Tài liệu Báo cáo khoa học: Mapping the functional domain of the prion protein docx

Mapping the functional domain of the prion protein
Taian Cui
1
, Maki Daniels
2
, Boon Seng Wong
3
, Ruliang Li
3
, Man-Sun Sy
3
, Judyth Sassoon
1
and David R. Brown
1,2
1
Department of Biology and Biochemistry, University of Bath, UK;
2
Department of Biochemistry, Cambridge University, UK;
3
Institute of Pathology, Case Western Reserve University School of Medicine, Cleveland, Ohio, USA
Prion diseases such as Creutzfeldt–Jakob disease are pos-
sibly caused by the conversion of a normal cellular glyco-
protein, the prion protein (PrP
c
) into an abnormal isoform
(PrP
Sc
). The process that causes this conversion is unknown,
but to understand it requires a detailed insight into the
normal activity of PrP

c
. It has become accepted from results
of numerous studies that PrP
c
is a Cu-binding protein and
that its normal function requires Cu. Further work has
suggested that PrP
c
is an antioxidant with an activity like
that of a superoxide dismutase. We have shown in this
investigation that this activity is optimal for the whole
protein and that deletion of parts of the protein reduce or
abolish this activity. The protein therefore contains an active
domain requiring certain regions such as the Cu-binding
octameric repeat region and the hydrophobic core. These
regions show high evolutionary conservation fitting with
the idea that they are important to the active domain of
the protein.
Keywords: copper; Creutzfeldt–Jakob disease; oxidative
stress; scrapie; superoxide dismutase.
Neurodegenerative diseases are a major threat to human
health. One group of disease termed prion diseases [1,2]
make up a small percentage of all human neurodegenerative
diseases. Prion diseases have become a major concern
because of the possibility that one particular from, variant
Creutzfeldt–Jacob disease (vCJD), might arise through
transmission of an animal disease, such as bovine spongi-
form encephalopathy [3], to humans [4]. Other prion
diseases include the sheep disease scrapie [5] and inherited
forms such as Gerstmann–Stra

¨
ussler–Scheinker syndrome
[6]. All of these disease are linked together because of the
deposition of an abnormal, protease-resistant isoform of the
prion protein in brains of individuals with these diseases.
This abnormal form of the protein (PrP
Sc
) is also suggested
to be the infectious agent in the disease on the basis of
infection studies [2].
PrP
Sc
is generated from the normal cellular isoform of the
prion protein (PrP
c
) which is present in the brain as a cell
surface glycoprotein [7]. Each form has distinct properties
[8]. Therefore understanding the basis of prion disease
revolves around understanding how the normal protein is
converted to the abnormal isoform. This conversion
involves a switch in conformation from a structure rich in
a helices to one rich in b-sheet [9]. Although there have been
many studies with PrP
Sc
the study of PrP
c
has been limited
until recently. As an evolutionarily conserved glycoprotein
[10] it has been postulated that PrP
c

has an important
function. Nevertheless, knockout mice for PrP
c
show no
gross changes in terms of development or behaviour [11]
but cannot be infected with mouse-passaged scrapie [12]. In
contrast to this biochemical and cell biological studies have
suggest that PrP-knockout mice have compromised cellular
resistance to oxidative stress [13,14].
The first clue to the molecular function of PrP
c
came from
studies that show PrP
c
to be a Cu-binding protein [15–20].
The main Cu-binding site of the protein was shown to be
within a conserved octameric repeat region, rich in histidine,
located in the N terminus [10]. PrP
c
binds up to four atoms
of Cu at these sites with a possible fifth binding site located
elsewhere in the molecule [16,18,21]. Cellular expression of
PrP
c
also facilitates Cu uptake by neurones [22] and
increased extracellular Cu causes an increased turnover of
PrP
c
[23]. Binding of Cu to the protein influences its ability
to interact with other proteins such as plasminogen [24] and

glycosaminoglycans [25].
Knockout of PrP
c
causes a decrease in cellular resistance
of neurones to oxidative stress [13,14,26]. This has lead to
suggestions that PrP
c
might be an antioxidant. Immuno-
depletion of PrP
c
from the brain extracts leads to a
reduction in superoxide dismutase (SOD) activity within
the extract [27]. Studies with both recombinant protein and
native protein purified from the brains of mice suggest that
PrP
c
can act as a SOD [17,28]. This activity is high and
requires specific binding of Cu to the octameric repeats.
Binding of Cu elsewhere in the protein, or Cu simply to a
peptide based on the octameric repeats does not result in
this activity [28]. Cellular resistance to oxidative stress is
influenced by the PrP
c
protein and the amount of Cu bound
to it [17]. Allelic differences in mouse PrP
c
have also been
shown to influence the level of the activity of the protein, as
protein with the sequence of the mouse ÔbÕ allele is more
Correspondence to D. R. Brown, Department of Biology and Bio-

chemistry, University of Bath, Calverton Down, Bath, BA2 7AY, UK.
Fax: +44 1225 826779, Tel.: +44 1225 323133,
E-mail:
Abbreviations: CJD, Creutzfeldt–Jacob disease; vCJD, variant
Creutzfeldt–Jacob disease; PrP
c
, prion protein; PrP
Sc
,abnormal
isoform of prion protein; rPrP, recombinant mouse prion protein;
SOD, superoxide dismutase.
(Received 28 April 2003, revised 5 June 2003, accepted 11 June 2003)
Eur. J. Biochem. 270, 3368–3376 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03717.x
active than that based of the sequence of the ÔaÕ allele [29]. In
contrast, PrP
Sc
, which binds almost no Cu has no detectable
SOD activity [30,31].
Proteins that are enzymes normally have active sites that
are essential for the enzymatic activity. In this study we used
both a panel of highly specific antibodies and a series of
deletion mutants of recombinant PrP to determine which
regions of the protein are necessary for the SOD activity.
We determined that the active site consists of two domains.
The first includes the Cu-binding domain and the second
includes the conserved hydrophobic domain in the middle
of the protein. Additionally, the C terminus of the protein is
important for this activity.
Experimental methods
Production of recombinant protein

