Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx

Domain IV of mouse laminin b1 and b2 chains
Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue
contents
Takako Sasaki
1
, Karlheinz Mann
1
, Jeffrey H. Miner
2
, Nicolai Miosge
3
and Rupert Timpl
1
1
Max-Planck-Institut fu
È
r Biochemie, Martinsried, Germany;
2
Renal Division and Department of Cell Biology and Physiology,
Washington University School of Medicine, St Louis, MO, USA;
3
Center of Anatomy, Department of Histology, University
of Go
È
ttingen, Germany
Domain IV, consisting of abo ut 230 residues, represents a
particular protein module so far found only in l aminin b1
and b2 c hains. Both domains were obtained by r ecombi-
nant production in mammalian cells. They showed a
globular structure, as expected from electron microscopic
examination of laminins. Fragment b1IV w as obtained as a

monomer and a disul®de-bonded dimer, a nd both were
modi®ed t o  50% b y a single chondroitin sulfate chain
attached to Ser721 of an SGD consensus sequence.
Dimerization is caused by an odd number of cysteines,
with three of them having a par tial thiol character.
Whether both modi®cations also occur in tissue forms of
laminin remains to be established. Fragment b2IV was
only obtained as a monomer, as it lacked one crucial
cysteine and the SGD sequence. It required, however, the
presence of two adjacent LE modules for p roper folding.
Polyclonal antibodies raised against both fragments
showed no cross-reaction with each other and allowed
establishment of b chain-speci®c radioimmunoassays and
light and electron microscopic immunostaining of t issues.
This demonstrated a 5±25-fold lower content of b2com-
pared with b1 chains in various tissue extracts of adult
mice. Tissues derived from b2-de®cient mice failed to react
with the b2-speci®c antibodies but showed a twofold higher
content of b1 than heterozygotes. The antibodies to b2
showed broader tissue staining t han reported previously,
including in particular a distinc t reaction with the extra-
synaptic endomysium of skeletal muscle. Immunogold
staining localized both b chains primarily to basement
membranes of kidney, muscle and various other tissues.
Keywords: basement membranes; chondroitin sulfate;
laminin domain; radioimmunoassay; recombinant p ro-
duction.
Laminins represent a family of heterotrimeric proteins (abc)
which are mainly localized in basement membranes and
involved in cell±matrix and various other protein interac-

tions. Fifteen different isoforms are so far known, laminin-1
to laminin-15, based on the assembly of different a1toa5,
b1tob3andc1toc3 chains [1±3]. These chains share a 600-
residue domain II,I which oligomerizes into a rod-like
coiled-coil structure forming the long arm of laminins. The
N-terminal short arms and C-terminal G domains, however,
are composed of laminin-type LE, L4, LN and LG
modules, which form rod-like or globular structures in
various combinations [1,4]. Most of these modules are also
shared by seve ral other extracellular proteins s uch as t he
proteoglycans perlecan and agrin. A few other domains are
so far unique to laminins and include domain IV of the b1
and b2 chain. Only b1IV h as so fa r been obt aine d as a
proteolytic fragment [5].
Ten of the laminin isoforms contain either the b1or
b2 chain in combination with c1 and one of the ®ve a chains
[6±8]. These two b chains consis t o f about 1760 residues,
have an identical modular structure, and show about 50%
sequence identity [9,10]. Their mRNAs are expressed at
different levels in a large number of tissues [10,11], produced
by a variety of cultured cells, and, as shown by antibody
staining, encode proteins found in various basement mem-
branes [12±16]. Their distribution can change during
embryonic development, particularly in aorta, kidney and
skeletal mu scle. The b2 chain was actually discovered in a
search for proteins that are speci®c for neuromuscular
synapses [9] and this restriction has been con®rmed in
subsequent studies of mouse [15] but not human tissues
[17±19].
Little evidence is, however, available on potential func-

tional differences between b1andb2 chains. Laminins
containing either variant were shown to promote in an
equivalent manner cell adhesion [6] and neurite outgrowth
[7]. These activitie s are attributed to the shared a chains and
apparently not modulated by different b chains. The
analysis of chimeric b chains provided evidence that a
16-residue sequence close to the C-terminus of domain I is
directing the synaptic localization of b2-containing laminins
[20]. A Leu-Arg-Glu sequence in a similar region of
b2 chain was also claimed to provide a speci®c stop signal
for neurons [21]. This sequence seems, however, not to be
active when installed in a native coiled-coil conformation
[22]. A particular role for t he b2 chain was also emphasized
Correspondence to R. Timpl, Max-Planck-Institut fu
È
rBiochemie,
Am Klopferspitz 18A, D-82152 Martinsried, Germany.
Fax: + 49 89 8578 2422, Tel.: + 49 89 8578 2440,
E-mail:
(Received 8 august 2001, revised 31 October 2001, accepted 7
November 2001)
Eur. J. Biochem. 269, 431±442 (2002) Ó FEBS 2002
by gene knock-out studies, which demonstrated in mice
distinct de®ciences in neuromuscular synapses and glomer-
ular ®ltration [23,24].
In this study, we have used recombinant production of
domain IV in mammalian cells to explore further structural
and tissue differences of the b1andb2 chain. This revealed
glycosaminoglycan modi®cation a nd disul®de-dependent
dimerization of b1IV but not of b2IV, which could be

readily explained by sequence differences. This also allowed
development of sensitive and speci®c immunological assays
for both b chains that are useful for quantitative analyses
and examination of their distrib ution in tissue s.
MATERIALS AND METHODS
Sources of proteins
Laminin-1, in complex with nidogen-1 and its elastase
fragment E10, were obtained from a mouse tumor basement
membrane [5,25]. Other recombinant fragments of mouse
laminins included a1IVa [26], b1VI//V and b3VI/V (unpub -
lished) which were prepared by established procedures [27].
Construction of expression vectors and cell transfections
The templates used were a complete mouse b1 cDNA
(plasmid no. 1609) provided by Y. Yamada (NIDR,
Bethseda, MD, USA), and for b2IV we used RNA from
embryonic mouse endothelial cells provided by A. Hatzo-
poulos (GSF, Munich, Germany). T he sense and antisense
primers for b1 were GTCAGCTAGCTAACGAGGTGG
AGTCCGGTTAC and GTCACTCGAGCTAAAGGCC
CGTCTGGTGAATCAAG, respectively, and for b2GTC
AGCTAGCCCGTCCCTGTGACTGTGATG and GTC
ACTCGAGCTAGGCTTGACAGCCTGCAGGG,
respectively. They were used for ampli®cation by PCR and
RT-PCR, respectively. These primers introduced at the 5¢
end an NheIsiteandatthe3¢ end a stop codon followed by
an XhoI site to allow insertion into the episomal expression
vector pCEP-Pu containing the BM-40 signal peptide [28]. A
Ser721Ala mutation was introduced into b1IV by fusion
PCR [29].These vectors were used to t ransfect 293-EBNA
cells, and serum-free medium was collected from these cells

