Tài liệu Báo cáo Y học: Characterization of a cloned subtilisin-like serine proteinase from a psychrotrophic Vibrio species doc

Characterization of a cloned subtilisin-like serine proteinase
from a psychrotrophic
Vibrio
species
Jo
´
hanna Arno
´
rsdo
´
ttir
1,2
,Ru
´
na B. Sma
´
rado
´
ttir
1
,O
´
lafur Th. Magnu
´
sson
2
, Sigrı
´
dur H. Thorbjarnardo
´
ttir

1
,
Gudmundur Eggertsson
1
and Magnu
´
s M. Kristja
´
nsson
2
1
Institute of Biology, University of Iceland; and
2
Department of Biochemistry, Science Institute, University of Iceland,
Reykjavik, Iceland
The gene encoding a subtilisin-like serine proteinase in the
psychrotrophic Vibrio sp. PA44 has been successfully
cloned, sequenced and expressed in Escherichia coli.The
gene is 1593 basepairs and encodes a precursor protein of
530 amino acid residues with a calculated molecular mass
of 55.7 kDa. The enzyme is isolated, however, as an active
40.6-kDa proteinase, without a 139 amino acid residue
N-terminal prosequence. Under mild conditions the
enzyme undergoes a further autocatalytic cleavage to give
a 29.7-kDa proteinase that retains full enzymatic activity.
The deduced amino acid sequence of the enzyme has high
homology to proteinases of the proteinase K family of
subtilisin-like proteinases. With respect to the enzyme
characteristics compared in this study the properties of the
wild-type and recombinant proteinases are the same.

Sequence analysis revealed that especially with respect to
the thermophilic homologues, aqualysin I from Thermus
aquaticus and a proteinase from Thermus strain Rt41A,
the cold-adapted Vibrio-proteinase has a higher content of
polar/uncharged amino acids, as well as aspartate resi-
dues. The thermophilic enzymes had a higher content of
arginines, and relatively higher number of hydrophobic
amino acids and a higher aliphatic index. These factors
may contribute to the adaptation of these proteinases to
different temperature conditions.
Keywords: cold adaptation; psychrotrophic; Vibrio-protein-
ase; proteinase K-like; subtilisin-like proteinase.
Many microorganisms and ectothermic animals live under
environmental temperatures that fluctuate in the range )2
to 10 °C without the opportunity to regulate their cellular
temperatures [1–3]. In fact, cold temperature is the most
widespread physiological stress condition that organisms
have either to adapt to or to avoid. Adaptive changes in
protein structure and function induced by cold are of prime
importance for cold acclimation and survival processes [4].
A common denominator of evolutionary adaptive changes
of proteins appears to be the conservation and optimization
of the functional state of the proteins, such that they are in
Ôcorresponding statesÕ with respect to functionally important
motions, under the different physical conditions to which
the proteins have adapted [5]. It has been suggested that in
order to maintain such Ôcorresponding statesÕ for efficient
biological function at low temperatures, cold-adapted
proteins must have adopted a higher degree of conforma-
tional flexibility [5–11]. As such cold-adaptive strategies

would require weakening or alteration of some intramole-
cular interactions, the structural stability of cold-adapted
proteins is expected to be diminished in comparison
with their counterparts adapted to higher temperatures
[6–8,11,12]. This has indeed been generally observed for
naturally occurring psychrophilic enzymes studied to date.
Recent studies in which directed evolution was used to
induce cold adaptive properties in a mesophilic enzyme and
increased thermal stability in a psychrophilic enzyme have,
however, indicated that there may not be a strict correlation
between increased activity at low temperatures and
decreased thermostability [13–15].
In recent years, there has been a growing interest in
enzymes from psychrophilic microorganisms, both as
models in studies on thermal stability and molecular
adaptation of proteins, as well as potential candidates for
biotechnological applications. Several enzymes from psy-
chrophilic bacteria have now been characterized [16–35] and
crystal structures of citrate synthase [23], triose-phosphate
isomerase [24], a-amylase [27,28], and that of malate
dehydrogenase [31] have been published. The psychrophilic
enzymes characterized so far generally have higher catalytic
activities at low temperatures and are less thermostable than
their counterparts from mesophiles. Comparative studies
where available crystal structures, sequences or three-
dimensional homology models of psychrophilic proteins
have been compared with homologous meso- and/or
thermophilic proteins have shown that a general set of rules
does not seem to exist for cold adaptation of proteins. Cold-
adaptive mechanisms seem to involve weakening of certain

Correspondence to M. M. Kristja
´
nsson, Department of Biochemistry,
Science Institute, University of Iceland, Dunhaga 3, 107 Reykjavik,
Iceland. Fax: + 354 5528911, Tel.: + 354 5254800,
E-mail:
Abbreviations: AQUI, aqualysin I; GdmSCN, guanidinium
thiocyanate; GdmCl, guanidinium chloride; PRK, proteinase K;
Suc-AAPF-NH-Np, succinyl-AlaAlaProPhe-p-nitroanilide;
VPR, Vibrio-proteinase.
Enzymes: aqualysin I (EC 3.4.21 ); proteinase K (EC 3.4.21.64);
Vibrio-proteinase (EC 3.4.21 )
Note: the sequence reported in this paper has been deposited in the
GenBank database (accession number AF521587).
(Received 19 June 2002, revised 11 September 2002,
accepted 16 September 2002)
Eur. J. Biochem. 269, 5536–5546 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03259.x
critical intramolecular interactions that tend to facilitate
increased local or global flexibilities in the protein molecules.
Fewer intra or intersubunit salt-bridges [17,18,21,23,
28,31,33], reduction in aromatic–aromatic interactions
[17,19,31,33], extended surface loops [17,21–23], fewer
prolines in such loops [19,21–23,28,33], lower hydropho-
bicity [18,19,26,34], weaker calcium-binding [17,27,28,34],
improved solvent interactions through additional surface
charges [17,19,22,23], and increased exposure of nonpolar
groups to the solvent [23,28] have all been cited as possible
reasons for increased flexibility and/or decreased thermal
stability of proteins from psychrophiles. In the case of
triose-phosphate isomerase from the psychrophilic bacter-

ium Vibrio marinus, a single amino acid substitution
(Ser238 fi Ala) that eliminates two hydrogen-bonds in a
loop region of the molecule could, to a large extent, account
for the cold-adaptation of the protein with respect to
catalytic activity and thermal stability [24].
We previously reported on selected enzymatic character-
istics of a subtilisin-like proteinase (subtilase) from a
psychrotrophic Vibrio species (VPR) [25]. The enzyme
belongs to the proteinase K family of these enzymes [36],
and showed cold-adaptive properties, i.e. higher catalytic
efficiency and lower thermal stability when compared with
the related mesophilic subtilase, proteinase K (PRK) from
the fungus Tritirachium album Limber, and aqualysin I
(AQUI) from the thermophile Thermus aquaticus YT-1. We
have now cloned, sequenced and expressed the gene for
VPR in E.coli. We compare the deduced amino acid
sequence of the proteinase to that of related enzymes from
the proteinase K family representing different traits in
temperature adaptation.
MATERIALS AND METHODS
Materials
The wild-type Vibrio-proteinase (VPR
wt
) was purified from
cultures of Vibrio strain PA44 as described previously [25].
Proteinase K, succinyl-AlaAlaProPhe-p-nitroanilide (Suc-
AAPF-NH-Np), guanidinium thiocyanate (GdmSCN), and
chemicals used for preparation of buffers were from the
Sigma Chemical Company (St Louis, MO, USA). Purified
aqualysin I was obtained as described previously [37].