Production of recombinant mouse prion protein (rPrP) has
been described previously [28]. Briefly, PCR amplified
product was cloned in the expression vector, pET-23
(Novagen) and transformed into Escherichia coli
AD
494(DE3). The expressed proteins were recovered from
urea solubilized, sonicated bacterial lysate after using immo-
bilized nickel-based affinity chromatography (Invitrogen).
The eluted material was refolded by several successive rounds
of dilution in either deionized water or 1 m
M
CuSO
4
fol-
lowed by ultrafiltration and dialysis to remove unbound Cu.
The final protein was typically >95% pure and was concen-
trated to 1–2 mgÆmL
)1
. Its identity was confirmed by
N-terminal sequencing and Western blotting using the poly-
clonal antibody to mouse PrP (DR1). Protein concentration
was determined using the Sigma BCA protein assay reagent.
Mutagenesis
Deletion mutants of the rPrP were prepared using a PCR
based mutagenesis procedure involving paired oligonucleo-
tides to either insert an additional restriction site or to delete
a proportion of the gene sequence. Mutagenesis was
confirmed by DNA sequencing. The mouse PrP ORF was
inserted between the Nde1site(5¢)andtheXho1site(3¢). An
additional Xho1 site was inserted either after codon 171, or

codon 112. Removal of an Xho1fragmentbyenzymatic
digestion and subsequent ligation created the deletion
mutants PrP23–112 and PrP23–171. A similar procedure
was used to produce PrP45–231, PrP90–231, PrP105–231
and PrP113–231. In this case an Nde1 site was inserted
before codon, 45, 90, 105 and 113, respectively. Paired
primers were also used in mutagenesis experiments to
generate deletions of codons 35–45 (PrPD34–45), 112 to136
(PrPD112–136) and 135–150 (PrPD135–150). The oligo-
nucleotides used in these mutagenesis experiments are listed
in Table 1. Other prion protein mutations generated in a
similar way were as described previously [28,32,33]. Protein
for these deletion mutants was expressed, purified and
refolded as described above for wild-type protein.
SOD assays
SOD-like activity of recombinant PrP (1 lgÆmL
)1
)was
determined using the xanthine/xanthine oxidase/nitro-blue
tetrazolium (NBT) assay as described before [28]. This
assay uses superoxide production from xanthine oxidase
and xanthine and detection of a coloured formazan
product formed from nitro-blue tetrazolium at 560 nm.
The SOD-like activity was expressed as percentage inhibi-
tion of formazan produced where 100% formazan product
formation is the amount of nitro-blue tetrazolium reduced
by xanthine oxidase-formed radicals in control reactions
without brain extracts or affinity-purified PrP. All assays
were performed in triplicate. The proteins used were tested
for their ability to reduce nitro-blue tetrazolium in the

absence of xanthine oxidase. None of the proteins showed
any reduction of nitro-blue tetrazolium to form formazan
as measured spectrophotometrically for 5 min. Also,
xanthine oxidase was driven to reduce nitro-blue tetra-
zolium aerobically by the addition of 50 l
M
xanthine to the
reaction mixture. A second gel-based assay was also used
to detect SOD activity. Proteins (5–20 lg) were electro-
phoresed on a 7% polyacrylamide gel without SDS or
reducing agents. After electrophoresis, the gel was soaked
in a solution of 5 m
M
nitro-blue tetrazolium at room
temperature with rocking for 20 min The gel was then
rinsed briefly with distilled water and a developing solution
(30 l
M
riboflavin, 30 m
M
tetramethylethylenediamine,
40 m
M
potassium phosphate pH 7.8) for 15 min. At this
point the gel was exposed to the light until a uniform blue
colour covered the gel. Protein with SOD reactivity leaves
the gel transparent. However, if the reaction was allowed
to proceed indefinitely the contrast between these regions
would be lost.
Western blotting

Purified proteins were electrophoresed on a 15% polyacryl-
amide gel in the presence of SDS and reducing agents.
Proteins were blotted onto polyvinylidene fluoride (PVDF)
membrane and protein detected by a specific polyclonal
(DR1) or monoclonal (DM3) antibody as described previ-
ously [32]. This allowed verification of the size and identity
of these proteins.
Table 1. Mutagenesis oligonucleotides. Only forward oligonucleotides
are listed. The reverse oligonucleotide of the splint pair had the com-
plementary sequence.
Prion protein
generated Oligonucleotide
PrP23–112
GCATGTGGCAGGGCTCGAGGCAGCTGGGGC
PrP23–171 GCAACCAGCTCGAGTTCGTGCACG
PrP45–231 GGGAAGCCATATGGGCAACCG
PrP90–231 GCCCCATGGCGGTGGATGGCATATGGGAGG
GGGTACCC
PrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC
TCAAGC
PrP113–231 CCAACCTCAAGCATATGGCAGGG
PrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCC
PrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCC
PrPD112–136 CCAACCTCAAGCATGTGATGATCCATTTTGGC
PrPD135–150 GCGCCGTGAGCGAAAACATGTACCGC
Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3369
CD spectroscopy
CD spectra were recorded for prion proteins and peptides
using a Jasco J-810 spectropolarimeter, calibrated with
ammonium d-camphor-10-sulfonate by a method similar to

that described previously [27]. Protein solutions were
prepared to contain 2 mgÆmL
)1
in 10 m
M
sodium phos-
phate pH 7.4. These samples were measured in cuvettes of
1 mm or 0.5 mm pathlength (Hellma). The spectrum from
190 nm to 250 nm was analysed with step resolution of
0.5 nm at a temperature of 23 °C. Five scans were averaged
and the buffer background was subtracted. Spectra are
presented as molar ellipticity (h).
Results
Antibody inhibition of PrP SOD-like activity
A panel of highly specific monoclonal antibodies and
polyclonal antisera were generated against mouse PrP and
have been described previously [32,34–36]. The epitopes of
these antibodies have been mapped and are listed in
Table 2. The activity of wild-type PrP is like that of a SOD
and this activity can be measured by a number of assays.
The most robust and accessible method for such a study
uses spectrophotometric analysis. We used an assay based
on formazan production from nitro-blue tetrazolium by
superoxide generated by xanthine oxidase and xanthine.
SOD activity inhibits formazan production in the assay by
breaking down superoxide. This assay was used to measure
the activity of wild-type PrP. A concentration of
0.5 lgÆmL
)1
PrP was found to inhibit 70% of the