[28].
Puri®cation of recombinant proteins
Conditioned medium was passed over a DEAE-cellulose
column equilibrated in 0.05
M
Tris/HCl, pH 8.6, and eluted
with a line ar 0±0.6
M
NaCl gradient. The ef¯uent was
monitored at 280 nm an d by a carbazole assay [30].
Fragment b1IV was eluted at 0.2±0.3
M
and 0.3±0.4
M
NaCl, whereas most of fragment b2IV did not bind to the
column. They were both puri®ed on a Superose 12 column
(HR 16/50) equilibrated in 0.2
M
ammonium acetate,
pH 6 .8. Fragment b2IV was then bound to a Mono Q
column in 0.02
M
Tris/HCl, pH 8.0, and eluted with 0.03±
0.05
M
NaCl.
Characterization of protein structures
Cleavage with CNBr was p erformed in 70% f ormic acid
(24 h at 23 °C) in the dark under nitrogen. The fragments
were separated by size-exclusion chromatography on a

Superdex Peptide column (Amersham-Pharmacia; HR 10/
30) in 0.1% tri¯uoroacetic acid/25% acetonitrile. Further
cleavage at enzyme/substrate ratios of 1 : 100 with trypsin
or endoproteinase Lys-C in 0 .2
M
NH
4
HCO
3
or with pepsin
in 0.1
M
glycine/HCl, pH 1.9 (23 °C, 15 h) was followed by
Superdex chromatography and/or HPLC on a C
18
column
[31]. Differential alkylation with 4-vinylpyridine or iodoac-
etate after partial and complete reduction with dithioth reitol
in 0.05
M
Tris/HCl, pH 8.5, and 6
M
guanidinium hydro-
chloride/0.05
M
Tris/HCl, pH 8.5, respectively, followed a
previously used procedure [32]. Digestion with chondroitin-
ases ABC, AC or B (Sigma) followed a previous protocol
[33].
Analytical methods

Hydrolysis with 6
M
or 3
M
HCl (16 h, 110 °C) was used to
determine protein and hexosamine contents on an LC3000
analyzer (Biotronic). E dman degradation was performed on
Applied Biosystems sequencers 473 and 492 following the
manufacturer's instructions. The recovery of pyridylethylcy-
steines and carboxymethylcysteines was e stimated from the
height of the respective phenylthiohydanto in derivatives in
the corresponding sequencer runs. Electron microscopy of
rotary shadowed proteins [34], CD, and matrix-assisted laser
desorption ionization MS [35] followed standard protocols.
Immunological methods
Generation of rabbit antisera, af®nity puri®cation of
antibodies, ELISA titration, and radioimmunoassays fol-
lowed established protocols [36]. A radioimmuno-inhibition
assay speci®c for recombinant mouse laminin fragment
c1III3-5 using antiserum against laminin fragment P1 has
been described [37]. Immunoblotting using ECL Western-
blotting reagents followed a previous procedure [38]. Mouse
Engelbreth-Holm-Swarm (EHS) tumor and tissues from
adult mice and 18-day-old pups heterozygous for (b2+/±)
or lacking (b2 ±/±) the laminin b2 chain gene [23] were
extracted with EDTA-containing buffers and then deter-
gents; this was followed by digestion with bacterial colla-
genase [39]. These extracts were then used at dilutions o f
1 : 10 and higher for radioimmuno-inhibition assays.
Immuno¯uorescence staining of frozen tissue sections

folllowed previously used procedures [8,15]. Gold p articles
(16 n m) were used to label af®nity-puri®ed rabbit antibodies
as described [40]. Tissue s ections on nickel grids w ere
incubated for 15 min with NaCl/P
i
,pH7.2,andthen
labeled gold diluted 1 : 200 for 16 h at room temperature.
Sections were rinsed with water, stained with uranyl acetate
(15 m in) and lead citrate (5 min), and examined with a Zeiss
EM 109 electron microscope. Controls included colloidal
gold alone or samples coated with goat anti-(rabbit Ig) IgG
or anti-(rat Ig) IgG and were all negative.
RESULTS
Expression and puri®cation of recombinant domain IV
from mouse laminin b1 and b2 chain
Domain IV of t he b1 (position 541±771) and b2 (position
556±782) chains correspond to the central globular domain
432 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
in the short arm of these laminin chains [2] (Fig. 1B). They
are of similar size and share 41% identical residues including
four out of ®ve cysteines and 2 9% conservative replace-
ments (Fig. 1A). Features unique to b1IV are single
potential acceptor sites for N-glycosylation and glycosami-
noglycan attachment, respectively. Episomal expression
vectors were prepared for both domains in order to obtain
them as recombinant fragments from serum-free culture
medium of transfected human kidney 293-EBNA cells.
Production and secretion of fragment b1IV occurred at h igh
rates (150±170 lgámL
)1

áday
)1
) as shown by radioimmuno-
assay (see below), whereas no protein could be detected after
transfection with the b2IV expression vector corresponding
to the sequence shown in Fig. 1 A. This indicated a protein-
folding p roblem, which was overcome b y adding two
laminin-type epidermal g rowth factor-like (LE) modules to
the N-treminus and C-terminus of b2IV (LE5, position 523±
555; LE6, position 783±831, see Fig. 1B), allowing produc-
tion of this longer fragment at a moderate level (5 lgámL
)1
á
day
)1
). This fragment will be referred to as b2IV.
The initial puri®cation of fragment b1IV on DEAE-
cellulose showed it to be present in about equal proportions
in two pools e luted at 0.2±0.3
M
NaCl (pool 1) and 0.3±
0.4
M
NaCl (pool 2). Pool 1 consisted mainly of a 34-kDa
band, as expected for a b1IV monomer, and about equal
amounts of a disul®de-bonded b1IV dimer (66 kDa), which
could be separated by molecular sieve chromatography as
shown by e lectrophoresis (Fig. 2, lanes 1 and 3). P ool 2
coincided with a strong carbazole reaction for uronic acids,
Fig. 1. Sequence alignment of domain I V (A) from mouse laminin b1