Bacterial strains and plasmids
The strain used for genomic DNA was Vibrio strain PA44
[25,38]. The E.colistrain used for cloning was TG1 supE,
hsdD5, thi, D(lac-proAB), F¢ (traD36, proAB
+
,lacI
q
,lac
DZM15) [39]. Cloning vectors used were pUC18 and 19,
M13 vectors mp18 and 19 (New England Biolabs). The
vectors pBAD (Invitrogen) and pJOE 3075.3 [40] were used
for gene expression in the E.colistrains Top10 and JM109,
respectively.
Growth conditions and DNA manipulations
Vibrio PA44 was grown as described [25,38] and genomic
DNA was prepared using the CTAB/NaCl method as
described [41]. For cloning of the proteinase gene primers
were designed from the sequence of Vibrio alginolyticus [42]:
5¢-GCG
GAATTCTACACCCGCTACATGTGGCGTCG
CCAT-3¢ and 5¢-CGC
GGATCCTGGGGACTAGATC
GAATC-GACCAACGTAA-3¢. Underlined are restriction
enzyme sites for EcoRI and BamHI, respectively. The
primers were used to amplify about 600 base pairs from the
genomic Vibrio PA44 DNA. The PCR product was cloned
into M13mp19 and sequenced. The sequencing revealed an
EcoRI restriction site on the PCR fragment.
Genomic Vibrio PA44 DNA was digested with several
restriction enzymes (EcoRI, BamHI, HindIII, SalI, SacI,

PstI) and analyzed on agarose gels. Southern hybridiza-
tion with the PCR product revealed a HindIII fragment of
about 3000 basepairs. This fragment was cloned in two
EcoRI-HindIII pieces into M13mp19 and sequenced on an
ABI 373 automated DNA sequencer (Applied Biosys-
tems). DNA sequences and deduced amino acid sequences
were analyzed and compared using Sequencer 3.0
(Applied Biosystems) and the
DNASIS
software (Hitachi
Software Engineering). Homology searches were conduc-
tedwiththe
BLAST
program using the server at National
Center for Biotechnology Information (i.
nlm.nih.gov/BLAST/).
Expression and protein purification
The pBAD TOPO TA CloningÒ Kit from Invitrogen was
used for expression. The gene was amplified with PCR from
genomic Vibrio DNA using the primers 5¢-ATGTTAAA
GAAAGTATTAAGTTGTTG-TATTGCAGC-3¢ and
5¢-AAAGTTTGCTTGGAGCGTCAAGCC-ACTGTAAG
CCG-3¢, cloned into the expression vector pBAD-TOPO,
transformed into the E.coliTop10 strain and grown on LB
agar containing 100 lgÆmL
)1
ampicillin. An overnight
culture in LB-amp was diluted 50-fold and grown at
37 °CtoanD
600

¼ 0.7. At this stage CaCl
2
was added to
the culture to a final concentration of 10 m
M
, expression
was induced with 0.01%
L
-arabinose and cells were then
grown at 22 °CtoanD
600
¼ 1.2 for up to 48 h. Cells were
harvested by centrifugation (8000 g for 15 min) and lysed in
50 m
M
Tris,pH 8,10 m
M
CaCl
2
with 1 mgÆmL
)1
lysozyme,
sonication and repeated freezing and thawing in liquid
nitrogen. The cell lysate was treated with 5 lgÆmL
)1
DNase
and 5 lgÆmL
)1
RNase at 4 °C overnight and cell debris was
removed by centrifugation (20 000 g for 20 min). Proteins

in the supernatant were salted out with ammonium sulfate.
Pellet from 30 to 60% ammonium sulfate saturation was
collected and redissolved in 25 m
M
Tris, pH 8, 10 m
M
CaCl
2
. The recombinant Vibrio-proteinase (VPR
rt
)was
then purified to homogeneity as described for the proteinase
isolated from Vibrio strain PA44 [25].
Analytical procedures
The VPR
rt
was analyzed for purity/homogeneity and
molecular mass by SDS/PAGE using 8–25% gradient gels
(PhastGel 8–25) and isoelectric focusing on PhastGel 3–9
using the Phast-System (Pharmacia-LKB). Before electro-
phoresis the proteinase samples were treated with phenyl-
methylsulfonyl fluoride to a final concentration of 1 m
M
to
prevent autolysis during sample preparations. Gels were
stained with Coomassie brilliant blue R-250. Protein
concentration in solutions of VPR was estimated by
absorbance at 280 nm, using molar absorption coefficients;
e(280) of 50 350
M

)1
Æcm
)1
and 34 295
M
)1
Æcm
)1
for the 40.6
Ó FEBS 2002 Characterization of a cloned psychrotrophic proteinase (Eur. J. Biochem. 269) 5537
and 29.7 kDa forms of the protein, respectively, determined
as described by Pace et al. [43]. Mass spectral data was
obtained on a Reflex III MALDI-TOF spectrometer
(Bruker), operated in a linear mode. The matrix used was
sinnepic acid (Bruker) in a 50 : 50 acetonitrile/water mix-
ture, containing 0.1% trifluoroacetic acid, using the dried
droplet method.
Kinetic and thermal stability measurements
Enzymatic activity of VPR was assayed using SucAAPF-
NH-Np as a substrate as described previously [25], using
a thermoregulated Unicam UV1 spectrometer. Kinetic
parameters for activity were determined at 25 °Cbyfitting
the rate data measured at substrate concentrations between
0.05 and 1 m
M
, to the Michaelis–Menten equation by
nonlinear regression using the software
KCAT
(Biometallics,
Inc., Princeton, NJ, USA).

Thermal stability of VPR
wt
and VPR
rt
was determined
by measuring the rates of their inactivation at appropriate
temperatures between 52 and 68 °C. At each temperature
enzyme samples, dissolved (5–10 lgÆmL
)1
)in25m
M
Tris,
pH 8 (adjusted for each temperature), containing 100 m
M
NaCl, 1 m
M
EDTA and 15 m
M
CaCl
2
, were heated and
aliquots were withdrawn at intervals and immediately
assayed for remaining activity against SucAAPF-NH-Np
as described previously [25]. Rate constants for thermal
inactivation obtained from the first order plots were used
to construct Arrhenius plots describing the temperature
dependence of these rate constants [ln k vs. 1/temperature
(K)]. T
50%
values were obtained from the Arrhenius plots

as the temperature at which the rate of inactivation
corresponded to 50% loss of original enzyme activity after
30 min.
GdmSCN denaturation experiments
For measuring denaturation curves of VPR, PRK and
AQUI as a function of GdmSCN concentration, the
proteinases were first inhibited by incubation with 10 m
M
phenylmethylsulfonyl fluoride for at least 15 min, before
the samples were applied to a Sephadex G-25 column,
equilibrated with 25 m
M
Tris, pH 8.0, containing 15 m
M
CaCl
2
and 1 m
M
EDTA. The collected protein peaks
were diluted with the buffer containing the different
concentrations of GdmSCN. After incubation for up
to 24 h at 25 °C, the degree of unfolding was moni-
tored by measuring the fluorescence intensity using a
Spex Fluoromax spectrofluorometer. Reversal of inhibi-
tion of the proteinases during incubation was minor and
would not affect the pretransition baselines in the
denaturation curves. The excitation wavelengths were
275 nm for VPR and AQUI and 280 nm for PRK, but
emissions were monitored at 355 nm for VPR, at 335 nm
for PRK and at 320 nm in the case of AQUI. Excitation

