cultures
were then grown for a further 48 h unless indicated. All
analysis was performed on triplicate samples and replicated
three times.
Fatty acid analysis
Microalgae or yeast cells were harvested by centrifugation.
Total fatty acids were extracted and transmethylated as
previously described [14]. Fatty acid methyl esters (FAMEs)
of methyl pentadecanoate (15:0) or methyl heptadecanoate
(17:0) were included as internal standards to enable quanti-
fication. PUFA FAMEs were identified by comparing chro-
matographic traces with transmethylated commercial
Menhaden oil (Supelco, Gillingham, Dorset, UK), and by
identification of picolinyl ester and dimethyl disulphide
adduct structures by GCMS as previously described [18].
Sphingoid base analysis

Sphingolipid analysis of yeast cells was carried out essen-
tially as described previously [21]. LCBs were liberated
from yeast cells by alkaline hydrolysis and extracted with
chloroform ⁄ dioxane ⁄ water (6 : 5 : 1, v ⁄ v ⁄ v). The LCB frac-
tion was converted to dinitrophenol derivatives, extracted
with chloroform ⁄ methanol ⁄ water (8 : 4 : 3, v ⁄ v ⁄ v), purified
by TLC on silica plates and analysed by reversed-phase
HPLC using an Agilent 1100 LC system, with MS analysis
carried out on a Thermoquest LCQ system with an APCI
source. Standards were obtained from Matreya Inc. USA,
or using previously authenticated in vivo synthesized LCBs
[23,24].
Acknowledgements
Financial support for this work was provided by the
Department for Environment, Food and Rural Affairs
grant no. NF 0507 and the EU Sixth Framework Pro-
gramme Integrated Project LipGene (Contract FOOD-
CT-2003–505944). RQ is a visiting scholar from
Microalgal front-end desaturases T. Tonon et al.
3410 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS
Sichuan University of China supported by the China
Scholarship Council, grant no. CSC 22851086.
Rothamsted Research receives grant-aided support
from the Biological Sciences and Biotechnology
Research Council (BBSRC) UK.
References
1 Hanisak MD (1998) Seaweed cultivation: global trends.
World Aquaculture 29, 18–21.
2 Anonymous (2000) The State of World Fisheries and
Aquaculture. Food and Agriculture Organization of the

United Nations, Rome, Italy.
3 Tonon T, Harvey D, Larson TR & Graham IA (2002)
Long chain polyunsaturated fatty acid production and
partitioning to triacylglycerols in four microalgae. Phy-
tochemistry 61, 15–24.
4 Metz JG, Roessler P, Facciotti D, Levering C, Dittrich F,
Lassner M, Valentine R, Lardizabal K, Domergue F,
Yamada A et al. (2001) Production of polyunsaturated
fatty acids by polyketide synthases in both prokaryotes
and eukaryotes. Science 293, 290–293.
5 Qi B, Beaudoin F, Fraser T, Stobart AK, Napier JA &
Lazarus CM (2002) Identification of a cDNA encoding
a novel C18-Delta(9) polyunsaturated fatty acid-specific
elongating activity from the docosahexaenoic acid
(DHA)-producing microalga, Isochrysis galbana. FEBS
Lett 510, 159–165.
6 Wallis JG & Browse J (1999) The Delta8-desaturase of
Euglena gracilis: an alternate pathway for synthesis of
20-carbon polyunsaturated fatty acids. Arch Biochem
Biophys 365, 307–316.
7 Sayanova O & Napier JA (2004) Eicosapentaenoic acid:
biosynthetic routes and the potential for synthesis in
transgenic plants. Phytochemistry 65, 147–158.
8 Beaudoin F, Michaelson LV, Hey SJ, Lewis MJ,
Shewry PR, Sayanova O & Napier JA (2000) Heterolo-
gous reconstitution in yeast of the polyunsaturated fatty
acid biosynthetic pathway. Proc Natl Acad Sci USA 97,
6421–6426.
9 Domergue F, Lerchl J, Za
¨