formazan production in the assay. This concentration was
used in further experiments in which antibodies or antisera
were added in conjunction with PrP to the SOD assay. The
results of these experiments are shown in Fig. 1. Several of
the antibodies and antisera caused a concentration-
dependent inhibition of the SOD-like activity of PrP. The
ability of the antibodies and antiserum to inhibit the SOD-
like activity of PrP is sumarized in Table 2. Antibodies and
antisera are listed according to the epitope to which they
bind. It can be clearly seen that the antibodies and antisera
that inhibit PrP’s activity are clustered around two parts of
the protein. The first cluster is in the N terminus. The
second cluster is focused on the hydrophobic domain,
residues 112–145. Two antibodies that bind to the C
terminus also had a minor inhibitory effect on the SOD-
like activity of PrP.
Production of deletion mutants of PrP
On the basis of the results with antibodies, a series of PrP
mutants were made to assess whether deletions of certain
domains of the protein decrease the SOD-like activity of the
protein. The domains deleted were based on the epitopes of
the antibodies that had a clear effect on SOD-like activity of
PrP. The mutants used in the study include the complete
N- and C-terminal fragments (PrP23–112 and PrP113–231),
deletions of the octameric repeat region (PrPD51–89,
PrPD67–89), deletions of the hydrophobic domain
(PrPD112–119, PrP112–136, PrP135–150), deletions of parts
of the N terminus (PrP90–231, PrP45–231, PrPD35–45, PrP)
and deletions of the C-terminal domain (PrP23–171). These
proteins are illustrated in Fig. 2. A number of these proteins

have been studied [28,32]. The identity of the proteins was
verified by Western blot with specific antibodies (Fig. 3).
SOD-like activity of PrP deletion mutants
The activity of the PrP mutant proteins were compared to
that of the wild-type recombinant PrP using two assays that
have been widely used to detect SOD activity. An in-gel
assay (Fig. 4) and a spectrophotometric assay (Fig. 5)
detected high levels of activity in wild-type protein. How-
ever, most of the mutations tested showed either no activity
or reduced activity. A summary of these findings is shown in
Table 3. Some results from previously published work are
included for completeness. The in-gel assay showed visually
that wild-type PrP has strong activity while the mutants
PrPD35–45, PrP23–171, PrPD112–119 and PrP45-231 had
reduced activity. PrPD112–136 had no activity. The spec-
trophotemetric assay was performed (Fig. 5) with increasing
concentrations of protein from all the mutants. It should be
kept in mind that for mutants with large deletions the
concentration of 5 lgÆmL
)1
represents a higher molar
concentration than wild-type protein. However, these
proteins except for PrP23–171 were inactive in the assay.
All mutants lacking the octameric repeat region were
inactive. Most of the mutants with small deletions showed
some activity except PrPD112–136. This mutant was
completely inactive. Of considerable interest was the mutant
PrP23–171 which despite a lack of a large amount of the C
terminus did show some activity. To test the stability of this
activity a time-course study was carried out to compare the

activity of this protein to wild-type PrP. The proteins were
Table 2. Epitopes of antibodies and antisera used in the investigation of
PrP activity. Numbers relate to the amino acid residue sequence of
mouse prion protein. ÔConformationalÕ implies antibodies that bind to
the C terminus of the protein (145–231). The affinity of these anti-
bodies is sensitive to the conformation adopted by the protein.
Antibody
name Epitope
Ability to
Inhibit Activity
5B2 35–52 + +
8B4 34–45 + +
DR3 37–53 + +
DM1 68–84 + + +
DR1 89–103 + +
DR2 94–109 –
5C3 90–145 –
11G5 115–130 + + +
DM2 121–136 + +
7H6 130–140 + +
DM3 142–160 +
2G8 149–165 –
2C2 153–165 –
8H4 175–185 –
6H3 Conformational –
9H7 Conformational –
7A9 Conformational +
1C10 Conformational +
3370 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003
added to the assay mixture at time zero and the activity

measured for 60 s. After this time the activity of the protein
was measured repeatedly at regular intervals for the next
hour (Fig. 5D). Where as wild-type PrP maintained its
activity over the hour, PrP23–171 lost the majority of its
activity over the same time period.
CD analysis of PrP mutants
In order to determine if deletion of critical regions of PrP
caused loss of activity because of structural alterations, the
deletion mutants were studied using CD spectroscopy. The
spectra produced are shown in Fig. 6. Of key interest were
those with minimal deletions of protein sequence which
caused significant reduction in activity of the protein. The
majority of the deletion mutations did not cause significant
changes in the structure of PrP. As suggested from previous
publications the N terminus (PrP23–112) showed a spec-
trum typical of a random coil (Fig. 6E). All other spectra
demonstrated predominantly helical content. Interestingly,
PrP23–171, which has deletions of two of the helical
domains of the PrP protein, also possessed a high content of
helical structure.
Activity domains of PrP
This body of research has provided two sets of results
concerning regions of the prion sequence necessary for its
100010010
0
20
40
60
80
100

120
5B2
8B4
DM1
5C3
11G5
DM2
DM3
C
[Antibody] in ng/ml
% Control SOD-like Activity
100010010
0
20
40
60
80
100
7H6
2G8
2C2
8H4
6H3
9H7
7A9
1C10
B
[Antibody] in ng/ml
% Control SOD-like Activity
100010010

0
20
40
60
80
100
DR3
DR1
DR2
A
Antiserum Dilution
% Control SOD-like Activity
Fig. 1. Antibodies. The activity of wild-type recombinant mouse PrP
was tested using a spectrophotometric assay based on the conversion
of nitro-blue tetrazolium to a coloured formazan product by super-
oxide generated from xanthine oxidase. PrP (0.5 lgÆmL
)1
)wasusedin
the assay which inhibited the reaction by 70% (see Fig. 5). Anti-
bodies and antisera were then tested for ability to block the effect of
PrP. PrP activity in the presence of the antibodies was expressed as a
percentage of the activity of PrP alone. Thus, decreased percentage of
control activity indicates inhibition of PrP. (Top) Effect of three
antisera of equivalent titre. Middle and bottom graphs show effects of
15 monoclonal antibodies. Shown are the mean and SEM of at least
three experiments.
PrP23-231
PrP23-112
PrP23-171
PrP45-231

PrP90-231
PrP105-231
PrP113-231
PrP∆35-45
PrP∆51-89
PrP∆51-67
PrP∆112-119
PrP∆112-136
PrP∆135-151
23 231
23 112
171
45
90
105
113
35
51 89
67
119
136
135 150
231
231
231
231
231
231
231
231