(top) and b2 (bottom) chains and domain structure of the laminin b1 and
b2 chains (B). (A) Both sequences show 41% identity (bars) and 29%
conservative changes (dots). Cysteines are numbered 1±5 in b1 and 1±4
in b2, and carbohydrate attachment motifs (SGD, N YT) are high-
lighted in bold. Asterisks mark corrections to the pub lished genomic
sequence of mouse b2 [43]. An arrowhead indicates the start of frag-
ment E10 [5]. The numbering includes the signal peptides. (B) Laminin
b1andb2 chains have the same domain structures consisting of LN
and LE (circles) modules, domain IV, and a coiled-coil (cc) domain
II,I.
Fig. 2. SDS/PAGE of puri®ed recombinant fragments c ontaining
domain IV of b1orb2 chain under nonreducing (A) and reducing (B)
conditions. Lanes were loaded with equal amounts of b1IV monomer
(1), b2IV (2), b1IV dimer (3), b1IV substituted with chondroitin sulfate
before (4) and after (5) digestion with chondroitinase ABC, and b1IV
mutant S721A monomer form (6). Positions of calibrating proteins are
showninkDaontheleft.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 433
indicating the presence of a proteoglycan. The correspond-
ing b1IV fragment was eluted in front of the b1IV dimer
from a molecular sieve and showed a broad electrophoretic
band mainly in the range 70±110 kDa, which could be
converted into the monomer and dimer bands after
treatment with chondroitinase ABC (Fig. 2, lanes 4 and 5).
Recombinant fragment b2IV did not bind to DEAE-
cellulose and s howed, after molecular s ieve chromatogra-
phy, a single band of 33 kDa (Fig. 2, lanes 2), indicating its
monomeric nature and lack of glycosaminoglycan mod i®-
cation. Edman degradation of the puri®ed recombinant
fragments showed a major single N-terminal sequence,

which was APLANEVESG for the b1 variants and
APLARPXD for b2IV, as expected from the vector
constructs. The ®rst four residues, respectively, were derived
from the foreign signal peptides introduced to allow
secretion of the proteins.
Structural characterization of the fragments
The proper folding of the recombinant fragments was
examined by several methods. Rotary shadowing followed
by electron microscopy showed small compact globular
shapes for b1IV monomers and dimers (not shown) and
b2IV (Fig. 3B). The same globule was also observed f or the
proteoglycan form of b1IV, but with some of the particles
being connected to a long faint thread-like structure
(Fig. 3 A). As t hese threads were not observed for b1
monomers and dimers, they probably represent the g lyco-
saminoglycan side chain. Proteolysis studies of b1IV
monomer showed no signi®cant change after trypsin
treatment (1±24 h), while elastase caused degradation to a
22-kDa fragment similar to the E10 fragment obtained from
elastase digests of laminin-1 [5]. Fragment b2IV, however,
was readily cleaved within 1±4 h by trypsin into fragments
smaller t han 20 kDa but was resistant to endoproteinase
Glu-C (data not shown). CD spectra of the b1IV monomer
showed a strong negative ellipticity at 209±220 nm, indicat-
ing about 30% a helix and only a small amount of
b structure (Fig. 4). The b2IV structure had only half the
a-helic al content, which may have become obscured
through the presence of two additional LE modules, which,
as shown previously, have only a small amount of
secondary structure [41].

Hexosamine analysis of b1IV monomer and dimer
showed 5±6 residues of glucosamine and less than one
galactosamine. That Edman degradation of various prote-
olytic peptides (see below) failed to identify Asn677,
indicating full occupation of the single N-linked a cceptor
site. The proteoglycan form of b1IV showed the same
glucosamine content, b ut a large increase in galactosamine
content (48 residues), which corresponds to about 19 kDa
of a glycosaminoglycan chain. Furthermore, digestion with
chondroitinases ABC (Fig. 2) and A,C but not by ch on-
droitinase B or heparitinase ( not shown) yielded t he b1IV
monomer and dimer bands, demonstrating the exclusive
substitution by chondroitin sulfate. The mean (SD) length
of the side chain was estimated from electron micrographs
of 30 particles to be 40 ( 10 nm), which is in good
agreement w ith a molecular m ass o f 20 k Da. M utation of
Ser721 to Ala did not interfere with recombinant produc-
tion of b1IV monomers (Fig. 2, lane 6) and dimers but
prevented completely the modi®cation by glycosaminogly-
cans, consistent with the a bsence of any oth er strong
acceptor site w ithin the b1IV sequence (Fig. 1). Fragment
b2IV lacked any of thes e substantial post-tr anslational
modi®cations, as d etermined b y M S, which yielded a
molecular m ass of 34 369 Da, in g ood agreement with a
mass of 34 357 calculated from the sequence.
The odd number of cysteines in b1IV indicated the
presence of a free thiol group, which is probably responsible
for dimerization. The native b1IV dimer was therefore ®rst
modi®ed b y partial reduction and p yridylethylation to
protect the thiol followed by complete reduction under

denaturing conditions and carboxymethylation. Peptides
were then generated by cleavage with endoproteinase Lys-C
followed by cleavage with some other proteases and
determination of the sequence around the ®ve cysteines
Fig. 3. Rotary shadowing electron microscopy of chondroitin sulfate-
substituted fragment b1IV (A) and fragment b2IV (B). Bar: 100 nm.
Fig. 4. CD spectra of recombinant domain IV from laminin b1 (full line)
and b2 (dashed line) chain.
434 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
(C1 to C5, Fig. 1A) by Edman degradation. The data
obtained showed complete carboxymethylation for C1 a nd
C2, while for C3, C4 and C5 there was also 20±25%
pyridylethylation. Dimeric b1IV was also cleaved w ith
CNBr giving rise to three single-chain peptides starting at
the N-terminus and positions 609 and 677, respectively. This
indicated C1±C2 connectivity, which was con®rmed by
Edman degradation of smaller pepsin fragments. The fourth
CNBr peptide showed two sequences starting as expected in
front of C3 and C5 and should also contain C4 (Fig. 1A). A
smaller pepsin fragment showed a c onnection between C3
and C5. Yet b ecause of the variable thiol content of C3 to
C5 (see above), we cannot exclude the possibility that the
disul®de connectivity is ¯exible, and we suggest that partial
formation of C3±C4 and C4±C5 bridges occur as well.
Immunochemical assays for domains b1IV and b2IV
and their application to the analysis of tissues
Many previous studies based mainly on immunohistology
have shown a complex and in part overlapping expression
pattern of laminin b1andb2 chains in adult tissues, during
embryonic development and in cultured cells (reviewed in