and emission bandwidths were 3 and 8 nm, respectively.
Cuvettes were thermostatted at 25 °C. The denaturation
curves were normalized according to F
u
¼ (y
ƒ
) y)/
(y
ƒ
) y
u
), assuming a two-state transition, where y
ƒ
and
y
u
are the extrapolated fluorescence intensities for the
folded and unfolded states, respectively, and y is the
measured fluorescence at each point in the transition
region.
RESULTS
Stability of VPR and related meso- and thermophilic
proteinases
As reported previously the psychrotrophic Vibrio-proteinase
differed significantly with respect to thermal stability in
comparison to its mesophilic and thermophilic counter-
parts, proteinase K and aqualysin I, respectively, when
estimated from their rates of inactivation at different
temperatures [25]. Stability measurements of proteinases
are complicated by autoproteolytic cleavage that may take

place during unfolding. The relationship between unfolding
and autolysis is usually ill-defined and in most cases it is not
clear to what extent global or local unfolding of the protein
molecule has to take place to trigger autolysis. In order to
obtain an estimate of the conformational stability of the
three related proteinases of this comparative study, we also
determined the denaturation curves of the enzymes inhibited
by phenylmethanesulfonyl fluoride, as a function of denat-
urant concentration. Several subtilases have been reported
to exhibit high stability towards protein denaturants, such
as urea and GdmCl [44]. In this study, the powerful
denaturant GdmSCN was used in most experiments as
neither urea nor GdmCl unfolded aqualysin I at concen-
trations set by the upper limit of the aqueous solubility of
the denaturants. Normalized denaturation curves for VPR,
PRK and AQUI as a function of GdmSCN concentration
at 25 °C and pH 8.0 are shown in Fig. 1. In line with the
previous results on thermal stability, a significant difference
was observed in the conformational stability of the
proteinases, following the order of their respective temper-
atures of adaptation. The [GdmSCN]
1/2
-values obtained
from the curves were 0.55
M
,1.5
M
and 3.2
M
for the VPR,

PRK and AQUI, respectively, underlining large differences
Fig. 1. Normalized denaturation curves for VPR (d), PRK (j)and
AQUI (m), all inhibited by phenylmethylsulfonyl fluoride. Unfolding
was monitored by changes occurring in the fluorescence emission
spectra of the enzymes between 320 and 355 nm as a function of
GdmSCN concentration dissolved in 25 m
M
Tris, pH 8.0, 15 m
M
CaCl
2
and 1 m
M
EDTA at 25 °C.
5538 J. Arno
´
rsdo
´
ttir et al. (Eur. J. Biochem. 269) Ó FEBS 2002
in their stabilities towards this denaturant. From denatur-
ation curves in the presence of the denaturants GdmCl and
urea under the same set of conditions [GdmCl]
1/2
and
[urea]
1/2
-values for VPR were found to be 1.3 and 4.4
M
,
respectively. For comparison, [GdmCl]

1/2
for PRK was
5.3
M
(data not shown).
Sequence analysis
The sequencing of the vpr gene revealed a 1593-bp sequence
encoding a protein of 530 amino acid residues with a
calculated molecular mass of 55.7 kDa (Fig. 2). The
deduced sequence has high sequence identity to enzymes
of the proteinase K family of subtilisin-like serine protein-
ases (Fig. 3), confirming its former classification as a
member of that family [25]. As for other enzymes belonging
to the proteinase K family [42,45], the VPR sequence
consists of three parts; an N-terminal prosequence, a
proteinase or catalytic domain, and a C-terminal prose-
quence. The N-terminal prosequence of VPR consists of 139
residues and most probably functions as a molecular
chaperone for correct folding, but that is subsequently
cleaved off by autolysis to give the active proteinase [46–50].
Thus, VPR is isolated from cultures of Vibrio strain PA44 as
a 40.6-kDa protein, without the 139 residue N-terminal
sequence. The enzyme undergoes further autolysis under
relatively mild conditions where a 100-residue C-terminal
extension is cleaved off to give a 29.7-kDa proteinase that
remains fully active [25]. Both the 40.6-kDa and the
29.7-kDa forms of the enzyme have the same N-terminal
sequence, based on amino acid sequencing and MALDI-
TOF mass spectrometry of the two enzyme forms indicates
that the peptide bond cleaved between the catalytic domain

and the C-terminal extension is at Asp291-Gly292. Thus,
according to these results the larger active form of the
proteinase is 391 residues with a calculated molecular mass
of 40 568 Da and the smaller form is 291 amino acid
residueswithamolecularmassof29670Da,ingood
agreement with results obtained by mass spectrometry.
Comparison of sequences of the proteinase domains of
VPR and related enzymes reveals 86 and 71% identity to
the mesophilic proteinases from V. alginolyticus and
V. cholerae, respectively, and 60% identity to aqualysin I
and the Thermus Rt41A proteinase, but 41% to proteinase
K. The sequences around the catalytic triad residues
(Asp37, His70 and Ser220) are highly conserved in all these
enzymes, and except for PRK they apparently all contain
identical disulfide bonds, i.e. Cys67–Cys99 and Cys163–
Cys194 (numbering of VPR from the N-terminal of the
proteinase domain (see Fig. 2 or 3). The proteinase domain
of VPR additionally contains Cys277 and Cys281, and
Cys351 and Cys362 in the C-terminal domain, that suppo-
sedly also form disulfide bonds as the enzyme has not been
found to contain any free thiol groups [25]. Identical
cysteine residue pattern is found in the V. alginolyticus
proteinase [42], but of these only the C-terminal disulfide
wouldbepresentintheenzymefromV. cholerae according
to its deduced amino acid sequence [51] (Fig. 3).
The overall amino acid composition of VPR is similar to
that of related enzymes, especially to the mesophilic
enzymes from V. alginolyticus and V. cholerae (Table 1).
These enzymes all contain relatively high content of Ser and
Thr, as well as Gly, probably reflecting a close packing of

the polypeptide chain within these protein structures. When
compared with the thermophilic counterparts, there appar-
ently is a trend to higher content of Asn and Gln in the cold-
adapted enzyme and also is the number of acidic amino acid
residues, especially Asp, higher in the three Vibrio protein-
ases (Table 1). The thermophilic enzymes, however have
higher content of Arg, and relatively higher numbers of
hydrophobic amino acids, as well as a higher aliphatic index
than the psychro- or mesophilic enzymes (Table 2). When
each of the amino acid exchanges that occur between VPR
and the other related enzymes were studied, a trend to an
increased number of Ser in the cold-adapted enzyme was
apparent. Especially was Ala fi Ser a frequent thermophi-
lic-to-psychrophilic exchange. Eight such Ala to Ser
exchanges occur between the structures of AQUI and
VPR and seven between the Thermus Rt41 proteinase
and VPR. Six of the exchanges that occur between VPR and
AQUI are also present, however, in the mesophilic enzyme
Fig. 2. Nucleotide sequence and deduced amino acid sequence of the vpr
gene coding for the subtilisin-like proteinase precursor from Vibrio strain
PA44. The N- and C-terminal residues of the proteinase domain are
underlined and residues of the catalytic triad are enlarged in bold
letters.
Ó FEBS 2002 Characterization of a cloned psychrotrophic proteinase (Eur. J. Biochem. 269) 5539
from V. alginolyticus, but all together there are four
Ala fi Ser exchanges between VPR and the mesophilic
enzyme. Comparison of the sequences of the two mesophilic
proteinases from V. alginolyticus and V. cholerae (69%
sequence identity) and between the thermophilic AQUI and
Thermus Rt41 proteinase (71% sequence identity) indicated

