Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc

Identi®cation and properties of type I-signal peptidases
of
Bacillus amyloliquefaciens
Hoang Ha Chu, Viet Hoang*, Peter Kreutzmann², Brigitte Hofemeister, Michael Melzer
and JuÈ rgen Hofemeister
Institute of Plant Genetics and Crop Plant Research (IPK), Gatersleben, Germany
The use of Bacillus amyloliquefaciens for enzyme production
and its exceptional high protein export capacity initiated this
study where the presence and function of multiple type I
signal peptidase isoforms was investigated. In addition to
type I signal peptidases SipS(ba) [Meijer, W.J.J., de Jong, A.,
Bea, G., Wisman, A., Tjalsma, H ., Venema, G., Bron, S. &
van Dijl, J.M. (1995) Mol. Microbiol. 17, 621±631] and
SipT(ba) [ Hoang, V. & Hofemeister, J . (1995) Biochim.
Biophys. Acta 1269, 64±68] which were previously identi®ed,
here we present e vidence for two other Sip-like g enes in
B. amyloliquefaciens. Same map positions as well as
sequence motifs veri®ed that these genes encode homologues
of Bacillus subtilis SipV and S ipW. SipU-encoding DNA was
not found in B. amyloliquefaciens. SipW-encoding DNA
was also found for other Bacillus strains representing dif-
ferent phylogenetic groups, but not for Bacillus stearother-
mophilus and Thermoactinomyces vulgaris. The absence of
these genes, however, could have been overlooked due to
sequence diversity. Seq uence alignments of 23 known Sip-
like proteins from Bacillus origin indicated further branching
of the P-group signal peptidases into clusters represented by
B. subtilis SipV, SipS-SipT-SipU and B. anthracis Sip3-Sip5
proteins, respectively. Each B. amyloliquefaciens sip(ba)
gene was expressed in an Escherichia coli LepBts mutant and
tested for g enetic complementation of the temperature se n-

sitive (TS) phenotype as well as pre-OmpA processing.
Although SipS(ba)aswellasSipT(ba) eciently restored
processing of pre-OmpA in E. coli, only SipS(ba) supported
growth at TS conditions, indicating functional d iversity.
Changed properties of the sip(ba) gene disruption mutants,
including c ell autolysis, motility, sporulation, and nuclease
activities, seemed to correlate with speci®cities and/or
localization o f B. amyloliquefaciens SipS, SipT and SipV
isoforms.
Keywords:SignalpeptidaseI;Bacillus amyloliquefaciens;
protein s ecretion; E. coli; genetic complementation.
The p rinciples of pro tein transport through membranes are
basically similar in eukaryotic and prokaryotic organisms
[1], although destinations of proteins are numerous in
eukaryotic cells but only few in bacterial cells, such as the
cytoplasmic membrane, periplasm, outer membrane, cell
wall, spore compartment, or the extracellular environment
[2±4]. The majority of export proteins are transported via
the Sec pathway by recognition and site-speci®c processing
[3±5]. These export proteins carry a particular N-terminal
leader (signal) p eptide, wh ich b ears distinc t domain s (N, H
and C), that are distinguished by charge and hydrophobicity
pro®le [3±5]. The N- and H -regions are t hought to interact
with the translocase machinery and to mediate membrane
insertion, whereas the C-region allows sequence-speci®c
cleavage by SPases and removal of the s ignal peptide from
the precursor (export) protein [4,6±8]. Minor differences
between individual signal peptides, speci®c properties of t he
export protein precursor [5,7,9], as w ell as the sp eci®city of
distinct SPases [3,10,11] a ffects the processing of individual

or groups of export proteins. The B. subtilis genome
sequencing project [12] has enabled computer analysis to
predict that  166 proteins o f the total B. subtilis proteome
contain a N-terminal signal peptide, characteristic for Sec
export protein precursors [4]. Several e ubacteria and
archaebacteria possess only one type I SPase functioning
in Sec export protein processing [13]. However, B. subtilis
contains ®ve chromosomally encoded type I SPases, named
SipS, SipT, SipU, SipV, and SipW, respectively [4,5,14,15].
Multiple type I SPases were also found in Archaeoglobus
fulgidus [16], Streptomyces lividans [17], Bradyrhizobium
japonicum [18,19] and Staphylococcus aureus [20]. The
presence of a unique type I SPase (LepB in E. coli)was
shown to be essential for cell viability [21,22]. In c ontrast,
B. subtilis has ®ve Sip homologues, of which SipS a s well a s
SipT isoforms were shown to be essential for cell viability,
and have overlapping processing functions. Double mutants
Correspondence to J. Hofemeister, Institute of Plant Genetics and
Crop Plant Research (IPK), Corrensstrasse 3, Gatersleben, D-06466,
Germany. Fax/Tel.: + 49 394825 13 8/241,
E-mail:
Abbreviations: Ap, ampicillin; c.f.u., colony forming units; Cm, chlo-
ramphenicol; CWBP, cell wall bound proteins; Em, erythromycin;
pre-OmpA, OmpA precursor protein; Sip, signal peptidase protein;
SPase I, signal peptidase I (leader peptidase I); TS, temperature
sensitivity; IPTG, isopropyl thio-b-
D
-galactoside.
De®nitions:SipS(ba), SipS(bj), SipT(ba), SipV(ba) and SipW(ba)are
the products of the sipS(ba), sipS(bj), sipT(ba), sipV(ba),and