[2,16]). Several of the monoclonal antibodies against
b2chainweregeneratedinmiceandfailedtoreactwith
the corresponding mouse antigens [9]. To circumvent these
limitations and to allow quantitative assays, we generated
rabbit antisera against recombinant mouse b1IV and b2IV.
These antisera had high titers (half-maximal binding) at
dilutions of 1 : 4000 (anti- b1) and 1 : 20 000 (anti-b2) in
ELISA and radioimmunoassays and did not cross-react
(titer less than 1 : 100) with the homologous (b2orb1IV)
antigen or recombinant N-terminal fragments b1VI/V and
b3VI/V of mouse l aminin. T hey were also c learly distin-
guishable in immunoblots of several biological samples,
with anti-b1 reacting mainly with a 220-kDa band and anti-
b2 with a 190-kDa band after electrophoresis under
reducing conditions (data not shown).
The antisera allowed the development of speci®c and
sensitive radioimmuno-inhibition assays, with half-maximal
inhibition being achieved at 0.1±0.2 n
M
b1IV and b2IV,
respectively (Fig. 5). The b1IV assay was inhibited in nearly
identical manner by m onomeric and dimeric b1IV and the
proteoglycan form and by laminin-1 (a1b1c1) derived from
the mouse EHS tumor (Fig. 5A). Laminin-1 fragment E10
showed a less steep and incomplete i nhibition pro®le,
indicating the loss of some antigenic epitopes. A more t han
1000-fold excess of b2IV showed no inhibition (Fig. 5A),
and the same was found for recombinant laminin fragments
b1VI/V, b3VI/V and a1IVa (data not shown). Similarly, the
assay for b2IV could not be inhibited by a large excess of

b1IV (Fig. 5B). Both assays could, however, be inhibited by
tissue extracts, a s shown for m ouse heart and k idney
(Fig. 5), with inhibition curves similar in slope to that of the
reference inhibitors b1IV a nd b2IV, respectively. Together
the data showed that these assays were highly speci®c and
suitable for the quantitation of b1andb2 c hain epitopes in
biological samples.
The extracellular matrix of m ouse EHS t umor has
previously been shown to c onsist exclusively of basement
membrane, and its major component, laminin-1, could be
solubilized in decent amounts (5 mgág
)1
wet tissue) by
extraction with EDTA and 6
M
guanidine [25]. W e now
used this tumor and also mouse kidney and muscle for
successive extraction with EDTA and detergents followed
by digestion with chondroitinase/heparitinase and bacterial
collagenase, which solubilized nearly all of the tissue. The
extracts were analysed by the b1IV and b2IV assay and also
by an assay speci®c for the laminin c1 chain [37]. This
demonstrated that 71±93% of the extractable laminin c1, b1
and b2 chain were already s olubilized by EDT A and
detergent. Furthermore, the content of extractable lami-
nin-1 was calculated based on the c1andb1chainassayto
be 5.5±5.8 mgág
)1
EHS tumor, in agreement with previous
data. A larger number of a dult mouse tissues were then

extracted w ith EDTA a nd detergent only and examined by
these three assays (Table 1). A variable content of laminin
b1 chain [17±422 pmolá(g wet tissue)
)1
] and lower amounts
of b2 chain (4±20% of b1) were found. As expected, the
highest amounts of b1 chain were found in the EHS tumor,
while t he content of b2 chain did not exceed 0.2%. T he
amounts of c1 c hain were within the u sual range of
Fig. 5. Radioimmuno-inhibition assays speci®c for laminin b1 (A) and b2
(B) chains. The assay consisted of 1 ng
125
I-labeled fragment b1IV
monomer or b2IV and ®xed amounts of the corresponding antiserum.
Inhibitors used were b1IV monomer (n), chondroitin sulfate-sub sti-
tuted b1IV (,), b2IV ( m), mouse laminin-1 (s) and its E10 fragment
(h) at the concentrations shown at the bottom. E DTA extracts of
mouse heart (d) and kidney (j) were used at the dilutions shown at
the top.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 435
analytical error ( 20%) of such inhibition assays [36], in
most cases in good agreement with the sum of b1and
b2 chains. It served therefore as an internal control for the
quality of t he data. Tissue extracts of mice being de®cient in
the laminin b2 chain [23,24] were used as further controls
and failed to inhibit the b2 assay (content less than
0.5 p molág
)1
). Interestingly, these extracts s howed a twofold
increase in the b1 chain content when compared with

heterozygous (b2 +/±) controls (Table 1), indicating a
signi®cant increase in biosynthesis or mRNA stability.
Immunolocalization in tissues
The antiserum against recombinant mouse b2IV was tested
in immunohistochemical assays on a panel of mouse tissues
using indirect immuno¯uorescence (Fig. 6). The antiserum
revealed a more widespread distribution of laminin b2than
has previously been reported. In the k idney, it was
previously shown to be con®ned to glomerular and vascular
smooth m uscle basement membranes [9,12]. Here, it was
detected in these b asement membranes, but also i n most
intertubular capillaries and segmentally in some tubular
basement membranes ( Fig. 6A). In skeletal muscle ®bers, it
was concentrated at synapses but was also found extrasy-
naptically. In peripheral nerve, it was found in the
perineurium, as previously reported [9,12], but also in the
endoneurium. Blood vessels throughout skeletal muscle also
contained the b2 chain (Fig. 6B).
In the small intestine, b2 was detected in smooth muscle
and blood vessels and at a low level in the epithelial
basement membrane of the crypts (Fig. 6C). In lung, it was
present in basement membranes associated w ith bronchial
epithelium, bronchial smooth m uscle, and alveoli through-
out the p arenchyma (Fig. 6D). In the retina, b2was
detected in the inner limiting membrane, Bruch's mem-
brane, and in c apillary basement membranes, but was n ot
detected in the interphotoreceptor matrix or in other layers
of the retina (Fig. E). In h eart, b2 was found in cardio-
myocyte and vascular b asement membranes throughout
(Fig. 6 F).

One r eason f or the discrepancies between published
reports showing a restricted distribution of b2 and our
results showing a more widespread distribution could be
that the antiserum used here cross-reacts with another
laminin chain in immunohistochemical assays. To investi-
gate this possibility, we immunostained tissues from Lamb2
mutantmice(Fig.7).Thesemicehaveamutationthathas
been shown to prevent any accumulation of laminin b2in
basement membranes [23,24]. No signi®cant ¯uorescence
was f ound on staining mutant tissues with the a nti-b2IV
serum, whereas tissues from a littermate c ontrol w ere w ell
stained. This demonstrates that the antiserum reacts with
laminin b2 but with no other laminin chain and no other
basement membrane component.
Results from immunohistochemical assays using anti-b1
serum (data not shown) were mostly consistent with
previously published reports showing a widespread
(although not ubiquitou s) expression pattern for laminin
b1. For example, in skeletal muscle, b1 was detected in the
extrasynaptic muscle ®be r basement m embranes and in
endoneurial basement membranes. It was not observed at
synapses or in the perineurium, sites where b2 is known to
be concentrated [12]. In kidney, b1 was detected in all
tubular basement membranes and in the glomerular
mesangium. In addition, it was detected at a low level in
the glomerular basement membrane, a s ite where b2is
concentrated (Fig. 6). Together with ou r b2 immunohisto-
chemical results, these data suggest that many basement
membranes contain both laminin b1andb2chains.How-
ever, in most cases one appears to be much more prevalent