hringer U & Heinz E (2002)
Cloning and functional characterization of Phaeodacty-
lum tricornutum front-end desaturases involved in eico-
sapentaenoic acid biosynthesis. Eur J Biochem 269,
4105–4113.
10 Abbadi A, Domergue F, Bauer J, Napier JA, Welti R,
Za
¨
hringer U, Cirpus P & Heinz E (2004) Biosynthesis
of very-long-chain polyunsaturated fatty acids in trans-
genic oilseeds: constraints on their accumulation. Plant
Cell 10, 2734–2748.
11 Qi B, Fraser T, Mugford S, Dobson G, Sayanova O,
Butler J, Napier JA, Stobart AK & Lazarus C (2004)
Production of very long chain polyunsaturated omega-3
and omega-6 fatty acid in plants. Nat Biotech 22, 1–7.
12 Qiu X, Hong H & MacKenzie SL (2001) Identification
of a Delta 4 fatty acid desaturase from Thraustochy-
trium sp. involved in the biosynthesis of docosahexanoic
acid by heterologous expression in Saccharomyces cere-
visiae and Brassica juncea. J Biol Chem 276, 31561–
31566.
13 Meyer A, Cirpus P, Ott C, Schlecker R, Za
¨
hringer U &
Heinz E (2003) Biosynthesis of docosahexaenoic acid in
Euglena gracilis: Biochemical and molecular evidence
for the involvement of a D4-fatty acyl group desaturase.
Biochemistry 42, 9779–9788.
14 Tonon T, Harvey D, Larson TR & Graham IA (2003)

Identification of a very long chain polyunsaturated fatty
acid D4-desaturase from the microalga Pavlova lutheri.
FEBS Lett 553, 440–444.
15 Pereira SL, Leonard AE, Huang Y-S, Chuang L-T &
Mukerji P (2004) Identification of two novel microalgal
enzymes involved in the conversion of the x3-fatty acid,
eicosapentaenoic acid, into docosahexaenoic acid. Bio-
chem J 384, 357–366.
16 Meyer A, Kirsch H, Domergue F, Abbadi A, Sperling P,
Bauer J, Cirpus P, Zank TK, Moreau H, Roscoe TJ
et al. (2004) Novel fatty acid elongase and their use for
the reconstitution of docosahexaenoic acid biosynthesis.
J Lipid Res 45, 1899–1909.
17 Armbrust EV, Berges JA, Bowler C, Green BR, Marti-
nez D, Putnam NH, Zhou S, Allen AE, Apt KE, Bech-
ner M et al. (2004) The genome of the diatom
Thalassiosira pseudonana: ecology, evolution, and meta-
bolism. Science 306, 79–86.
18 Tonon T, Harvey D, Qing R, Li Y, Larson TR & Gra-
ham IA (2004) Identification of a fatty acid A
¨
11-desa-
turase from the microalga Thalassiosira pseudonana.
FEBS Lett 563, 28–34.
19 Sperling P, Ternes P, Zank TK & Heinz E (2003) The
evolution of desaturases. Prostaglandins Leukot Essent
Fatty Acids 68, 73–95.
20 Watts JL & Browse J (1999) Isolation and characteriza-
tion of a delta5-fatty acid desaturase from Caenorhabdi-
tis elegans. Arch Biochem Biophys 362, 175–182.