231
231
112
112
51
45
23
23
23
23
23
23
Fig. 2. Mutant proteins. Mutants of PrP were prepared using PCR-
based mutatagenesis and restriction digestion/ligation. The mutations
were deleted in parts of the protein that would possibly reduce the
activity of PrP based on results shown in Fig. 1 and Table 2. Schematic
locations of the deletions as compared with the wild-type protein are
shown by a space within the grey bar next to the name of the protein.
Numbers refer to the amino acid residues in the mouse PrP sequence.
Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3371
function. Results of the use of antibodies on wild-type
protein and deletion mutants indicate the relative
importance of these domains to PrP’s SOD-like activity.
Comparison of data presented in Tables 2 and 3
indicates that there are principally two domains that
are necessary for this activity. The first is the Cu-binding
domain otherwise known as the octameric repeat region.
The second is the hydrophobic domain in the centre of
the molecule. A third domain in the N-terminal region
before the Cu-binding domain also has a strong influence

on activity. Further analysis indicates that the C terminus
influences the activity to some extent but is not essential.
Collectively, these results suggest that the activity of PrP
c
requires N- and C-terminal domains which might interact
to form the active site. These results are summarized in
Fig. 7.
Fig. 3. Western blotting. Wild-type mouse PrP and nine of the deletion
mutants described were electrophoresed on a 15% polyacrylamide gel
and transferred to a membrane. PrP was detected by using the antisera
DR1 which detects all of the mutants shown. 1, Wild-type PrP;
2, PrP23–231; 3, PrP23–171, 4; PrPD35–45; 5, PrPD135–150;
6, PrPD112–119; 7, PrP90–231; 8, PrPD51–89; 9, PrP45–231;
10, PrPD112–136.
Fig. 4. In-gel assay. An in-gel assay was used to provide a visual
demonstration of the SOD-like activity of wild-type PrP and some of
the active mutants. Five lg protein was electrophoresed on a native
polyacrylamide gel and stained for SOD-like activity. 1, Wild type PrP
protein; 2, PrPD35–45; 3, PrPD112–136; 4, PrP23–171; 5 PrPD112–119;
6, PrP45–231.
706050403020100
0
20
40
60
80
100
D
Time in minutes
% Zero Time Value

100101.1.01
0
20
40
60
80
100
B
[Protein] in µg
% Inhibition of
Formazan Production
100101.1.01
0
20
40
60
80
100
A
[Protein] in µg
% Inhibition of
Formazan Production
100101.1.01
0
20
40
60
80
100
C

[Protein] in µg
% Inhibition of
Formazan Production
Fig. 5. Activity of deletion mutants. The nitro-blue tetrazolium/xan-
thine/xanthine oxidase assay for SOD activity was used to assess the
affect of deletions on the activity of recombinant PrP. (A) Wild-type
PrP (d), PrP23–171 (s), PrP45–231 (h), PrP90–231 (j) PrP23–112 (s)
and PrP105–231 (n). (B) Wild-type PrP (d), PrP113–231 (s),
PrPD35–45 (h), PrPD51–89 (j)PrPD67–89 (s). (C) Wild-type PrP (d),
PrPD112–119 (s), PrPD135–150 (h), PrPD112–136 (j). Shown are
the mean and and standard errors for at least three separate experi-
ments. (D) The activity of wild-type PrP (d) and PrP23-171 (s)were
recorded over time. One lg protein was added to the nitro-blue tetra-
zolium/xanthine oxidase assay mixture and measured for SOD-like
activity in terms of inhibition of formazan production. From this zero
time point the SOD-like activity was remeasured 5, 15, 30, 45 and
60 min later. Results are expressed as a percentage of the time zero
value at 560 nm. Shown are the mean and SEM for at least three
separate experiments.
Table 3. Relative activity of PrP deletion mutants. Activity relative to
the wild-type PrP is indicated by the number of + signs: +++++,
activity equivalent to wild type; –, no activity. Recombinant protein is
not glycosylated but native protein has equivalent activity to recom-
binant protein [17]. Reactive cleavage of the disulfide bond has been
shown to decrease the activity of PrP [48].
PrP deletion mutant Relative activity
PrP23-112 –
PrP23-171 + +
PrP45-231 + + +
PrP90-231 –

PrP105-231 –
PrP113-231 –
PrPD35–45 + +
PrPD51–89 –
PrPD67–89 –
PrPD112–119 + +
PrPD112–136 –
PrPD135–150 ++++
No disulfide bridge + + +
Glycosylation +++++
3372 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Discussion
The prion protein is a Cu-binding protein. Early estimates
of the affinity of Cu for PrP
c
suggested that binding of Cu
was within the micromolar range [15,16]. Assessment of
PrP
c
-mediated Cu uptake suggested that PrP
c
influences Cu
distribution within the nanomolar range [22]. The implica-
tion of this is an affinity between Cu and PrP
c
in the
nanomolar range or lower. Recent studies have also
suggested that the affinity of Cu for PrP
c
could be in the

femtomolar range [18]. Despite these inconsistencies, the
conclusion that PrP
c
is a Cu-binding protein is widely
accepted. The implication of this is that PrP
c
is somehow
involved in Cu metabolism. Cu in the body is tightly linked
to redox chemistry and regulation of the balance between
the use of oxygen in respiration and possible oxidative
damage. Thus, without further consideration PrP
c
is
implicated in regulation of cellular resistance to oxidative
stress. However, there is also considerable evidence that
PrP
c
is an antioxidant [14]. This was first suggested in 1995
[13]. Much of this evidence comes from studies of PrP
knockout mice. Changes including electrophysiological
parameters [37] and altered sleeping patterns [38] in PrP
knockout mice have been linked to loss of antioxidant
protection [39,40]. PrP knockout mice are also more
susceptible to kindling agents [41]. The effect of such agents
is related to the induction of oxidative stress [14]. Cultured
cells are also more susceptible to oxidative stress when they
lack PrP
c
expression [13,24,42,43]. PC12 cells expressing
increased levels of PrP

c
are more resistant to oxidative stress
[44]. These findings were further clarified when it was shown
that recombinant and native PrP
c
can act as superoxide
dismutase [17,28]. Subsequently it has been shown that this
activity is dependent of the Cu binding of the protein [45].
Transfection of cells to express PrP
c
increases their ability to
reduce intracellular levels of oxidants [43]. Depletion of PrP
c
from cells reduces their total superoxide dismutase activity
[27]. Loss of PrP
c
expression by cells is compensated for by
specific up-regulation of other SODs including manganese
SOD [46] and extracellular SOD [14]. Therefore there is a
strong body of evidence linking PrP
c
to SOD-like activity.
Although some scepticism about the antioxidant function of
PrP
c
remains [47,48], there are sufficient data to consider
this as a potentially important enzymatic function of this
protein.
Data presented in this work verifies the previous findings
that PrP

c
is a SOD. Two separate assays confirm this
suggestion. That the recombinant protein was effective in
the in-gel assay also verifies that the protein is not a weak
SOD-like protein but one with equivalent catalytic ability to
that of cytoplasmic Cu/Zn SOD. The specific activity of PrP
has been shown previously to be about 10-fold less than that
of Cu/Zn SOD [28]. However, this Cu/Zn SOD is widely
recognized as a very potent catalyst given its ability to
catalyse a reaction that would spontaneously occur in
minutes or less, in the presence of sufficient concentration of
superoxide, in the absence of the enzyme [49].
Analyses of domains in this protein necessary for the
SOD-like activity used both deletion mutants and antibod-
ies that recognized known epitopes. In particular antibodies
DM1 and 11G5 showed the strongest inhibition of the
250245240235230225220215210205200195190
-14
-12
-10
-8
-6
-4
-2
0
2
E
Wavelength in nm
Molar Elipticity ( )
θθ