than the other.
Af®nity-puri®ed antibodies speci®c for b1IV or b2IV
were also used for ultrastructural localization of both
b chains in adult mouse tissues by immunogold staining
(Figs 8 and 9). This demonstrated for tubular and glomer-
ular basement membranes of kidney a distinct reaction with
both antibodies of about equal intensity (Fig. 8A±D) and of
basement membranes of c ollecting ducts, blood vessels and
Bowman's capsule. In the heart, some weaker staining was
observed in basement membranes adjacent to cardiomyo-
cytes and endothelial cells (Fig. 8E,F) and also in basement
membranes of t he endocardium and pericardium. Staining
of skeletal muscle identi®ed both b chains in endothelial and
muscle cell basement m embranes, whereas the adjacent
interstitial region did not react (Fig. 9A,B). A distinctly
stronger reaction for b2 was observed in the synaptic clefts
of neuromuscular junctions compared with extrasynaptic
regions (Fig. 9 C,D) and at myotendineous junctions. Other
basement membranes containing both b chains included the
dermal±epidermal junction and testis, whereas the dermal
connective tissue could not be stained.
DISCUSSION
Domain I V of lamin in b1andb2 represents a globular
structure in the central portion of the short arm region [1,2]
and h as not yet b een c haracterized at the structural and
functional level. We have now obtained these domains as
recombinant products from mammalian cells and demon-
strated t heir proper folding by electron microscopy, CD,
protease resistance, and immunochemical a nalysis. The
data also show that domain b1IV r epresents an autono-

mous folding unit and was produced at high rate. This was
Table 1. Contents [pmolá(g wet tissue)
)1
] of laminin c1, b1 and b2chains
in tissue extracts from normal adult and mutant (b2+/±;b2±/±)miceas
determined by radioimmuno-inhibition assays. Tissues were extracted
with EDTA-contain ing bu er and detergent and analyzed by assays
speci®c for recombin ant frag ments c1III3-5, b1IV and b2IV.
Tissue c1 b1 b2
EHS tumor 6935 6647 14
Placenta 510 422 14
Heart 567 343 35
Skeletal muscle 133 117 23
Intestine 97 104 4
Stomach 143 125 20
Thymus 44 66 6
Skin 16 17 3
Lung 225 176 12
Lung, b2 +/± 169 153 11
Lung, b2 ±/± 313 348 < 0.5
Kidney 84 106 8
Kidney, b2 +/± 101 140 9
Kidney, b2 ±/± 205 244 < 0.4
436 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
surprisingly not the case f or b2IV which needed two
additional LE modules for reasonable expression and
secretion. Similar observations have been reported for the
N-terminal globular LN module (domain VI) of the
laminin a1 chain, which could o nly be produced in
mammalian cells after it had been joined to a tandem of

four LE modules. The latter, however, folded properly o n
its own [27]. Another interesting observation is the
relatively high content o f a helix in b1IV and probably
b2IV. A high helix content has s o far only been demon-
strated for the coiled-coil domains I and II of laminins
[1,2], whereas o ther domains, such a s those composed of
Fig. 6. Immunohistochemical localization of laminin b2 chain in basement membranes of adult mouse tissues by antibodies against b2IV. (A) In kidney,
b2 is detected in basement membranes of glomerulus (g), large blood vessels (v), and most intertubular capillaries (arrows). Some segments of
tubular basement membran es are also stained. (B) In skeletal muscle, b2 is detected in basement membranes all around the muscle ®ber (f) as well as
the neurom uscular junction (arrowhead). In peripheral nerve (n), b2 is detected in both perineurial and e ndoneu rial basement membranes. (C) In
small intestine, b2 is detected primarily in basement membranes of s mooth muscle ( sm), large blood vessels ( v), and capillaries (arrows). Low levels
of b2 are detectable in basement membranes associated with crypts (c). (D) In lung, b2 is d etected in basement membran es of the bronchial
epithelium (e), bronchial smooth muscle (sm), and alveolar epithelium throughout the p arenchyma (p). (E) In retina, b2isdetectedintheinner
limiting membrane (ilm), Bruch's membrane (bm), and in capillaries (arrows). (F) In 3-w eek-old heart, b2 is detected in basement membranes
surrounding all cardiomyocytes, large vessels (v), and capillaries (arrows). Bar, 100 lmforA±C,F;50lmforD;75lmforE.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 437
LE or LG modules, essentially lack helical segments, as
shown by c rystallographic analyses [41,42]. T his suggests
novel folding f or do main IV, which can now be investi-
gated by X-r ay analysis of recombinant b1IV monomers
and dimers.
Additional differences between domain IV of b1and
b2 chains are related t o single amino-acid substitutions. A
single serine within an SGDG consensus sequence was
shown by site-directed mutagenesis (S721A) to be partially
substituted by a 20-kDa chondroitin sulfate chain i n both
the b1IV monomers and dimers. This sequence is changed in
b2IV of rat, mouse and hum an [9,43] to SGGD and
preceded by a four-residue gap (Fig. 1), w hich may explain
the failure to detect any glycosaminoglycan substitution in

recombinant b2IV. Yet an SGG site in perlecan domain V
[44] and three SGD sites in domain I [33,45] can serve as
acceptor sites for heparan sulfate/chondroitin sulfate, and
more remote sequences may regulate their complete or
partial occupation [45]. Special features of such regulations
may now be unravelled by site-directed mutagenesis of the
corresponding regions in b1IV and b2IV domains. O ur data
also indicate that tissue laminins containing b1chainsmay
Fig. 7 . Antiserum to laminin b2IV does not react with basement membranes in Lamb2 mutant tissues. Kidney (A and B) and skeletal muscle (C and D)
from 3-week-old Lamb2 +/+ and ±/± littermates were stained with anti-b2 serum. In the control, basement membranes throughout the kidney and
skeletal muscle were stained. Basement membranes at neuromuscular junctions (arrows in C) were more immunoreactive than were extrasynaptic
basement membranes. No immunoreactivity was detected in mutant tissues, demonstrating the speci®city of the antiserum. Neuromuscular
junctions were iden ti®ed by do uble lab eling with rho damine- a-bungarotoxin (C¢ and D¢). Bar, 100 lm.
438 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
be, at l east in part, converted i nto proteoglycans. This is
underscored by conservation of the SGD sequence in the
human laminin b1 chain [46], whereas the laminin b chains
of Drosophila [47] and Caenrhabditis elegans (accession no.
AAB 94193) lack this sequence and also differ in cysteine
patterns. Preliminary unpublished studies to identify such
forms in t issue extracts h ave, however, f ailed so f ar and
indicated only a low level of substitution or a speci®c
restriction to a few tissue sites. Yet we do not think that the
partial modi®cation of b1IV is an a rtefact o f r ecombinant
production because a similar low rate of substitution of
recombinant perlecan domain V correlated well with a
comparable low rate of modi®cation of two tissue forms of
perlecan [44].
An extra cysteine (C3 at position 710) in domain b1IV
not conserved i n b2IV w as a candidate to explain the