sipW(ba) genes of Bacillus amyloliquefaciens (ba)orBradyrhizobium
japonicum (bj), respectively.
*Present address: George Beadle Center for Genetics, School o f Bio-
logical Sciences, University o f Nebraska, Lincoln, USA.
Present address: Lower S axony Institute for Peptide R esearch, Han-
nover, Germany.
(Received 2 9 May 2001, revised 5 November 2001, accepted 13
November 2 001)
Eur. J. Biochem. 269, 458±469 (2002) Ó FEBS 2002
were nonviable, whereas deletion o f S ipU, SipV and SipW,
even in quadruple mutant derivatives in combination with
either SipS or SipT de®ciency, was without lethal conse-
quences. This allows the distinction between Spases of
major and minor importance for cell viability [ 13,23]. These
functional differences are not clearly re¯ected by sequence
motifs, but likely due to unknown activities [15]. Only o ne
minor Bacillus SPase, SipW, differs in several characteristics
from the group of prokaryotic (P-type) SPases, as it has
pronounced similarity to (ER-type) SPases found in archea
and in the ER membrane of eukaryotes [13,24,25]. SipW of
B. subtilis displays processing speci®city for TasA, an export
protein that acts from the spore membranes on spore coat
assembly. This study presents a ®rst example for secretion to
deliver individual proteins to s peci®c cellular locations, e.g.
during s porulation [25]. In spite o f this speci®city, other
SPase homologues of B. subtilis could apparently substitute
SipW functions, as the sipW gene was dispensable for cell
growth and sporulation [13,25].
B. amyloliquefaciens strains have only r ecently been
ranked from B. subtilis subspecies validation to a distinct

taxon [26,27]. Although strains of B. amyloliquefaciens are
among the most p otent producers o f i ndustrial enzymes
[28], little is known a bout physiological and g enetic
peculiarities [29]. In previous studies, two SipS-like signal
peptidases SipS1(ba) and SipS2(ba)ofB. amyloliquefaciens
were described [30] and later shown to have the highest
sequence similarity to SipS or SipT of B. subtilis,respect-
ively [31]. These ®ndings indicated sequence, as well as
mapping speci®city, of type I-SPase homologous of Bacillus
species [4,14]. The aim of this study was to isolate additional
Sip-like genes in B. amyloliquefaciens, and to evaluate
differences in functions after genetic complementation
in an E. coli LepBts mutant and a fter construction of
B. amyloliquefaciens sip(ba) gene disruption mutants.
MATERIALS AND METHODS
Strains and culture conditions
Table 1 lists the strains and plasmids used. Bacteria were
usually grown in trypton/yeast extract TBY broth or on
TBY-agar [32], Spizizen minimal medium (SMM) [33] or
Schaeffer's sporulation medium (SSM) [34], respectively.
Isopropyl thio-b-
D
-galactoside (IPTG, 1 m
M
) was added to
cultures. For antibiotica selection, Bacillus cultures were
supplemented with erythromycin (Em, 1 gáL
)1
) and/or with
chloramphenicol (Cm, 5 gáL

)1
); E. coli cultures were sup-
plemented with ampicillin (Ap, 50 gáL
)1
), Cm (10 gáL
)1
)or
kanamycin (20 gáL
)1
), respectively. The spores heat resist-
ance test was carried out according t o Nicholsen & Setlow
[34].
Recombinant DNA techniques
Chromosomal DNA from B. amyloliquefaciens was pre-
pared as described previously [33]. L arge-scale or mini-
preparations of plas mid DNA were made from E. coli
either by standard methods [35,36] or by using a QIAGEN
plasmid isolation kit (Qiagen GmbH, Hilden, FRG). The
Table 1. Bacterial strains and plasmids used in this stu dy.
Designation Relevant characteristics Description/reference
Strains
Escherichia coli XL1blue recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1,
lacI, [F proAB, lacI
q
ZDM15, Tn10(Tc
r
)]
Stratagene
Escherichia coli IT41 W3110, Lep-9ts; Tc
r