θθ
250245240235230225220215210205200195190
-6
-4
-2
0
2
4
6
8
G
Wavelength in nm
Molar Elepticity ( )
θθ
θθ
250245240235230225220215210205200195190
-3
-2
-1
0
1
2
3
H
Wavelength in nm
250245240235230225220215210205200195190
-8
-6
-4
-2

0
2
4
6
8
B
Wavelength in nm
250245240235230225220215210205200195190
-8
-6
-4
-2
0
2
4
6
8
D
Wavelength in nm
250245240235230225220215210205200195190
-6
-4
-2
0
2
4
6
8
F
Wavelength in nm

250245240235230225220215210205200195190
-6
-4
-2
0
2
4
6
8
C
Wavelength in nm
Molar Elipticity ( )
θθ
θθ
250245240235230225220215210205200195190
-8
-6
-4
-2
0
2
4
6
8
A
Wavelength in nm
Molar Elipticity ( )
θθ
θθ
Molar Ell ipticity (θθ

θθ
)Molar Ellipticity (θθ
θθ
)Molar Ellipticity (θθ
θθ
)Molar Ellipticity (θθ
θθ
)
Fig. 6. CD of PrP mutants. Wild-type and mutant PrPs were studied
by CD spectroscopy. (A) Wild-type PrP. (B) PrPD35–45. (C)
PrPD112–119. (D) PrP51–89. (E) PrP23–112. (F) PrPD135–150. (G)
PrPD112–136. (H) PrP23–171. Spectra are shown as molar ellipticity
(h).
s
s
Necessary Domains
123
231 252
51 90 112 145 178 213
N N
35
Minor Domain
Important Domain Important Domain
Signal Sequence
Octameric Repeats Hydrophobic Domain
GPI Anchor Signal
Fig. 7. Summary. This schematic diagram, based on the results from
all experiments, shows those regions of the PrP protein necessary for
the SOD-like activity with Cu bound. Black bars are essential for
activity; grey bars show those regions that also play a role but are not

essential; hatched bar indicates that the C-terminal part of PrP cor-
responding to the last two helices can also influence the activity of the
protein but are not essential.
Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3373
protein’s activity of suggesting that both the octameric
repeat region and the hydrophobic domain were critical for
the activity of the protein. This was confirmed by deletion
mutations that showed lack of SOD-like activity when
these regions were deleted. Experiments using three other
antibodies binding near the residues 35–45 also suggested
that this region was important. Deletion of these residues
confirmed this finding. Assays using the antibodies 7H6
and DM3 also indicated that residues 130–160 might also
play a role in the activity. However deletion of residues
135–150 had no affect at all on the activity suggesting this
domain is not involved in the activity of the protein. This
deletion also served as a good negative control showing
that deletion of part of PrP need not inhibit the SOD-like
activity if it is made outside the domains essential for this
activity.
Inhibition of activity by two antibodies that were sensitive
to the conformation of the C terminus indicated that the
conformation of the C terminus is important to the activity
of the protein. Deletion of the whole C terminus rendered
the protein inactive but surprisingly deletion of only the last
two helices (PrP23–171) did not lead to inactive protein.
Further analysis indicated that this mutant was labile in its
activity and rapidly lost activity when continually exposed
to superoxide. This mutant was highly soluble and con-
tained surprisingly high helical content. One possibility is

that the N terminus of the protein does not contain a totally
unordered structure when associated with at least one helix
of the C terminus. This would contradict findings from
NMR studies suggesting there is no structure in the N
terminus [50]. We have also observed the lack of regular
secondary structure along the N terminus with CD analysis
but again this might be different when associated with other
domains of the protein. Our findings concerning the
C-terminal domain support what was shown previously.
Preventing the formation of the disulfide bridge in the last
two helices reduces the activity of PrP [51]. Thus, although
these regions are not essential for the manifestation of the
activity they are important to maintaining that activity.
Further evidence for this comes from work with the
different mouse alleles of the protein. It was found that
protein generated from the mouse ÔbÕ allele has higher
activity from that of the ÔaÕ allele [29]. These alleles differ
only in two amino residues one of which is residue 189 in the
second helix.
That the octameric repeat region of the protein is
necessary for SOD function is clear from the fact that this
is the main Cu-binding region of the protein. Although it
has been suggested that Cu binds elsewhere in the
molecule [18,21] it is not clear if this occurs in vivo and
may only occur under nonphysiological conditions or
when the N-terminal region has been cleaved off. How-
ever, PrP90–231 which is equivalent to the protein studied
by Jackson et al.[18]alsolackedSODactivity.Thus,if
Cu does bind elsewhere in the protein this is not relevant
to the protein’s antioxidant activity. Deletion of only part

of the octameric repeat region renders the protein inactive.
This confirms previous suggestions that binding only one
atom of Cu is not sufficient for significant SOD-like
activity of the protein [17]. The importance of residues
35–45 is currently unknown. However, it might be that
this region of the protein interacts with other regions of
the protein, possibly to bring the Cu-binding domain into
proximity with the hydrophobic domain or the C-terminal
globular domain. This interpretation is supported by our
earlier findings that there are interactions between the
N terminus and the C terminus of PrP. Binding of a
monocolonal antibody to an epitope located between
residues 35 and 45 prevented the binding of another
monoclonal antibody that reacts with a conformational
epitope in the C terminus [52].
Analysis of the evolutionary conservation of the prion
protein among mammals clearly shows that all three critical
domains (residues 35–45, 51–89, 112–136) are extremely
highly conserved. Indeed, the region 112–126 is identical in
all mammals, birds and reptiles so far sequenced [10,53,54].
Therefore this report indicating that residues 112–136
constitute part of the functional domain of the protein
provides a plausible explanation for the high evolutionary
conservation of this region. Other research has shown the
importance of this region in PrP neurotoxicity [55,56] as a
binding site for PrP ligands [57,58].
There are already several reports that link oxidative
stress to prion disease [59–63]. Also, changes in the
essential metalloelements in the brains of patients with
CJD and experimental mouse scrapie have also been noted