substantial d imerization o f recombinant b1IV. We there-
fore used stepwise reduction under nondenaturing and
denaturing conditions as previously used to identify a
single cysteine responsible for ®bulin-2 dimerization [32].
This provided clear evidence for a C1±C2 connectivity
within b1IV but failed to identify unequivocally C3, C4 or
C5 as being responsible for dimerization. This could
indicate the existence of various disul®de isomers, but we
Fig. 8. Immunogold staining of laminin b1 (A,C,E) and b2 (B,D,F) chain in basement membranes of kidney and heart of adult mice. Both antibodies
reacted equally well with the basement membrane of a proximal tubule (A,B; arrows) and with the glomerular basement membrane (C,D; asterisks).
In the heart (E,F) both chains could be detected in the basement membranes of cardiomyocytes (arrows) as well as of endothelial cells of an adjacent
capillary (asterisks). The capillary lumen (l) and the interstitial tissue between both basement membranes showed insigni®cant staining. Bars,
0.25 lm.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 439
cannot exclude the possibility that they represent artefacts
of the treatments used. Nevertheless, we also cannot
dismiss the possibility of t he disul®de -dependent dimeriza-
tion of laminins in which domain b1IV participates. Such
complexes between laminin-5 (a3b3c2) and laminin-6
(a3b1c1) are known to exist in certain basement mem-
branes [48] or may be generated upon self-assembly of
laminins into networks, which occurs through their
N-terminal regions including the b1 chain [49].
Laminin b1andb2 chains have been localized by
immunohistology a t the light microscopy level to a large
variety of tissues, but not necessarily to the same subana-
tomical regions, which has generated several controversial
observations (reviewed in [16]). We have now prepared
potent polyvalent antisera against the natively folded
fragments b1IV and b2IV in order to re-examine s ome of

the previous data and to e stablish more qu antitative and
sensitive assays. The rabbit antisera obtained showed a high
speci®city for b1andb2 chains, respectively, as demon-
strated by ELISA, radioimmunoassay, and immunoblot.
This was underscored by the failure to show any reactivity
of antibodies to b2 with tissues d erived from b2-de®cient
mice. Speci®c radioimmuno-inhibition assays of high sen-
sitivity (IC
50
 0.1±0.2 n
M
) were developed and showed
both b chains and equivalent levels of laminin c1chainsin
EDTA/detergent extracts of various mouse tissues. The
content of b1 chains in these extracts exceeded the conten t
of b2 by a factor of 5±20. The relative amounts of b2were
particularly high in skeletal muscle, consistent, a s shown
here and previously, f or developing and adult human
muscle [17], by distinct staining of extrasynaptic areas of
muscle basement membranes. The radioimmunoassay data
are also inconsistent with restriction to synapses, as shown
in rats by monoclonal antibodies [9,15], considering the low
density of s ynaptic junction s (usually accoun ting for less
than 0.1% of the total basement membranes). The radio-
immunoassays also indicated a twofold higher content of b1
chain in lung and kidney of b2-de®cient mice compared with
littermate controls. Such upregulation was previously
predicted from immunostaining of kidneys, but it did not
lead to functional compensation [24].
This is the ®rst extensive examination of b2 distribu-

tion in mouse tissues, most other studies having utilized
rat, rabbit and human tissues. Thus, there could be
differences in b2 distribution among species. However,
restricted distribu tion of b2 in mouse kidney and skeletal
muscle has been reported [ 15,23,24], and we have
observed widespread expression of b2inratmuscle
using anti-b2IV serum (data not shown). One possible
explanation is that many laminin b2 monoclonal anti-
bodies that have been produced may r ecognize a speci®c
form of b2 found primarily in glomerular, synaptic,
perineural, and smooth muscle basement membranes.
This could result f rom selective glycosylation, con forma-
tional alteration, or association with a speci®c a chain.
Indeed, laminin a5 is also found in these basement
Fig. 9. Immunogold staining of laminin b1(A)andb2 (B±D) in extrasynaptic and synaptic regions of skeletal muscle from adult mice. Both antibodies
(A,B) stained the basement membrane around myocytes (arrows) and the endothelium of a capillary (asterisks). The arrowhead indicates some
staining close to a pericyte. l, C apillary lumen. (C,D) shows some stronger staining for b2 of the synaptic cleft (asterisks) than for the extrasynaptic
part (arrowheads). Bars, 0.25 lm.
440 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002
membranes and is thought to be associated with b2in
the laminin-11 trimer. Alternatively, these antibodies may
only recognize the highest concentrations of b2. Consis-
tent with this, anti-b2IV serum stains basement mem-
branes recognized by the other antibodies more intensely
than it stains other b asement membranes.
Our r esults agree with t hose o f Wewer and colleagues
[17], who found extrasynaptic deposition of b2 in human
skeletal muscle basement membranes using several m on-
oclonal and polyclonal a ntibodies. Furthermore, i n
embryonic rat, Durbeej et al. [50] identi®ed a subset of

b2 protein that was detectable on immunoblots but not in
immunohistochemical assays, suggesting that a subset of
b2 in tissue cannot be recognized by some antibodies
known to react with b2. However, in retina, b2hasbeen
shown to have a more widespread distribution than we
observed here, as it was also found in the interphotore-
ceptor matrix and in the outer plexiform layer [3,51]. As
these layers do not contain basement membranes, it is
possible that our anti-b2IV serum did not recognize b2in
these layers because o f a speci®c supramolecular organi-
zation which may mask most of the antigenic epitopes of
domain b2IV.
We have also extended the tissue localization of laminin
b1andb2 chains to t he ultrastructural level b y using
immunogold staining, which has not been examined in
previous studies. This was particularly important for
skeletal muscle, which showed immunogold staining for
the laminin a2 chain in muscle and c apillary basement
membranes, whereas most of the laminin a4chainwas
localized to adjacent interstitial regions of the endomysium
[52]. A similar restriction to basement membran es o f muscle
and capillaries was h ere found for t he b1andb2chain.
Comparable staining for both b chains was also found for
tubular, glomerular, and s ome other renal basement mem-
branes. An interesting ®nding was that staining for b2was
distinctly more intense at the junctional folds of synapses
than at the extrasynaptic basement membranes. This
indicates a higher epitope density or accessibility an d may
explain why certain monoclonal antibodies against b2 show
restricted synaptic staining [9,15]. A higher synapse-speci®c