21 Sperling P, Za
¨
hringer U & Heinz E (1998) A sphingoli-
pid desaturase from higher plants: identification of a
new cytochrome b5 fusion protein. J Biol Chem 273,
28590–28596.
22 Garton S, Michaelson LV, Beaudoin F, Beale MH &
Napier JA (2003) The dihydroceramide desaturase is
not essential for cell viability in Schizosaccharomyces
pombe. FEBS Lett 538, 192–196.
23 Sperling P, Libisch B, Za
¨
hringer U, Napier JA & Heinz
E (2001) Functional identification of D
8
-sphingolipid
desaturase from Borago officinalis. Arch Biochem
Biophys 388, 293–298.
24 Michaelson LV, Longman AJ, Sayanova O & Napier JA
(2002) Isolation and characterization of a cDNA
T. Tonon et al. Microalgal front-end desaturases
FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS 3411
encoding a Delta8 sphingolipid desaturase from Aquile-
gia vulgaris. Biochem Soc Trans 30, 1073–1075.
25 Hong H, Dalta N, Reed DW, Covello PS, MacKenzie
SL & Qiu X (2002) High-level production of c-linolenic
acid in Brassica juncea using a D6 desaturase from
Pythium irregulare. Plant Physiol 129, 354–262.
26 Girke T, Schimdt H, Za
¨

hringer U, Reski R & Heinz E
(1998) Identification of a novel D6-acyl-group desaturase
by targeted gene disruption in Physcomitrella patens.
Plant J 15, 39–48.
27 Sayanova O, Davies GM, Smith MA, Griffiths G,
Stobart AK, Shewry PR & Napier JA (1999) Accumula-
tion of D
6
-unsaturated fatty acids in transgenic tobacco
plants expressing a D
6
-desaturase from Borago
officinalis. J Exp Bot 50, 1647–1652.
28 Pereira SL, Leonard AE & Mukerji P (2003) Recent
advance in the study of fatty acid desaturases from ani-
mals and lower eukaryotes. Prostaglandins Leukot
Essent Fatty Acids 68, 97–106.
29 Napier JA, Michaelson LV & Dunn TM (2002) A new
class of lipid desaturase central to sphingolipid bio-
synthesis and signalling. Trends Plant Sci 7, 475–478.
30 Sperling P & Heinz E (2003) Plant sphingolipids: struc-
tural diversity, biosynthesis, first genes and functions.
Biochim Biophys Acta 1632, 1–15.
31 Merrill AH Jr & Sweeley CC (1996) Biochemistry of
Lipids, Lipoproteins and Membranes (Vance DE &
Vance J, eds), pp. 309–339. Elsevier Science B.V.,
Amsterdam, the Netherlands.
32 Takakuwa N, Kinoshita M, Oda Y & Ohnishi M (2002)
Isolation and characterization of the genes encoding
D

8
-sphingolipid desaturase from Saccharomyces kluyveri
and Kluyveromyces lactis. Curr Microbiol 45, 459–461.
33 Borner GH, Sherrier DJ, Weimar T, Michaelson LV,
Hawkins ND, Macaskill A, Napier JA, Beale MH, Lil-
ley KS & Dupree P (2005) Analysis of detergent-resis-
tant membranes in Arabidopsis: evidence for plasma
membrane lipid rafts. Plant Physiol 137, 104–116.
34 Dunn TM, Lynch DV, Michaelson LV & Napier JA
(2004) A post-genomic approach to understanding
sphingolipid metabolism in Arabidopsis thaliana. Ann
Bot Lond 93, 483–497.
35 Tonon T, Qing R, Harvey D, Li Y, Larson TR &
Graham IA (2005) Identification of a long-chain poly-
unsaturated fatty acid acyl-coenzyme A synthetase from
the diatom Thalassiosira pseudonana. Plant Physiol 138,
402–408.
36 Kozak M (1987) An analysis of 5¢-noncoding sequences
from 699 vertebrate messenger RNAs. Nucleic Acids
Res 15, 8125–8148.
37 Michaelson LV, Lazarus CM, Griffiths G, Napier JA &
Stobart AK (1998) Isolation of a delta5-fatty acid desa-
turase gene from Mortierella alpina. J Biol Chem 273,
19055–19059.
Microalgal front-end desaturases T. Tonon et al.
3412 FEBS Journal 272 (2005) 3401–3412 ª 2005 FEBS