[28,29]. These findings suggest that changes in Cu meta-
bolism and redox balance occur in prion diseases. The
exact nature of these changes is far from clear. However,
there is evidence that loss of Cu binding to PrP and
consequently, loss of PrP’s antioxidant activity occur early
in the course of prion disease [31]. The relevance of the
findings presented here are therefore quite important in
determining the changes that PrP undergoes during the
course of prion disease and the possible role of the loss of
its function to the disease. It is known that the hydropho-
bic domain spanning amino acids 112–136 form a critical
site in the protein at which the protein gains b-sheet
content [64]. This region also spans the site at which
normal metabolic cleavage occurs [65]. Deletion of this
region inhibits conversion of the protein to PrP
Sc
in
infected cells [66]. The importance of this region to the
function of the protein explains its evolutionary conserva-
tion. Conversion of this site to one that forms b-sheet and
facilitates aggregation of the protein is known to prevent
cleavage of the protein [67] and abolish antioxidant activity
[31]. Furthermore, interaction between this site on PrP
c
and PrP
Sc
or the neurotoxic peptides such as PrP106–126
also inhibits the antioxidant activity of PrP
c
[31] or cause

the protein to change conformation [67].
In summary we have provided an insight into regions of
PrP
c
critical to its normal antioxidant activity. We have
shown that regions outside the octameric repeat region are
necessary for this activity. These data suggest that a key
domain in PrP
c
that is involved in structural conversion of
the protein to PrP
Sc
may be conserved in evolution because
of its importance to this function.
Acknowledgements
Thanks to Dr Laurie Irons for assistance with CD measurements. This
work was supported by a fellowship from the BBSRC of the UK to
DRB.
3374 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003
References
1. Prusiner, S.B. (1982) Novel proteinaceous infectious particles
cause scrapie. Science 216, 136–144.
2. Prusiner, S.B. (1998) Prions. Proc.NatlAcad.Sci.USA95,
13363–13383.
3. Hope, J., Reekie, L.J., Hunter, N., Multhaup, G., Beyreuther, K.,
White,H.,Scott,A.C.,Stack,M.J.,Dawson,M.&Wells,G.A.
(1988) Fibrils from brains of cows with new cattle disease contain
scrapie-associated protein. Nature 336, 390–392.
4. Will, R.G., Ironside, J.W., Zeidler, M., Cousens, S.N., Estibeiro,
K.,Alperovitch,A.,Poser,S.,Pocchiari,M.,Hofman,A.&

Smith, P.G. (1996) A new variant of Creutzfeldt-Jakob disease in
the UK. Lancet 347, 921–925.
5. Rubenstein, R., Merz, P.A., Kascsak, R.J., Carp, R.I., Scalici,
C.L., Fama, C.L. & Wisniewski, H.M. (1987) Detection of scra-
pie-associated fibrils (SAF) and SAF proteins from scrapie-
affected sheep. J. Infect. Dis. 156, 36–42.
6. Hsiao, K. & Prusiner, S.B. (1990) Inherited human prion diseases.
Neurology 40, 1820–1827.
7. Stahl, N., Borchelt, D.R., Hsiao, K. & Prusiner, S.B. (1987)
Scrapie prion protein contains a phosphatidylinositol glycolipid.
Cell 51, 229–240.
8. Meyer, R.K., McKinley, M.P., Bowman, K.A., Braunfeld, M.B.,
Barry, R.A. & Prusiner, S.B. (1986) Separation and properties of
cellular and scrapie prion proteins. Proc.NatlAcad.Sci.USA83,
2310–2314.
9. Pan, K.M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A.,
Groth, D., Mehlhorn, I., Huang, Z., Fletterick, R.J., Cohen, F.E.
& Prusiner, S.B. (1993) Conversion of alpha-helices into beta-
sheets features in the formation of the scrapie prion proteins. Proc.
NatlAcad.Sci.USA90, 10962–10966.
10. Wopfner, F., Wiedenho
¨
fer, G., Schneider, R., von Bunn, A.,
Gilch,S.,Schwarz,T.F.,Werner,T.&Scha
¨
tzl, H.M. (1999)
Analysis of 27 mammalian and 9 avian PrPs reveals high con-
servation of flexible regions of the prion protein. J. Mol. Biol. 289,
1163–1178.
11. Bu

¨
eler,H.,Fischer,M.,Lang,Y.,Bluethmann,H.,Lipp,H P.,
DeArmond, S.J., Prusiner, S.B., Aguet, M. & Weissmann, C.
(1992) Normal development and behaviour of mice lacking the
neuronal cell-surface PrP protein. Nature 356, 577–582.
12. Bu
¨
eler, H., Aguzzi, A., Sailer, A., Greiner, R.A., Autenried, P.,
Aguet, M. & Weissmann, C. (1993) Mice devoid of PrP are
resistant to scrapie. Cell 73, 1339–1347.
13. Brown, D.R., Schmidt, B. & Kretzschmar, H.A. (1996) Role of
microglia and host prion protein in neurotoxicity of a prion pro-
tein fragment. Nature 380, 345–347.
14. Brown, D.R., St. Nicholas, R., J. & Canevari, L. (2002) Lack of
prion protein expression results in a neuronal phenotype sensitive
to stress. J. Neurosci. Res. 67, 211–224.
15. Hornshaw,M.P.,McDermott,J.R.,Candy,J.M.&Lakey,J.H.,
(1995) Copper binding to the N-terminal repeat region of
mammalian and avian prion protein: structural studies
using synthetic peptides. Biochem. Biophys. Res. Comm. 214,
993–999.
16. Brown, D.R., Qin, K., Herms, J.W., Madlung, A., Manson, J.,
Strome, R., Fraser, P.E., Kruck, T., von Bohlen, A., Schulz-
Schaeffer, W., Giese, A., Westaway, D. & Kretzschmar, H.
(1997a) The cellular prion protein binds copper in vivo. Nature
390, 684–687.
17. Brown, D.R., Clive, C. & Haswell, S.J. (2001) Anti-oxidant
activity related to copper binding of native prion protein.
J. Neurochem. 76, 69–76.
18. Jackson, G.S., Murray, I., Hosszu, L.L., Gibbs, N., Waltho, J.P.,