that Ala fi Ser amino acid exchanges were not more
frequent than other exchanges between these enzymes
adapted to similar temperature conditions.
Fewer proline residues in surface loops has been cited as a
possible reason for increased flexibility and or decreased
stability in a few psychrophilic enzymes [19,21–23,28,32].
Comparison of sequences, as well as 3D homology models
of AQUI and VPR, generated by the automatic protein
modeling server
SWISS
-
MODEL
[52,53], based on known
crystal structures of proteinase K, revealed that the
thermophilic enzyme contains five Pro residues that are
not present in VPR, four (Pro5, Pro7, Pro240, Pro268) of
which are located in surface loops. It awaits mutagenic
studies to test if these proline residues contribute to
temperature adaptation of AQUI or VPR.
Subtilisin-like proteinases are highly dependent on cal-
cium for stability of their native conformations against
denaturation and/or autolysis. Stronger calcium binding has
been suggested as one of the major causes for the high
thermal stability of the thermophilic subtilases; thermitase
[54,55] and aqualysin I [56]. Weaker calcium binding as
compared with that of mesophilic counterparts, has also been
suggested to be a structural determinant in cold-adaptation
of subtilisin S41, from the Antarctic bacterium Bacillus TA41
Fig. 3. Alignment of the deduced amino acid
sequence of the psychrotrophic Vibrio-protein-

ase (VPR), proteinase from Vibrio alginolyti-
cus, aqualysin I (AQUI) from Thermus
aquaticus YT-1 and proteinase K (PRK) from
Tritirachium album. Arrows indicate the
N-terminal of VPR as determined by amino
acid sequence analysis [25] and the beginning of
the C-terminal extension based on results from
MALDI-TOF mass spectrometry. Residues of
the catalytic triad are indicated by an asterisk.
Secondary structural elements based on known
crystal structures of PRK are indicated by h
(helix) and s (strand) and calcium binding
ligands (P175, V177 and D200 at the
Ca1 site and T16 and D260 at the Ca2 site,
according to the numbering of the PRK
sequence) are denoted by C.
5540 J. Arno
´
rsdo
´
ttir et al. (Eur. J. Biochem. 269) Ó FEBS 2002
[17]. We have also observed a strong dependence on calcium
binding for the stability of VPR, as well as for PRK and
AQUI (M. M. Kristjansson, unpublished results). Two
calcium sites with different binding affinities have been
identified in the high resolution crystal structures of PRK
[57,58]. At the stronger Ca1-site, calcium ion is coordinated
in the form of pentagonal bipyramid by O
d1
and O

d2
of
Asp200, the carbonyl oxygens of Pro175 and Val177, and
four water molecules. At the weaker Ca2-site, which bridges
two loops of the C- and N-termini of the protein, calcium is
coordinated by the carboxylate oxygens of Asp260 and the
backbone oxygen of Thr16, in addition to 4–5 water
molecules [57,58]. Comparison of the sequences and the
homology models for VPR and AQUI to that of PRK
indicate that the Ca1 site appears to be present in both VPR
and AQUI. The weaker Ca2 site of PRK does not appear to
be present, however, in either of the two proteinases, due
to the lack of a carboxylate group at positions corresponding
to Asp260 in PRK. A weakly bound calcium ion has been
shown to have a significant role in the thermal stability of
AQUI [56], thus, a yet-unidentified Ca-site is likely to be
present in that molecule.
Expression of the
vpr
gene in
E. coli
Attempts to design a suitable expression system for the vpr
gene involved three expression vectors. We did not
manage to clone the gene into the pET 23b vector,
Table 1. Amino acid composition of the proteinase domain of Vibrio-proteinase and related enzymes of the proteinase K family.
Amino
acid
Vibrio-
proteinase V. alginol V. cholerae Thermus Rt41a AQUI PRK
No. % No. % No. % No. % No. % No. %

Ala 25 8.6 33 11.5 28 9.8 36 12.9 40 14.2 33 11.8
Arg 9 3.1 8 2.8 11 3.8 10 3.6 15 5.3 12 4.3
Asn 23 7.9 20 7.0 26 9.1 14 5.0 19 6.8 17 6.1
Asp 21 7.2 20 7.0 21 7.3 13 4.7 13 4.6 13 4.7
Cys 6 2.1 6 2.1 4 1.4 4 1.4 4 1.4 5 1.8
Gln 10 3.4 9 3.1 13 4.5 8 2.9 5 1.8 7 2.5
Glu 5 1.7 3 1.0 5 1.7 1 0.4 3 1.1 5 1.8
Gly 40 13.7 7 12.9 35 12.2 31 11.2 37 13.2 33 11.8
His 4 1.4 4 1.4 5 1.7 7 2.5 5 1.8 4 1.4
Ile 9 3.1 8 2.8 13 4.5 11 4.0 9 3.2 11 3.9
Leu 18 6.2 15 5.2 15 5.2 19 6.8 19 6.8 14 5.0
Lys 5 1.7 5 1.7 9 3.1 4 1.4 2 0.7 8 2.9
Met 3 1.0 3 1.0 3 1.0 3 1.1 2 0.7 5 1.8
Phe 7 2.4 6 2.1 5 1.7 5 1.8 3 1.1 6 2.2
Pro 12 4.1 7 2.4 13 4.5 13 4.7 11 3.9 9 3.2
Ser 38 13.1 38 13.3 26 9.1 22 7.9 29 10.3 37 13.3
Thr 20 6.9 19 6.6 22 7.7 34 12.2 25 8.9 22 7.9
Trp 4 1.4 4 1.4 3 1.0 4 1.4 3 1.1 2 0.7
Tyr 8 2.8 9 3.1 8 2.8 15 5.4 12 4.3 17 6.1
Val 24 8.2 32 11.2 22 7.7 24 8.63 25 8.9 19 6.8
S 291 286 287 278 281 288
Table 2. Comparison of structural parameters based on amino acid composition of Vibrio-proteinase and related enzymes from the proteinase K family.
Parameter Vibrio-proteinase V. alginol V. cholerae Thermus Rt41a AQUAI PRK
% charged
a
15.12 13.99 17.77 12.60 13.53 15.05
% acidic
b
8.93 8.04 9.06 5.04 5.70 6.45
% basic

c
4.81 4.55 6.97 5.04 6.05 7.17
Polar/uncharged
d
49.83 48.26 46.69 46.05 46.62 49.46
Arg/(Arg + Lys) 0.643 0.615 0.555 0.882 0.714 0.600
% hydrophobic
e
35.05 37.77 35.54 41.37 39.85 35.49
% aromatic 6.53 6.65 5.57 8.64 6.41 8.96
(Ile + Leu)/(Ile + Leu + Val) 0.529 0.418 0.560 0.555 0.528 0.568
pI
calc
f
4.52 4.56 5.28 7.22 7.89 8.25
GRAVY
g
)0.268 )0.038 )0.433 0.037 )0.038 )0.218
Aliphatic index
f
68.69 75.35 70.03 80.07 78.90 66.52
a
DEHKR;
b
DE;
c
KR;
d
GSTNQYC;
e