22
Bacillus subtilis GSB26 arol906 metB6 sacA321 str6 amyE 32
Bacillus amyloliquefaciens
GBA12 ALKO2718; DnprE, DaprE 53
GBA13 GBA12, but sipS::pEAS*
a
This study
GBA14 GBA12, but sipT::pEAT* This study
GBA15 GBA12, but sipV::pEAV* This study
GBA16 GBA12, but sipW::pEAW* This study
Plasmids
pUC18 Ap
r
Stratagene
pQE16 Ap
r
QIAGEN
pE194 Em
r
, temperature- sensitive (TS) 41
integration plasmid
pDG148 Km
r
,Pm
r
,Ap
r
,Pspac, lacI 40
pEAS*, pEAT*, pEAV*, pEAW* pE194, Em
r

::pUC18, Ap
r
with core-DNA This study
of sipS*(ba),sipT*,sipV*, sipW* genes,
respectively
pOpac pDG148 with ompA gene This study
pOpacSh, pOpacTh, pOpacVh, pOpacWh, pDG148 with Sip(ba) expression cassettes
Pspac-ompA- sip(ba)His-tag, respectively.
This study
pOpacBh pDG148 with LepB expression cassette
Pspac-ompA- lepB(ec)His-tag.
This study
pTK99 pJQ501, Gm
r
, sipS(bj) in antisenese orientation 19
pTK100 pJQ501, Gm
r
, sipS(bj) in sense orientation 19
a
The symbol:: indicates the insertion of a respective pEA* integration plasmid at a homologous chromosomal sip gene locus.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 459
same procedures were applied for B. subtilis or B. amylo-
liquefaciens except that for plasmid isolation, cells w ere
prepared in lysis buffer with lysozyme (4 gáL
)1
)at37°C,
incubated for 5 min. The digestion and ligation of DNA
were performed with various restriction enzymes and T4
DNA ligase, following the supplier's instructions. The
general molecular cloning techniques and DNA electro-

phoresis were carried out essentially as described by
Sambrook et al. [36] and Ausubel et al. [35]. DNA
fragments were prepared from agarose gels using the
QIAEX gel elution kit (Qiagen). E. coli was transformed
with competence treatment [36]. B. subtilis was transformed
either after competence treatment [33] or protoplast f orma-
tion [37]. Th e latter method was also used to transform
B. amyloliquefaciens, except that prior to transformation,
the DNA was occasionally treated with BamHI methylase.
Alternatively, plasmid DNA was transformed into
B. amyloliquefaciens by electroporation [38].
DNA sequencing and sequence analysis
DNA sequencing was performed by an automated system
(A.L.F. express, Pharmacia), u sing the r ecommended
primers for the pGEM-T and pUC18 vector, w ith t he
AutoRead sequencing kit (Pharmacia). Sequence analysis
was performed with the
PC
/
GENE
software from Intelli-
Genetics, Inc. (Mountain View, Calif.) and
DNA-STAR
software from Lasergene Inc. (Madison, WI, USA).
The
BLAST
software (National Center for Biotech nology
Information, Bethesda, MD, USA) was used for online
database scanning. Phenetic and cladistic analyses of the
amino-acid alignment were performed in

PAUP
*4.0b8
[39]. Mean c haracter differences w ere use d to calculate
pairwise distances, which w ere clustered with the Neighbor-
Joining algorithm. Fitch parsimony analysis was con-
ducted with
ACCTRAN
character optimization, with the
gaps treated as missing data and the heuristic search
algorithm with 100 random sequence additions. To test
the statistical support of the branches in phenetic and
cladistic analyses, bootstrap resamples were conducted
with 5000 and 500 replicates, respectively. Parsimony
analysis resulted in two equally parsimonious trees of
1388 steps length (CI 0.7177, RI 0.6631), which are
compatible with the tree topology obtained by the
Neighbor-Joining analysis.
Plasmid and mutant constructions
For Sip protein expression and processing studies plasmids
pOpacSh, pOpacTh, pOpacVh, and pOpacWh were con-
structed. These plasmids contain within the vector pDG148
[40], t he ompA as we ll as the re spective sip(ba)gene for
IPTG-inducible expression of pre-OmpA and S ip proteins
in one single cassette, essentially as follows: Pspac-ompA-
sipHis-tag-Ppen-lacI. A PCR fragment carrying the ompA
gene was ampli®ed from E. coli chromosomal DNA using
primers Omp1 a nd Omp2 (Table 2). T his ompA DNA was
cloned into vector pUC18 and after digestion with Hin dIII
and EcoRI, cloned into pDG148 vector to obtain the
plasmid pOpac (Table 1). The respective sip(ba) genes