accumulation of b2 chain-containing laminins based on a
particular recognition sequence [20] would also be compat-
ible with a neuromuscular phenotype found in b2-de®cient
mice [23].
ACKNOWLEDGEMENTS
We are g rateful f or the excellent technical assistance of Hanna
Wiedemann, Mischa Reiter, Vera van Delden, Christa Wendt, Cong
Li, and Albert Ries, and thank Y. Yamada and A. Hatzopoulos for
providing reagents. The study was supported by grants from DFG (Ti
95/8-1) and the EC project QLK3-CT2000-00084.
REFERENCES
1. Sasaki, T. & Timpl, R. (1999) Laminins. I n Guidebook to the
Extracellular Matrix, Anchor and Adhesion Proteins (Kreis T. &
Vale R., eds), 2nd edn, pp. 434±443. Oxford University Press,
Oxford.
2. Colognato, H. & Yurchenco, P.D. (2000) Form and function: the
laminin family of heterotrimers. Dev. Dyn. 218, 213±234.
3. Libby, R.T., Champliaud, M F., Claudepierre, T., Koch, M.,
Burgeson,R.E.,Hunter,D.D.&Brunken,W.J.(2000)Laminin
expression in adult and developing retinae: evidence of two novel
CNS laminins. J. Neurosci. 20, 6517±6528.
4. Engel, J. & Bozik, D . (1999) Modules in ECM and adhesion
molecules. In Guidebook to the Extracellular Matrix, Anchor and
Adhesion Proteins (Kreis T. & Vale R., eds), 2nd edn, pp. 344±351.
Oxford University Press, Oxford.
5. Mann, K., Deutzmann, R. & Timpl, R. (1988) Characterization of
proteolytic fragments of th e laminin-nidogen complex and their
anity in ligand binding assays. Eur. J. Biochem. 178, 71±80.
6. Brown, J.C., W iedemann, H. & Timpl, R. (1994) Protein binding
and cell adhesion properties of two laminin isoforms (AmB1eB2e,

AmB1sB2e ) from h uman pla centa . J. Cell Sci. 107, 329±338.
7. Brandenberger, R. & Chiquet, M. (1995) Distinct h eparin-binding
and n eurite-promoting properties of laminin isoforms isolated
from chick heart. J. Cell Sci. 108, 3099±3108.
8. Miner, J.H., Patton, B .L., Lentz, S.I., Gilbert, D.J., Snider, W.D.,
Jenkins, N.A., Copeland, N.G. & Sanes, J.R. (1997) The laminin a
chains: expression, developmental transitions, an d chromosomal
locations of a1±5, identi®cation o f heterotrimeric laminins 8±11
and cloning of a novel a3 isoforms. J. Cell Biol. 137, 685±701.
9. Hunter, D .D., Shah, V., Merlie, J.P. & Sanes, J.R. (1989) A
laminin-like adhesive protein concentrated in the synaptic cleft of
the neuromuscular junction. Nature (London) 338, 229±234.
10. Iivanainen, A., Vuolteenaho, R., Saino, K., Eddy, R., Shows,
T.B., Sariola, H. & Tryggvason, K. (1994) The human laminin b2
chain ( s-laminin): structure, expression in fetal tissues and
chromosomal assignment of the LAMB2 gene. Matrix Biol. 14,
489±497.
11. Wewer, U.M., Gerecke, D.R., Durkin, M.E., Kurtz, K.S., Mattei,
M G., Champliaud, M.F., Burgeson, R.E. & Albrechtsen, R.
(1994) Human b2 chain of laminin (formerly s chain): cDNA
cloning, chromosomal localization, and expression in carcinomas.
Genomics 24, 243±252.
12. Sanes, J.R., Engvall, E., Butkowski, R. & Hunter, D.D. (1990)
Molecular heterogeneity of basal laminae: isoforms of laminin and
collagen IV at the neuromuscular j unctio n and elsewhere. J. Cell
Biol. 111, 1685±1699.
13. Wewer, U .M., Engvall, E., Paulsson, M., Yamada, Y. & Albr-
echtsen, R. (1992) Laminin A, B1, B2, S and M subunits in the
postnatal rat liver development and after partial hepatectomy.
Lab. Invest. 66 , 378±389.

14. Glukhova, M., Koteliansky, V ., Fondacci, C., Marotte , F. &
Rappaport, L. (1993) Laminin variants and integrin laminin
receptors in develop ing and adult human smooth muscle. Dev.
Biol. 157, 437±447.
15. Patton,B.L.,Miner,J.H.,Chiu,A.Y.&Sanes,J.R.(1997)Dis-
tribution and function of lamin ins in the neuromuscular system of
developing, addult an d mutant mice. J. Cell Biol. 139, 1507±1521.
16. Gullberg, D., Tiger, C .F. & Velling, T. (1999) Laminins during
muscle development and in muscular dystrophies. Cell.Mol.Life
Sci. 56, 442±460.
17. Wewer,U.M.,Thornell,L.E.,Loechel,F.,Zhang,X.,Durkin,
M.E. & Amano, S. (1997) Extrasynaptic location of laminin b2
chain in developing and adult human muscle. Am.J.Pathol.151,
621±631.
18. Cohn, R.D., H errmann, R., Wewer, U.M. & Voit, T. (1997)
Changes of laminin b2 chain expression in congenital muscular
dystrophy. Neuromuscul. Disord. 7, 373±378.
19. Cohn, R.D., Herrmann, R., Sorokin, L., Wewer, U.M. & Voit, T .
(1998) Laminin a2 chain-de®cient congenital muscular dystrophy:
variable epitope expression in severe and mild cases. Neurology 51,
94±100.
20. Martin, P.T., Ettinger, A.J. & Sanes, J .R. (1995) A synaptic
localization domain in the synaptic c left protein laminin b2
(s-laminin). Science 269, 413±416.
21. Porter, B.E., Weis, J. & Sanes, J.R. (1995) A motoneuron-selective
stop signal in the synaptic protein s-laminin. Neuron 14, 549±559.
Ó FEBS 2002 Laminin b1 and b2 chains (Eur. J. Biochem. 269) 441
22. Brandenberger, R., Kammerer, R.A., Engel, J. & Chiquet, M.
(1996) Native chick laminin-4 containing the b2-chain (s-laminin)
promotes motor axon growth. J. Cell Biol. 135, 1583±1592.

23. Noakes, P.G., Gautam, M., Mudd, J., Sanes, J.R. & Merlie, J.P.
(1995) Aberrant dierentiation of neuromuscular junctions in
mice lacking s-laminin/laminin b2. Nature (London) 374, 258±262.
24. Noakes, P.G., Mine r, J.H., Gautam, M., Cunningham, J.M.,
Sanes, J.R. & Merlie, J.P. (1995) The renal glomerulus of m ice
lacking s-laminin/laminin b2: nephrosis despite molec ular com-
pensation by laminin b1. Nat. Genet. 10, 400±406.
25. Paulsson, M., Aumailley, M., Deutzmann, R., Beck, K. & Engel, J.
(1987) Laminin±nidogen complex: extraction with chelating agents
and structural characterizatio n. Eur. J. Biochem. 16 6, 11±19.
26. Schulze, B., Mann, K., Po
È
schl, E., Yamada, Y. & Timpl, R. (1996)
Structural and functional analysis of the globular domain IVa of
the laminin a1 chain and its impact on an adjacent RGD site.
Biochem. J. 314, 847±851.
27. Ettner, N., Go
È
hring, W., Sasaki, T., Mann, K. & Timpl, R. (1998)
The N-terminal globular domain of the laminin a1 chain binds to
a1b1anda2b1 integrins and the h eparan sulfate-containing
domains of perlecan. FE BS Lett. 43 0, 217±221.
28.Kohfeldt,E.,Maurer,P.,Vannahme,C.&Timpl,R.(1997)
Properties of the e xtracellular calcium binding module of the
proteoglycan testican. FEBS L ett. 414, 557±561.
29. Vallejo, A.N., Pogulis, R.J. & Pease, L.R. (1994) In vitro synthesis
of novel genes: mutagenesis and recombination by PCR. PCR
Methods Applic. 4, 123±130.
30. Bitter, T. & M uir, H. (1962) A modi®ed uronic acid carbazole
reaction. Anal. Biochem. 4, 330±334.