LMIVWPAF;
f
Calculated at />g
GRAVY, grand
average of hydropathicity.
Ó FEBS 2002 Characterization of a cloned psychrotrophic proteinase (Eur. J. Biochem. 269) 5541
possibly because of detrimental background expression.
The gene was cloned into another vector, pJOE 3075.3
[40]. The gene was overexpressed using the pJOE vector in
E.colistrain JM109, but the protein formed inclusion
bodies. Changing the conditions in the expression culture,
such as lowering the temperature or changing the
concentration of the inducer has not given production of
active enzyme, nor have attempts to refold the protein by
different means in vitro been successful. The gene was
moderately expressed, giving a yield of  2mgÆL
)1
,using
the pBAD TOPO expression system. No activity was
detected after induction and culturing at 37 °C. Culturing
at 32 °C after induction resulted in a detectable produc-
tion of active proteinase, which was further enhanced by
lowering the growth temperature to room temperature
after induction.
Characterization of the recombinant VPR
The purified VPR
rt
showed identical properties to VPR
wt
with respect to migration on SDS/PAGE and the time

dependent autoproteolytic 40.6 fi 29.7 kDa conversion at
40 °C (Fig. 4). The recombinant and wild-type enzyme also
showed identical electrophoretic behavior for both forms of
the enzyme on IEF gels (data not shown). The larger form
having an estimated isoelectric point of 4.6, but 3.7 for the
smaller form.
AfeatureoftheVibrio-proteinase is its sensitivity to
treatment with dithiothreitol. In the presence of 10 m
M
dithiothreitol at 25 °C, the activity of enzyme is decreased
to about one-quarter of its original activity, an effect that
was attributed to an eightfold increase in K
m
for
SucAAPF-NH-Np, while the k
cat
was unchanged for the
reaction [25]. When VPR
rt
was treated with dithiothreitol
under the same conditions as VPR
wt
both enzymes
displayed identical inactivation behaviour, indicating that
the same disulfide(s) are involved in maintaining the
integrity of active protein structure in both wild-type and
recombinant VPR.
The wild-type and recombinant forms of the enzyme
showed no significant differences in terms of thermal
stability when compared in the form of Arrhenius

plots (Table 3). They also had comparable Michaelis–
Menten kinetic parameters when their amidase activity
against succinyl-AAPF-NH-Np was measured at 25 °C
(Table 3).
DISCUSSION
The extracellular proteinase K-like proteinase from the
psychrotolerant Vibrio strain PA44 is produced as a
55.7-kDa precursor protein, containing an 139 residue
N-terminal prosequence, a 291 residue proteinase domain,
and a 100 residue C-terminal domain. Production of such
relatively large precursor proteins appears to be a common
trait of proteinases belonging to the proteinase K family. In
aqualysin I, from the thermophile Thermus aquaticus, a 127-
residue N-terminal prosequence is cleaved off in an intra-
molecular autocatalytic reaction apparently after assisting in
the correct folding of the proteinase [49,50,59]. The
N-terminal prosequence is necessary for the production of
active aqualysin I and most likely acts as an intramolecular
chaperone, by similar mechanisms as has been described for
such N-prosequences of subtilisins [46–48] and a-lytic
protease, a trypsin-like serine proteinase [60]. Because of
the similarity that exists between the sequences of VPR and
AQUI, we predict that the N-terminal prosequence of the
cold-adapted enzyme has such an intramolecular chaperone-
like activity for that enzyme. A 105 residue C-terminal
prosequence has been found to play an important role in
extracellular secretion of AQUI in an expression system
using Thermus thermophilus cells, and it was suggested that
the sequence is required for the translocation of the
precursor across the outer membrane [61]. VPR is secreted

both as the wild-type enzyme in cultures of Vibrio strain
PA44andinourE.coliexpression system as a 40.6-kDa
protein, containing the C-terminal prosequence and as we
have shown previously [25], the enzyme undergoes, under
relatively mild conditions, an autocatalytic cleavage to a
29.7-kDa proteinase, lacking the C-terminal extended
sequence, but which remains fully active. We observed the
same behaviour for the recombinant VPR (Fig. 4). With
Fig. 4. In vitro processing of wild-type (A) and
recombinant (B) VPR at 40 °C. Samples of the
enzymes were incubated in 25 m
M
Tris,
pH 8.0, containing 10 m
M
CaCl
2
. Aliquots
were withdrawn at intervals and phenyl-
methylsulfonyl fluoride was added to a final
concentration of 1 m
M
to inhibit enzyme
activity, followed by analysis by SDS/PAGE
on 8–25% gels.
Table 3. Comparison of thermal stability (T
50%
) and Michaelis–Menten
parameters (K
m

and k
cat
) against succinyl-AAPF-p-nitroanilide of wild-
type (VPR
wt
) and recombinant (VPR
rt
)formsoftheVibrio-proteinase.
Property VPR
wt
VPR
rt
T
50%
56 °C56°C
K
m
179 ± 12 l
M
164 ± 17 l
M
k
cat
68.9 s
)1
76.5 s
)1
5542 J. Arno
´
rsdo

´
ttir et al. (Eur. J. Biochem. 269) Ó FEBS 2002
respect to the enzyme characteristics compared in this study,
the properties of wild-type and recombinant forms of VPR
were undistinguishable, hence we conclude that the two
forms are identical molecular entities.
The deduced amino acid sequence of VPR shows over
50% identity to sequences of the proteinase K-like protein-
ases from Vibrio alginolyticus [42], Vibrio cholerae [51],
Alteromonas sp. [62], Kytococcus sedentarius (
SWISSPROT
accession no. Q9L705), aqualysin I from Thermus aquaticus
[45] and Thermus strain Rt41A [63]. We chose to compare
the sequence of VPR to the enzymes from V. alginolyticus
and V. cholerae, as close homologs of VPR of mesophilic
origin, the thermophilic AQUI and Thermus Rt41A prote-
inase, as well as proteinase K as the representative enzyme
of this proteinase family, in an attempt to observe tendencies
in amino acid substitutions that might correlate with their
differences in temperature adaptation. Although such a
comparison is limited by the small sample size, there appears
to be a tendency towards a higher content of polar/
uncharged amino acids, in particular Asn, Gln and Ser, in
the cold-adapted VPR, especially when compared with the
thermophilic enzymes. Of specific amino acid substitutions,
the Ala fi Ser exchange was the most often observed
thermophilic-to-psychrophilic substitution. It is of interest
in this respect that in a recent study where 115 protein
sequences from the genome of the extreme thermophilic
archaeon Methanococcus jannaschii were compared with

their homologs from several mesophilic Methanococcus
species, the strongest correlation with thermophily of the
observed amino acid exchanges was the decrease in the
content of uncharged polar residues (Ser, Thr, Asn and Gln)
[64]. Of the specific amino acid replacements, the Ser fi Ala
exchange showed the highest correlation with thermophily
[64]. The Ser fi Ala replacement was also observed as one
of the most frequent ÔthermostabilizingÕ amino acid ex-
change observed by Argos and coworkers [65,66] in their
sequence comparisons of meso- and thermophilic proteins.
We are now carrying out mutagenic studies on VPR to
examine whether some of the Ala fi Ser substitution we
have observed in this comparison may contribute to its cold
adaptation.
The cold-adapted VPR also seems to be less hydro-
phobic than the thermophilic Thermus proteinases, as
calculated in Table 2. The lower hydrophobic content
and aliphatic index of VPR can largely be accounted for
by the lower Ala content. Four Pro residues located on
surface loops in AQUI, that are not present in VPR, may
contribute to the higher stability of the thermophilic as
compared with the cold-adapted enzyme. As a result of
inherent constraints on rotations around the N–Ca bond
of proline residues, their introduction into mobile regions
of proteins, such as loops, is expected to restrict available
backbone configurations and thus increase rigidity and
hence stability in such regions [67,68]. Stabilization of
loops may also take place by shortening or deletion, or
by substitutions that reduce the number of ÔflexibleÕ
glycines in such regions [67–69]. In addition to restricting