Clarke, A.R. & Collinge, J. (2001) Location and properties of
metal-binding sites on the human prion protein. Proc. Natl Acad.
Sci. USA 98, 8531–8535.
19. Viles, J.H., Cohen, F.E., Prusiner, S.B., Goodin, D.B., Wright,
P.E. & Dyson, H.J. (1999) Copper binding to the prion protein:
Structural implications of four identical cooperative binding sites.
Proc.NatlAcad.Sci.USA96, 2042–2047.
20. Aronoff-Spencer, E., Burns, C.S., Avdievich, N.I., Gerfen, G.J.,
Peisach, J., Antholine, W.E., Ball, H.L., Cohen, F.E., Prusiner,
S.B. & Millhauser, G.L. (2000) Identification of the Cu
2+
binding
sites in the N-terminal domain of the prion protein by EPR and
CD spectroscopy. Biochemistry 39, 13760–13771.
21. Cereghetti,G.M.,Schweiger,A.,Glockshuber,R.&VanDoor-
slaer, S. (2001) Electron Paramagnetic Resonance Evidence for
Binding of Cu
2+
to the C-terminal Domain of the Murine Prion
Protein. Biophys. J. 81, 516–525.
22. Brown, D.R. (1999) Prion protein expression aids cellular uptake
and veratridine-induced release of copper. J. Neurosci. Res. 58,
717–725.
23. Pauly, P.C. & Harris, D.A. (1998) Copper stimulates endocytosis
of the prion protein. J. Biol. Chem. 273, 33107–33110.
24. Ellis, V., Daniels, M., Misra, R. & Brown, D.R. (2002)
Plasminogen activation is stimulated by prion protein and
regulated in a copper-dependent manner. Biochemistry 41, 6891–
6896.
25. Pan,T.,Wong,B.S.,Liu,T.,Li,R.,Petersen,R.B.&Sy,M.S.

(2002) Cell surface prion protein interacts with glycosamino-
glycans. Biochem. J. 368, 81–90.
26. Brown, D.R., Schultz-Schaeffer, W.J., Schmidt, B. & Kretzsch-
mar, H.A. (1997) Prion protein-deficient cells show altered
response to oxidative stress due to decreased SOD-1 activity. Exp.
Neurol. 146, 104–112.
27. Wong,B.S.,Pan,T.,Liu,T.,Li,R.L.,Gambetti,P.&Sy,M.S.
(2000) Differential contribution of superoxide dismutase activity
by prion protein in vivo. Biochem. Biophys. Res. Commun 273,
136–139.
28.Brown,D.R.,Wong,B.S.,Hafiz,F.,Clive,C.,Haswell,S.&
Jones, I.M. (1999) Normal prion protein has an activity like that of
superoxide dismutase. Biochem. J. 344, 1–5.
29. Brown, D.R., Iordanova, I.M., Wong, B S., Ve
´
nien-Bryan, C.,
Hafiz, F., Glasssmith, L.L., Sy, M S., Gambetti, P., Jones, I.M.,
Clive, C. & Haswell, S.J. (2000) Functional and structural differ-
ences between the prion protein from two alleles prnp
a
and prnp
b
of mouse. Eur. J. Biochem. 267, 2452–2459.
30. Wong, B S., Chen, S.G., Colucci, M., Xie, Z., Pan, T., Liu, T.,
Li, R., Gambetti, P., Sy, M S. & Brown, D.R. (2001a) Aberrant
metal binding by prion protein in human prion disease. J. Neuro-
chem. 78, 1400–1408.
31. Thackray, A.M., Knight, R., Haswell, S.J., Bujdoso, R. & Brown,
D.R. (2002) Metal imbalance and compromised antioxidant
function are early changes in prion disease. Biochem. J. 362,

253–258.
32. Brown, D.R. (2000) PrP
Sc
-like prion protein peptide inhibits the
function of cellular prion protein. Biochem. J. 352, 511–518.
33. Daniels, M., Cereghetti, G.M. & Brown, D.R. (2001) Toxicity of
novel C-terminal prion protein fragments and peptides harbouring
disease-related C-terminal mutations. Eur. J. Biochem. 268,
6155–6164.
34. Pan,T.,Li,R.,Wong,B.S.,Liu,T.,Gambetti,P.&Sy,M S.
(2002) Heterogeneity of normal prion protein in two-dimensional
immunoblot: presence of various glycosylated and truncated
forms. J. Neurochem. 81, 1092–1101.
35. Liu,T.,Zwingman,T.,Li,R.,Pan,T.,Wong,B.S.,Petersen,R.B.,
Gambetti,P.,Herrup,K.&Sy,M.S.(2001)Differentialexpres-
sion of cellular prion protein in mouse brain as detected with
multiple anti-PrP monoclonal antibodies. Brain Res. 896, 118–129.
Ó FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3375
36. Zanusso,G.,Liu,D.,Ferrari,S.,Hegyi,I.,Yin,X.,Aguzzi,A.,
Hornemann, S., Liemann, S., Glockshuber, R., Manson, J.C.,
Brown, P., Petersen, R.B., Gambetti, P. & Sy, M.S. (1998) Prion
protein expression in different species: analysis with a panel of new
mAbs. Proc.NatlAcad.Sci.USA95, 8812–8816.
37. Collinge, J., Whittington, M.A., Sidle, K.C., Smith, C.J., Palmer,
M.S., Clarke, A.R. & Jefferys, J.G. (1994) Prion protein is
necessary for normal synaptic function. Nature 370, 295–297.
38. Tobler, I., Gaus, S.E., Deboer, T., Achermann, P., Fischer, M.,
Ru
¨
licke, T., Moser, M., Oesch, B., McBride, P.A. & Manson, J.C.

(1996) Altered circadian activity rhythms and sleep in mice devoid
of prion protein. Nature 380, 639–642.
39. Hu
¨
ber, R., Deboer, T. & Tobler, I. (2002) Sleep deprivation in
prion protein deficient mice sleep deprivation in prion protein
deficient mice and control mice: genotype dependent regional
rebound. Neuroreport 13,1–4.
40. Curtis,J.,Errington,M.,Bliss,T.,Voss,K.&Macleod,N.(2003)
Age-Dependent Loss of PTP and LTP in the hippocampus of PrP-
null Mice. Neurobiol. Dis. 13, 55–62.
41. Walz, R., Amaral, O.B., Rockenbach, I.C., Roesler, R., Izquierdo,
I.,Cavalheiro,E.A.,Martins,V.R.&Brentani,R.R.(1999)
Increased sensitivity to seizures in mice lacking cellular prion
protein. Epilepsia 40, 1679–1682.
42. White, A.R., Collins, S.J., Maher, F., Jobling, M.F., Stewart,
L.R., Thyer, J.M., Beyreuther, K., Masters, C.L. & Cappai, R.
(1999a) Prion protein-deficient neurons reveal lower glutathione
reductase activity and increased susceptibility to hydrogen per-
oxide toxicity. Am. J. Pathol. 155, 1723–1730.
43. Zeng, F., Watt, N.T., Walmsley, A.R. & Hooper, N.M. (2003)
Tethering the N-terminus of the prion protein compromises the
cellular response to oxidative stress. J. Neurochem. 84, 480–490.
44. Brown, D.R., Schmidt, B. & Kretzschmar, H.A. (1997c) Effects of
oxidative stress on prion protein expression in PC12 cells. Int. J.
Dev Neurosci. 15, 961–972.
45. Brown, D.R., Hafiz, F., Glasssmith, L.L., Wong, B S., Jones,
I.M., Clive, C. & Haswell, S.J. (2000) Consequences of manganese
replacement of copper for prion protein function and proteinase
resistance. EMBO J. 19, 1180–1186.