were isolated from initial cloning vectors and cloned into
the vector pQE16 in frame with the His-tag-encoding
sequence. The lepB gene was PCR ampli®ed from E. coli
DNA using the primers Lep1 and Lep2 (Table 2), and then
cloned into the pQE16 vector. A fter restriction e nzyme
digestion of p QE derivated plasmids (pQSh, pQTh, p QVh,
pQWh, pQBh), the His-tagged genes (sipSh, sipTh, sipVh,
sipWh, and lepBh) w ere isolated and each cassette was
cloned into t he pOpac vector to obtain t he OmpA-Sip/Lep
expression plasmids (pOpacSh, pOpacTh, pOpacVh, pOp-
acWh, and pOpacBh). The integrative plasmids pEAS*,
pEAT*, pEAV* and pEAW* used for construction of the
B. amyloliquefaciens sip gene disruption mutants were
formed as follow s: a c ore DNA fragment c overing an
internal portion of the r espective sip gene was ampli®ed
using chromosomal DNA of B. amyloliquefaciens and the
respective gene-speci®c, i nternal primers (Table 2). These
PCR fragments were cloned i nto the pUC18 vector and the
resulting pUC18- sip construct ligated into the PstIsiteof
the temperature sensitive (TS) p lasmid pE194. After the
transformation of ALKO2718 cells with one respective
integrative plasmid (see above), integration mutants were
isolated by Em selection a t 42 °C [41]. S everal Em and h eat
resistant colonies of each mutant progeny were isolated
andtestedforintegrationofthesip::pE* cassette a fter PCR
ampli®cation. The construction scheme of mutant strains
GBA13 (sipS::pEAS*), GBA14 (sipT::pEAT*), GBA15
(sipV:: pEAV*) and GBA16 (sipW::pEAW*) is shown in
Fig. 4.
Pulse-chase protein labelling, immunoprecipitation,

SDS/PAGE and ¯uorography
The pulse-chase labelling method was carried out as
described by Edens [42]. The preculture of each strain w as
grown at 30 °CtoD
600
 0.5, and then divided into
cultures A and B, each of 5 mL. After i ncubation for
10 min a t either 3 0 °Cor42°C, the t wo cultures were
labelled for 1 min at the indicated temperature by the
addition of
35
S[methionine] (50 mCiáL
)1
) and chased by
the addition of nonradioactive methionine and cysteine
(2.5 gáL
)1
). Samples w ere collected at intervals and after
the addition of 1 mL trichloroacetic acid, kept on ice for
30 min. Polyclonal anti-OmpA Ig was used to precipitate
the protein.
Assay for cell autolysis
Cultures of wild-type and mutant strains of B. amylolique-
faciens were grown in TBY medium to D
600
 0.6. After
addition of 0.05
M
sodium azide , cell lysis was followed
spectrophotometrically while continuing incubation at

37 °C and agitation at 200 r.p.m. [43].
Cell-wall-bound protein (CWBP) extraction, and autolysin
detection after SDS/PAGE
Cell wall substrate was isolated from exponential growing
B. amyloliquefaciens cells according to Harwood et al.[44].
The CWBP extract was prepared from vegetative B. amy-
loliquefaciens cells according to Blackman et al. [43], exce pt
that cells were desintegrated by ultrasonication. Autolysin
activities were performed after SDS/PAGE, and enzymo-
graphy was assayed after renaturation of gels as described
by Foster [45] using B. amyloliquefaciens vegetative cell wall
as the substrate.
460 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
DNase detection after SDS/PAGE
Supernatant proteins of respective cultures were trichloro-
acetic acid-precipitated, collected, washed and sep arated by
12% SDS/PAGE containing calf thymus DNA (10 mgáL
)1
)
according to t he method described by Rosenthal & Lacks
[46].
Electron microscopy
For the primary ®xation, cells of B. amyloliquefaciens were
kept for 1 h at room temperature in 50 m
M
cacodylate
buffer ( pH 7.2), containing 0.5% (v/v) glutaraldehyde and
2.0% (v/v) formaldehyde. After washing, the samples were
subjucted to a secondary ®xation [1 h in a solution of 1 .0%
(w/v) OsO