flexibility in the loop regions, these factors would also
reduce the conformational entropy of the unfolded state
of the protein and thus contribute to the stability of the
native state [67–69]. Conversely, the opposite effects may
be important to increase flexibility in cold-adapted
enzymes and extended surface loops [17,21–23] and fewer
prolines in such loops [19,21–23,28,32], have indeed been
reported as structural determinants of cold-adaptation in
psychrophilic enzymes. Glycine residues are highly con-
served in the sequences of the proteinases compared in
this study. For example, of the 37 glycines present in the
proteinase domain of AQUI, 29 are present at identical
positions in VPR. The catalytic domain of VPR contains
10 additional glycine residues; of those, however, seven
are also present at identical sites in the mesophilic
proteinase from V. alginolyticus. According to our
homology model only one of the three extra glycines in
the cold-adapted proteinase is located in a loop region of
the protein. Thus an increased number of ÔflexibleÕ
glycines in loops is not expected to play a key role in
cold-adaptation of VPR.
As for other subtilisin-like proteinases, calcium binding
is highly important for the stability of VPR, but its role in
temperature adaptation is far from being straightforward.
Both site-directed [20] and random mutagenesis (directed
evolution) studies [13–15] have shown that modification of
groups involved in calcium binding in these proteinases
can significantly affect both thermal stability and catalytic
activity. Sequence comparisons and evaluation of 3D
homology models for VPR and AQUI, indicate that at

least one of the two well-defined calcium binding sites (the
stronger Ca1-site) in the structure of PRK is also present
in these enzymes, but the weaker, Ca2-site, cannot be
present due to the lack of the carboxylate ligand
corresponding to Asp260 in PRK. For VPR it is
interesting to observe that a highly similar amino acid
sequence as the one that makes up one of the three
calcium binding sites (the Ômedium strengthÕ Ca2-site)
identified in thermitase is present in the enzyme (Fig. 5).
This Ca-site is positioned in a loop that leads into an
a-helix containing the active site His residue of the
catalytic triad. Except for one substitution (Ala66 fi Ser)
the sequences of VPR and the V. alginolyticus proteinase
are identical in this region, but are different from AQUI.
In addition to the ligands indicated in Fig. 5, an Arg residue
(Arg102) stabilizes the Ca-site by making a salt bridge to the
ligands Asp57 and Asp60 [54,55]. Both of the Vibrio sp.
enzymes, as well as AQUI and the Thermus Rt41 proteinase,
also contain a conserved Arg residue at equivalent sites in
their sequences (Fig. 3). It still remains to be seen if a
difference in calcium binding affinity in any way affects the
temperature adaptation among these proteinases.
In common with many cold-adapted enzymes character-
ized so far, VPR is anionic, e.g. it has an acidic isoelectric
point. It apparently shares this property with its mesophilic
counterparts (Table 3), but is different from the basic pIs for
AQUI (pI >9–10) [70] and the Thermus Rt41A proteinase
(pI  10.25–10.5) [63]. The lower pI of VPR compared with
its thermophilic counterparts results from higher content of
Fig. 5. Comparison of the amino acid sequence of the main ligands

(indicated in bold) of the medium strength calcium binding site (Ca2 site)
of thermitase and a similar sequence found in VPR. TheactivesiteHis
residue is indicated by an asterix.
Ó FEBS 2002 Characterization of a cloned psychrotrophic proteinase (Eur. J. Biochem. 269) 5543
Asp and lower number of Arg residues (Table 3). In
subtilisin S41, an acidic pI was mainly attributed to 11 extra
Asp residues located on the surface of the molecule giving
rise to a more flexible enzyme [17]. Similar trends have also
been observed in a cold active citrate synthase [22]. It has
been pointed out, however, that subtilisin S41 shares the
high Asp content with the closely related subtilisin SSII
from the mesophilic Bacillus sphaericus and it might
therefore contribute less to cold-adaptation of the psychro-
philic enzyme than suggested [13].
ACKNOWLEDGMENTS
We thank Dr Gudni A
´
. Alfredsson, Institute of Biology, University of
Iceland for providing us with cultures of Vibrio strain PA44, Dr Hiroshi
Matsuzawa, Department of Biotechnology, The University of Tokyo,
for samples of aqualysin I, and Dr O
´
lafur H. Fridjonsson, Prokaria,
Reykjavı
´
k for the pJOE 3075.3 vector for these studies. We also thank
Berit Nielsen at deCODE Genetics, Reykjavik for carrying out the
mass spectrometry of samples. This work was supported by grants from
the Icelandic Research Council.
REFERENCES

1. Hazel, J.R. & Prosser, C.L. (1974) Molecular mechanisms of
temperature compensation in poikilotherms. Physiol. Rev. 54,
620–677.
2. Somero, G.N. (1995) Proteins and temperature. Annu. Rev.
Physiol. 57, 43–68.
3. Feller, G., Arpigny, J.L., Narinx, E. & Gerday, C. (1997) Mole-
cular adaptations of enzymes from psychrophilic organisms.
Comp.Biochem.Physiol.118A, 495–499.
4. Franks, F. (1995) Protein destabilization at low temperatures.
Adv. Prot. Chem. 46, 105–139.
5. Jaenicke, R. & Bo
¨
hm, G. (1998) The stability of proteins in
extreme environments. Curr. Opin. Struct. Biol. 8, 738–748.
6. Feller, G., Narinx, E., Arpigny, J.L., Aittaleb, M., Baise, E.,
Genicot, S. & Gerday, C. (1996) Enzymes from psychrophilic
organisms. FEMS Microbiol. Lett. 18, 189–202.
7. Gerday, C., Aittaleb, M., Arpigny, J.L., Baise, E., Chessa, J.P.,
Garsoux, G., Petrescu, I. & Feller, G. (1997) Psychrophilic
enzymes: a thermodynamic challenge. Biochem. Biophys. Acta
1342, 119–131.
8. Kristja
´
nsson, M.M., A
´
sgeirsson, B. & Bjarnason, J.B. (1997)
Serine proteinases from cold-adapted organisms. Adv. Exp. Med.
Biol. 415, 27–46.
9.Za
´

vodsky, P., Kardos, J., Svingor, A
´
.&Petsko,G.A.(1998)
Adjustment of conformational flexibility is a key event in the
thermal adaptation of proteins. Proc. Natl Acad. Sci. USA 95,
7406–7411.
10. Fields, P.A. & Somero, G.N. (1998) Hot spots in cold adaptation:
localized increases in conformational flexibility in lactate dehy-
drogenase A
4
orthologs of antarctic notothenioid fishes. Proc.
Natl Acad. Sci. USA 95, 11476–11481.
11. Smala
˚
s, A.O., Schrøder Leiros, H K., Os, V. & Peder, N. (2000)
Cold adapted enzymes. Biotechnol. Ann. Rev. 6, 1–57.
12. Shoichet,B.,Baase,W.A.,Kuroki,R.&Matthews,B.W.(1995)
A relationship between protein stability and protein function.
Proc. Natl Acad. Sci. USA 92, 452–456.
13. Miyazaki, K., Wintrode, P.L., Grayling, R.A., Rubingh, D.N. &
Arnold, F.H. (2000) Directed evolution study of temperature
adaptation in a psychrophilic enzyme. J. Mol. Biol. 297, 1015–
1026.
14. Wintrode, P.L., Miyazaki, K. & Arnold, F.H. (2000) Cold adap-
tation of a mesophilic subtilisin-like protease by laboratory evo-
lution. J. Biol. Chem. 275, 31635–31640.
15. Wintrode, P.L., Miyazaki, K. & Arnold, F.H. (2001) patterns of
adaptation in a laboratory evolved thermophilic enzyme. Biochim.
Biophys. Acta 1549,1–8.
16. Rentier-Delrue, F., Mande, S.C., Moyens, S., Terpstra, P.,