31. Mayer, U., Aumailley, M., Mann, K., Timpl, R. & Engel, J. (1991)
Calcium-dependent binding of basement membrane protein BM-
40 (osteo nectin, SPARC) to basement membran e collagen type
IV. Eur. J. Biochem. 198, 141±150.
32. Sasaki, T., Mann, K., Wiedemann, H., Go
È
hring, W., Lustig, A.,
Engel, J., Chu, M L. & Timpl, R. (1997) D imer model for the
micro®brillar protein ®bulin-2 and identi®cation of the connecting
disul®de bridge. EMBO J. 16, 3035±3043.
33. Costell, M., Mann, K., Yamada, Y. & Timpl, R. (1997) Charac-
terization o f recombinant perlecan domain I an d its substitution
by glycosam inoglyca ns and oligo sacch arides . Eur. J. Bio chem.
243, 115±121.
34. Engel, J. (1994) Electron microscopy of extracellular m atrix
components. Methods Enzymol. 245, 469±488.
35. Mann, K., Mechling, D.E., Ba
È
chinger, H P., Eckerskorn, C.,
Gaill, F. & Timpl, R. (1996) Glycosylated threonine but not 4 -
hydroxyproline dominates the triple helix stabilizing positions
in the sequence of a hydrothermal vent worm cuticle collagen.
J. Mol. Biol. 261, 255±266.
36. Timpl, R. (1982) Antibodies to collagens and procollagens.
Methods Enzymol. 82, 472±498.
37. Mayer, U., Nischt, R., Po
È
schl, E., Mann, K., Fukud a, K., Gerl,
M., Y amada, Y. & Timpl, R. (1993) A single EGF-like motif of
laminin is responsible for high anity nidogen binding. EMBO J.

12, 1879±1885.
38. Sasaki,T.,Wiedemann,H.,Matzner,M.,Chu,M L.&Timpl,R.
(1996) Expression of ®bulin-2 by ®broblasts and deposition with
®bronectin into a ®brillar matrix. J. Cell Sci. 109, 2895±2904.
39. Miosge, N., Sasaki, T. & Timpl, R. (1999) Angiogenesis inhibitor
endostatin is a d istinct co mponent of elastic ®bers in vessel walls.
FASEB J. 13, 1743±1750.
40. Miosge, N., Quondamatteo, F., Klenczar, C. & Herken, R. (2000)
Nidogen-1: expression and ultrastructural loc aliza tion during
the onset of mesoderm formation in the early mouse embryo.
J. Histochem. Cytochem. 48, 229±237.
41. Stetefeld, J., Mayer, U., Timpl, R. & Huber, R. (1996) Crystal
structure of three consecutive laminin-type epidermal growth
factor-like (LE) modules of laminin c1 chain harbor ing the nid-
ogen binding site . J. Mol. Biol. 257, 644±657.
42. Tisi, D., Talts, J.F., Timpl, R. & Hohenester, E. (2000) Structure
of the C-terminal LG domain pair of the laminin a2 chain har-
bouring binding sites for a-dystroglyc an and heparin. EMBO J.
19, 1432±1440.
43. Durkin, M.E., Gantam, M., Loechel, F., Sanes, J.R., Merlie, J.P.,
Albrechtsen, R. & Wewer, U.M. (1996) Structural organization of
the human and mouse laminin b2 chain genes, and alternative
splicing at the 5¢ end of the human transcript. J. Biol. Chem. 271,
13407±13416.
44. Friedrich, M.V.K., Go
È
hring, W., Mo
È
rgelin, M., Brancaccio, A.,
David, G. & Timpl, R . (1999) Structural basis of glycosamino-

glycan modi®cation and heterotypic interactions of perlecan
domain V. J. Mol. Biol. 294, 259±270.
45. Dolan, M., Horchar, T., Rigatti, B. & Hassell, J.R. (1997) Iden-
ti®cation of sites in domain I of perlecan that regulate heparan
sulfate syn thesis . J. Biol. Chem. 272, 4316±4322.
46. Pikkarainen, T., Ed dy, R., Fukushima, Y., Byers, M., Show s, T.,
Pihlajaniemi, T., Saraste, M. & Tryggvason, K. (1987) H uman
lamin in b1 chain. A multidomain protein with gene (LAMB1)
locus in the q22 region of chromosome 7. J. Biol. Chem. 262,
10454±10462.
47. Montell, D.J. & Goodman, C.S. (1988) Drosophila substrate
adhesion molecule: sequenc e o f laminin b1 chain reveals domains
of homology with mouse. Cell 53 , 463±473.
48. Champliaud, M F., Lunstrum, G P., Rousselle, P., Nishiyama,
T.,Keene,D.R.&Burgeson,R.E.(1996)Humanammioncon-
tains a novel laminin variant, laminin 7, which like laminin 6,
covalently associates with laminin 5 to promote stable epithelial±
stromal attachment. J. Cell Biol. 132, 1189±1198.
49. Yurchenco, P.D. & Cheng, Y S. (1993) Self-assembly and calci-
um-binding sites in laminin. A three-arm interaction model. J. Biol.
Chem. 268, 17286±17299.
50. Durbeej, M., Fecker, L., Hjalt, T., Zhang, H Y., Salmivirta, K.,
Klein, G., Timpl, R., Sorokin, L., Ebendal, T., Ekblom, P. &
Ekblom, M. (1996) Expression of laminin a1, a5andb2chains
during embryogenesis of the kidney and vasculature. Matrix Biol.
15, 397±413.
51. Hunter, D.D., Murphy, M.D., Olsson, C.V. & Brunken, W.J.
(1992) S-laminin expression in adult and de veloping retinae: a
potential cue for photoreceptor mo rphogene sis. Neuron 8,399±
413.

52. Talts, J.F., S asaki, T., M iosge, N., Go
È
hring, W., Mann, K .,
Mayne, R. & T impl, R. (2000) Structural and functional analy-
sis of the recombinant G domain of the laminin a4chainand
its proteolytic processing in tissues. J. Biol. Chem. 275, 35192±
35199.
442 T. Sasaki et al.(Eur. J. Biochem. 269) Ó FEBS 2002