46. Miele, G., Jeffrey, M., Turnbull, D., Manson, J. & Clinton, M.
(2002) Ablation of cellular prion protein expression affects mito-
chondrial numbers and morphology. Biochem. Biophys. Res.
Commun. 291, 372–377.
47. Behrens, A. & Aguzzi, A. (2002) Small is not beautiful: antag-
onizing functions for the prion protein PrP
c
and its homologue
Dpl. Trends Neurosci. 25, 150–154.
48. Sorenson, J.R. (2001) Prion diseases: copper deficiency states
associated with impaired nitrogen monoxide or carbon monoxide
transduction and translocation. J. Inorg. Biochem. 87, 125–127.
49. Fridovich, I. (1975) Superoxide dismutases. Ann. Rev. Biochem.
44, 146–159.
50.Riek,R.,Hornemann,S.,Wider,G.,Glockshuber,R.&
Wu
¨
thrich, K. (1997) NMR characterization of the full-length
recombinant murine prion protein mPrP (23–231). FEBS Lett.
413, 282–288.
51. Wong, B.S., Venien-Bryan, C., Williamson, R.A., Burton, D.R.,
Gambetti, P., Sy, M.S., Brown, D.R. & Jones, I.M. (2000) Copper
refolding of prion protein. Biochem. Biophys. Res. Commun. 276,
1217–1224.
52. Li, R., Liu, T., Wong, B.S., Pan, T., Morillas, M., Swietnicki, W.,
O’Rourke,K.,Gambetti,P.,Surewicz,W.K.&Sy,M.S.(2000)
Identification of an epitope in the C terminus of normal prion
protein whose expression is modulated by binding events in the N
terminus. J. Mol. Biol. 301, 567–573.
53. Scha

¨
tzl,H.M.,DaCosta,M.,Taylor,M.,Cohen,F.E.&Prusiner,
S.B. (1995) Prion protein gene variation among primates. J. Mol.
Biol. 245, 362–374.
54. Simonic, T., Duga, S., Strumbo, B., Asselta, R., Ceciliani, F. &
Ronchi, S. (2000) cDNA cloning of turtle prion protein. FEBS
Lett. 469, 33–38.
55. Forloni,G.,Angeretti,N.,Chiesa,R.,Monzani,E.,Salmona,M.,
Bugiani, O. & Tagliavini, F. (1993) Neurotoxicity of a prion
protein fragment. Nature 362, 543–546.
56. Brown, D.R. (2000) Prion protein peptides: Optimal toxicity and
peptide blockade of toxicity. Mol. Cell Neurosci. 15, 66–78.
57. Martins, V.R., Graner, E., Garcia-Abreu, J., de Souza, S.J.,
Mercadante, A.F., Veiga, S.S., Zanata, S.M., Neto, V.M. &
Brentani, R.R. (1997) Complementary hydropathy identifies a
cellular prion protein receptor. Nature Med. 3, 1376–1382.
58. Zanata, S.M., Lopes, M.H., Mercadante, A.F., Hajj, G.N., Chi-
arini, L.B., Nomizo, R., Freitas, A.R., Cabral, A.L., Lee, K.S.,
Juliano, M.A., de Oliveira, E., Jachieri, S.G., Burlingame, A.,
Huang, L., Linden, R., Brentani, R.R. & Martins, V.R. (2002)
Stress-inducible protein 1 is a cell surface ligand for cellular prion
that triggers neuroprotection. EMBO J. 21, 3307–3316.
59. Kim,N.H.,Park,S.,Jin,J.,Kwon,M.,Choi,E.,Carp,R.I.&
Kim, Y. (2000) Increased ferric iron content and iron-induced
oxidative stress in the brains of scrapie-infected mice. Brain Res.
884, 98–103.
60. Milhavet, O., McMahon, H.E., Rachidi, W., Nishida, N., Kata-
mine, S., Mange, A., Arlotto, M., Casanova, D., Riondel, J.,
Favier, A. & Lehmann, S. (2000) Prion infection impairs the cel-
lular response to oxidative stress. Proc. Natl Acad. Sci. USA 97,

13937–13942.
61. Guentchev, M., Voigtla
¨
nder,T.,Haberler,C.,Groschup,M.H.&
Budka, H. (2000) Evidence for oxidative stress in experimental
prion disease. Neurobiol. Dis. 7, 270–273.
62. Guentchev, M., Siedlak, S.L., Jarius, C., Tagliavini, F., Castellani,
R.J., Perry, G., Smith, M.A. & Budka, H. (2002) Oxidative
damage to nucleic acids in human prion disease. Neurobiol. Dis. 9,
275–281.
63. Wong, B S., Brown, D.R., Pan, T., Whiteman, M., Liu, T., Bu,
X., Li, R., Gambetti, P., Olesik, J., Rubinstein, R. & Sy, M S.
(2001b) Oxidative impairment in scrapie-infected mice is asso-
ciated with brain metal perturbations and altered ani-oxidantion
activities. J. Neurochem. 79, 689–698.
64. Viles, J., Donne, D., Kroon, G., Prusiner, S.B., Cohen, F.E.,
Dyson, H.J. & Wright, P.E. (2001) Local structural plasticity of
the prion protein. Analysis of NMR relaxation dynamics.
Biochemistry 40, 2743–2753.
65. Chen, S.G., Teplow, D.B., Parchi, P., Teller, J.K., Gambetti, P. &
Autilio-Gambetti, L. (1995) Truncated forms of the human prion
proteininnormalbrainandinpriondiseases.J. Biol. Chem. 270,
19137–19180.
66. Ho
¨
lscher, C., Delius, H. & Bu
¨
rkle, A. (1998) Overexpression of
non-convertable PrPcD114–121 in scrapie-infected mouse neuro-
blastoma cells leads to trans-dominant inhibition of wild-type

PrPSc accumulation. J. Virol. 72, 1153–1159.
67. Nguyen, J., Baldwin, M.A., CohE.N., F.E. & Prusiner, S.B. (1995)
Prion protein peptide induces a-helix to b-sheet conformation
transitions. Biochemistry 34, 4186–4192.
3376 T. Cui et al. (Eur. J. Biochem. 270) Ó FEBS 2003