Mainfroid, V., Goraj, K., Lion, M., Hol, W.G.J. & Martial, J.A.
(1993) Cloning and overexpression of the triose-phosphate iso-
merase genes from psychrophilic and thermophilic bacteria.
Structural comparison of the predicted protein sequences. J. Mol.
Biol. 229, 85–93.
17. Davail, S., Feller, G., Narinx, E. & Gerday, C. (1994) Cold
adaptation of proteins. Purification, characterization, and
sequence of the heat-labile subtilisin from the antarctic psychro-
phile Bacillus TA41. J. Biol. Chem. 269, 17448–17453.
18. Feller, G., Payan, F., Theys, F., Qian, M., Haser, R. & Gerday, C.
(1994) Stability and structural analysis of a-amylase from the
antarctic psychrophile Alteromonas haloplanctis. Eur. J. Biochem.
222, 441–447.
19. Feller, G., Zekhnini, Z., Lamotte-Brasseur, J. & Gerday, C. (1997)
Enzymes from cold-adapted microorganisms. The class C b-lac-
tamase from the antarctic psychrophile Psychrobacter immobilis
A5. Eur. J. Biochem. 244, 186–191.
20. Narinx, E., Baise, E. & Gerday, C. (1997) Subtilisin from psy-
chrophilic antarctic bacteria: characterization and site-directed
mutagenesis of residues possibly involved in the adaptation to
cold. Protein Eng. 10, 1271–1279.
21. Wallon, G., Lovett, S.T., Magyar, C., Swingor, A., Szilagyi, A.,
Zavodsky, P., Ringe, D. & Petsko, G.A. (1997) Sequence and
homology model of 3-isopropylmalate dehydrogenase from the
psychrotrophic bacterium Vibrio sp. I5 suggest reasons for thermal
instability. Protein Eng. 10, 665–672.
22. Gerike, U., Danson, M.J., Russel, N.J. & Hough, D.W. (1997)
Sequencing and expression of the gene encoding a cold-active
citrate synthase from an Antarctic bacterium, strain DS2–3R.
Eur.J.Biochem.248, 49–57.

23.Russell,R.J.M.,Gerike,U.,Danson,M.J.,Hough,D.W.&
Taylor, G.L. (1998) Structural adaptation of the cold-active citrate
synthase from an Antarctic bacterium. Structure 6, 351–361.
24. Alvarez, M., Zeelen, J.P., Mainfroid, V., Rentier-Delrue, F.,
Martial, J.A., Wyns, L., Wierenga, R.K. & Maes, D. (1998)
Triose-phosphate isomerase (TIM) of the psychrophilic bacterium
Vibrio marinus. J. Biol. Chem. 273, 2199–2206.
25. Kristja
´
nson, M.M., Magnu´ sson, O
´
.Th, Gudmundsson, H.M.,
Alfredsson, G.A
´
. & Matsuzawa, H. (1999) Properties of a sub-
tilisin-like proteinase from a psychrotrophic Vibrio-species.
Comparison to proteinase K and aqualysin I. Eur. J. Biochem.
260, 752–761.
26. Kristja
´
nsson, M.M. & Magnu´ sson. O
´
.Th (2001) Effects of lyo-
tropic salts on the stability of a subtilisin-like proteinase from a
psychrotrophic Vibrio-species, proteinase K and aqualysin I.
Protein Peptide Lett. 8, 249–255.
27. Aghajari, N., Feller, G., Gerday, C. & Haser, R. (1998) Crystal
structures of the psychrophilic a-amylase from Alteromonas
haloplanctis in its native form and complexed with an inhibitor.
Protein Sci. 7, 564–572.

28. Aghajari, N., Feller, G., Gerday, C. & Haser, R. (1998) Structures
of the psychrophilic Alteromonas haloplanctis a-amylase give
insights into cold adaptation at a molecular level. Structure 6,
1503–1516.
29. Feller, G., d’Amico, D. & Gerday, C. (1999) Thermodynamic
stability of a cold-active a-amylase from the Antarctic bacterium
Alteromonas haloplanktis. Biochemistry 38, 4613–4619.
30. D’Amico, S., Gerday, C. & Feller, G. (2001) Structural determi-
nants of cold adaptation and stability in a large protein. J. Biol.
Chem. 276, 25791–25796.
31. Kim, S Y., Hwang, K.Y., Kim, S H., Sung, H C., Han, Y.S. &
Cho, Y. (1999) Structural basis for cold adaptation. Sequence,
biochemical properties, and crystal structure of malate
5544 J. Arno
´
rsdo
´
ttir et al. (Eur. J. Biochem. 269) Ó FEBS 2002
dehydrogenase from a psychrophile Aquaspirillum arcticum.
J. Biol. Chem. 274, 11761–11767.
32. Georlette,D.,Jonsson,Z.O.,VanPetegem,F.,Chessa,J.,Van
Beeumen, J., Hubscher, U. & Gerday, C. (2000) A DNA ligase
from the psychrophile Pseudoalteromonas haloplanktis gives
insight into the adaptation of proteins to low temperatures. Eur. J.
Biochem. 267, 3502–3512.
33. Bentahir, M., Feller, G., Aittaleb, M., Lamotte-Brasseur, J.,
Himri, T., Chessa, J.P. & Gerday, C. (2000) Structural, kinetic,
and calorimetric characterization of the cold-active phosphogly-
cerate kinase from the antarctic Pseudomonas sp. TACII18. J. Biol.
Chem. 275, 11147–11153.

34. Chessa, J.P., Petrescu, I., Bentahir, M., Van Beeumen, J. &
Gerday, C. (2000) Purification, physico-chemical characterization
and sequence of a heat-labile alkaline metalloprotease isolated
from a psychrophilic Pseudomonas species. Biochim. Biophys. Acta
1479, 265–274.
35.Sheridan,P.P.,Panasik,N.,Coombs,J.M.&Brenchley,J.E.
(2000) Approaches for deciphering the structural basis of low
temperature enzyme activity. Biochim. Biophys. Acta 1543, 417–
433.
36. Siezen, R.J. & Leunissen, J.A.M. (1997) Subtilases: the super-
family of subtilisin-like serine proteases. Protein Sci. 6, 501–523.
37. Lin,S J.,Kim,D W.,Ryugo,Y.,Wakagi,T.&Matsuzawa,H.
(1997) Increase of the protease activity of aqualysin I, a thermo-
stable serine protease, by replacing Asn 219 near the catalytic
residue Ser 222. Biosci. Biotechnol. Biochem. 61, 718–719.
38. Alfredsson, G.A., Gudmundsson, H.M., Xiang, J.Y. & Krist-
ja
´
nsson. M.M. (1995) Subtilisin-like serine proteases from psy-
chrophilic marine bacteria. J. Mar. Biotechnol. 3, 71–72.
39. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning. Cold Spring Harbor Laboratory Press, New York.
40. Wilms,B.,Hauck,A.,Reuss,M.,Mattes,R.,Siemann,M.&
Altenbucher, J. (2001) High-cell-density fermentation for pro-
duction of
L
-N-carbamoylase using an expression system based
on the Escherichia coli rhaBAD promoter. Biotechnol. Bioeng. 73,
95–103.
41. Ausubel, F.M., Brent, R.E., More, D.D., Seidman, J.G.,

Smith, J.A. & Struhl, K. (1989) Current Protocols in Molecular
Biology. Green Publishing Associates and Wiley-Interscience,
New York.
42. Deane, S.M., Robb, F.T., Robb, S.M. & Woods, D.R. (1989)
Nucleotide sequence of the Vibrio alginolyticus calcium dependent,
detergent-resistant alkaline serine exoprotease A. Gene 76, 281–
288.
43. Pace,C.N.,Vajdos,F.,Fee,L.,Grimsley,G.&Gary,T.(1995)
How to measure and predict the molar absorption coefficient of a
protein. Protein Sci. 4, 2411–2423.
44. Genov, N., Filippi, B., Dolashka, P., Wilson, K.S. & Betzel, C.
(1995) Stability of subtilisins and related proteinases (subtilases).
Int. J. Peptide Protein Res. 45, 391–400.
45. Terada,I.,Kwon,S.T.,Miyata,Y.,Matsuzawa,H.&Ohta,T.
(1990) Unique precursor structure of an extracellular protease,
aqualysin I, NH
2
- and COOH-terminal pro-sequence and its
processing in Escherichia coli. J. Biol. Chem. 265, 6576–6581.
46. Shinde, U. & Inouye, M. (1993) Intramolecular chaperon and
protein folding. Trends Biochem. Sci. 18, 442–446.
47. Eder, J., Rheinecker, M. & Fersht, A.R. (1993) Folding of
subtilisin BPN¢: role of the pro-sequence. J. Mol. Biol. 233,
293–304.
48. Bryan, P., Wang, L., Hoskins, J., Ruvinov, S., Strausberg, S.,
Alexander, P., Almog, O., Gilliland, G. & Gallagher, T. (1995)
Catalysis of a protein folding reaction: Mechanistic implications
of the 2.0 A
˚
structure of the subtilisin-prodomain complex.

Biochemistry 34, 10310–10318.
49. Lee, Y.C., Miyata, Y., Terada, I., Ohta, T. & Matsuzawa, H.
(1991) Involvement of NH
2
-terminal pro-sequence in the pro-
duction of active aqualysin I (a thermophilic serine protease) in
Escherichia coli. Agric. Biol. Chem. 55, 3027–3032.
50. Lee, Y.C., Ohta, T. & Matsuzawa, H. (1992) A non-covalent
NH2-terminal pro-region aids the production of active aqualysin I
(a thermophilic protease) without the COOH-terminal pro-
sequence in Escherichia coli. FEMS Microbiol. Lett. 92, 73–78.
51. Heidelberg, J.F., Eisen, J.A., Nelson, W.C., Clayton, R.A.,
Gwinn, M.L., Dodson, R.J., Haft, D.H., Hickey, E.K., Peterson,
J.D.,Umayam,L.A.,Gill,S.R.,Nelson,K.E.,Read,T.D.,
Tettelin,H.,Richardson,D.,Ermolaeva,M.D.,Vamathevan,J.,
Bass,S.,Qin,H.,Dragoi,I.,Sellers,P.,McDonald,L.,Utterback,
T., Fleischman, R.D., Nierman, W.C., White, O., Salzberg, S.L.,
Smith, H.O., Colwell, R.R., Mekalanos, J.J., Venter, J.C. &
Fraser, C.M. (2000) DNA sequence of both chromosomes of the
cholera pathogen Vibrio cholerae. Nature 406, 477–483.
52. Guex, N., Diemand, A. & Peitsch, M.C. (1999) Protein modelling
for all. Trends Biochem. Sci. 24, 364–367.
53. Guex, N. & Peitsch, M.C. (1997) SWISS-MODEL and the Swiss-
PdbViewer: an environment for comparative protein modelling.
Electrophoresis 18, 2714–2723.
54. Teplyakov, A.V., Kuranova, I.P., Harutyunyan, E.H., Vainshtein,
B.K., Fro
¨
mmel, C., Ho
¨

hne, W.E. & Wilson, K.S. (1990) Crystal
structure of thermitase at 1.4 A
˚
resolution. J. Mol. Biol. 214,
261–279.
55. Gros, P., Kalk, K.H. & Hol, W.G.J. (1991) Calcium binding of
thermitase. Crystallographic studies of thermitase at 0, 5, and 100
mM calcium. J. Biol. Chem. 266, 2953–2961.
56. Lin, S.J., Yoshimura, E., Sakai, H., Wakagi, T. & Matsuzawa, H.
(1999) Weakly bound calcium ions involved in the thermostability
of aqualysin I, a heat-stable subtilisin-type protease of Thermus
aquaticus YT-1. Biochim. Biophys. Acta 1433, 132–138.
57. Mu
¨
ller, A., Hinrich, W., Wolf, W.M. & Saenger, W. (1994)
Crystal structure of calcium-free proteinase K at 1.5 A
˚
resolution.
J. Biol. Chem. 269, 23108–23111.
58. Betzel, C., Gourinath, S., Kumar, P., Kaur, P., Perbandt, M.,
Eschenburg, S. & Singh, T.P. (2001) Structure of a serine protei-
nase proteinase K from Tritirachium album limber at 0.98 A
˚
resolution. Biochemistry 40, 3080–3088.
59. Kurosaka, K., Ohta, T. & Matsuzawa, H. (1996) 38 kDa pre-
cursor protein of aqualysin I (a thermophilic subtilisin-type pro-
tease) with a C-terminal extended sequence: its purification and
in vitro processing. Mol. Microbiol. 20, 385–389.
60. Cunningham, E.L., Jaswal, S.S., Sohl, J.L. & Agard, D.A. (1999)
Kinetic stability as a mechanism for protease longevity. Proc. Natl

Acad.Sci.USA96, 11008–11014.
61. Lee, Y.C., Koike, H., Taguchi, H., Ohta, T. & Matsuzawa, H.
(1994) Requirement of a COOH-terminal pro-sequence for the
extracellular secretion of aqualysin I (a thermophilic subtilisin-
type protease) in Thermus thermophilus. FEMS Microbiol. Lett.
120, 69–74.
62. Tsujibo, H., Miyamoto, K., Tanaka, K., Kaidzu, Y., Imada, C.,
Okami, Y. & Inamori, Y. (1996) Cloning and sequence analysis
of a protease-encoding gene from the marine bacterium
Alteromonas sp. starin O-7. Biosci. Biotechnol. Biochem. 60, 1284–
1288.
63. Peek, K., Daniel, R.M., Monk, C., Parker, L. & Coolbear, T.
(1992) Purification and characterization of a thermostable pro-
teinase isolated from Thermus sp. strain Rt41A. Eur.J.Biochem.
207, 1035–1044.
64. Haney, P.J., Badger, J.H., Buldak, G.L., Reich, C.I., Woese,
C.R. & Osen, G.J. (1999) Thermal adaptation analyzed by
comparison of protein sequences from mesophilic and extremely
thermophilic Methanococcus species. Proc. Natl Acad. Sci. USA
96, 3578–3583.
65. Argos, P., Rossmann, M.G., Grau, U.M., Zuber, H., Frank, G. &
Tratschin, J.D. (1979) Thermal stability and protein structure.
Biochemistry 18, 5698–5703.
Ó FEBS 2002 Characterization of a cloned psychrotrophic proteinase (Eur. J. Biochem. 269) 5545
66. Mene
´
ndez-Arias, L. & Argos, P. (1991) Engineering protein
thermal stability. Sequence statistics point to residue substitutions
in a-helices. J. Mol. Biol. 206, 397–406.
67. Matthews, B.W., Nicholson, H. & Becktel, W.J. (1987) Enhanced

protein thermostability from site-directed mutations that decrease
the entropy of unfolding. Proc. Natl Acad. Sci. USA 84, 6663–
6677.
68. Vielle, C., Burdette, D.S. & Zeikus, J.G. (1996) Thermozymes.
Biotechnol. Ann. Rev. 2, 1–83.
69. Thompson, M.J. & Eisenberg, D. (1999) Transproteomic evidence
of a loop-deletion mechanism for enhancing protein thermo-
stability. J. Mol. Biol. 290, 595–604.
70. Matsuzawa, H., Tokugawa, K., Hamaoki, M., Mizoguchi, M.,
Taguchi, H., Terada, I., Kwon, S.T. & Ohta, T. (1988) Purification
and characterization of aqualysin I (a thermophilic alkaline serine
protease) produced by Thermus aquaticus YT-1. Eur.J.Biochem.
171, 441–447.
5546 J. Arno
´
rsdo
´
ttir et al. (Eur. J. Biochem. 269) Ó FEBS 2002