4
in 50 m
M
cacodylate buffer]. Prior to dehydra-
tion, the cells were washed and t ransferred into 1.5% agar.
Dehydration, embedding and cutting of 1 mm
3
agar blocks
was performed as previously described [47]. The ultrathin-
sections were contrasted with a saturated methanolic
solution of uranyl acetate and lead citrate prior to exam-
ination in a Zeiss CEM 920 A transmission electron
microscope at 80 kV.
RESULTS
Cloning of a
sipV
-like gene
PCR reactions with genomic DNA of B. amyloliquefaciens
and primers V1, V 2, and V 3 (Table 2) for regions
MKKRFWFLA, VFIDYKVEG, and IVGVISDAE of
the B. subtilis Sip V protein were chosen and found to
generate PCR fragments of about 0.5 and 0.4 kb, respec-
tively (Fig. 1,A1). Moreover, Southern hybridization with
the 0.5 kb -PCR fragment as a probe indicated that the
genomic DNA of B. amyloliquefaciens contains speci®cally
hybridizing DNA. The previously described RAGE proto-
col [30] was used to PCR amplify and clone a corresponding
DNA region (Fig. 1,A2). A
BLAST
search of the nucleotide

sequence of the ampli®ed DNA fragment revealed the
presence of three ORFs, the deduced proteins having 70, 77,
and 67% identity to proteins encoded by the yhjE-sipV-yhjG
Table 2. Oligonucleotide primers used for P CR.
Name 5¢®3¢ Sequence
a
Description
CH1 CAYTTYGGNGCNGGNAAYATNGG Cloning of sipU
CH2 CAYGGNWSNGCNCCNGAYATNGCNGG Cloning of sipU
CH5 ATGATHGCNGCNYTNATHTTYACNAT Cloning of sipU
CH6 TTYTAYAARCCNTTYYTNATHGARGG Cloning of sipU
CH7 TCYTCNSWNGGCATNCCCATNCCRTT Cloning of sipU
CH8 TTNGCYTGNCKCATYTCNCCRAANGG Cloning of sipU
HV11 TTRTCNCCCATNACRAARTA Cloning of sipU
U1 TTGAAYGCNAARACNATHACNYTNAARAA Cloning of sipU
V1 TTGAARAARMGNTTYTGGTTYYTNGC Cloning of sipV
V2 GTNTTYATNGTYTAYAARGTNGARGG Cloning of sipV
V3 TCNGCRTCNSWNATNACNCCNACNAT Cloning of sipV
V4 GCCAAAACAACGATAAGCACGCC Cloning of sipV
V5 GGATTCATGCTGATTCCTTCGAC Cloning of sipV
V6 ACTTGGCACTACACCGCACCTCATGCG Cloning of sipV
V7 ATTTCGTGATTGGCGACAACCGC Cloning of sipV
V8 GAGAATTCCGGAGGGGGACAGGAATCTTG Construction of pOpacVh
V9 GCAGATCTCTTGGCGTATGATTCACTGAT Construction of pOpacVh
W1 GGNWSNATGGARCCNGARTTYAAYACNGG Cloning of sipW
W2 TCNGCNGCNGCRTTRTTRTCNCCYTTNGT Cloning of sipW
W7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipW
W8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipW
W9 GGCGATGTCATCACTTTTACACAA Cloning of sipW
W10 AACACACAGAATAATCGGGATCAC Cloning of sipW

W11 GAGAATTCAAAAGAAAGCGGGGAAGAA Construction of pOpacWh
W12 CGAGATCTTGTGGACATGGTCCCGTTTC Construction of pOpacWh
S1 CGGAATTCGCTAATGGGAGGAAATCAC Construction of pOpacSh
S2 TACAGATCTTTTCGTCTTGCGAATTTC Construction of pOpacSh
T1 CAGAATTCGTCTAGGAGGAACCACGTT Construction of pOpacTh
T2 GCGAGATCTTTTTGTCTGACGCATATC Construction of pOpacTh
Lep1 CAGCAATTGACCCTTAGGAGTTGGCAT Construction of pOpacBh
Lep2 GATGGATCTATGGATGCCGCCAATG Construction of pOpacBh
Omp1 GCAAAGCTTATTTTGGATGATAACGAGGCG Construction of pOpac
Omp2 GCGAATTCCTACCAGACGAGAACTTAAGCC Construction of pOpac
Uni1 GTTTTCCCATGCACGAC Primer for pUC18
Uni2 GTAAAACGACGGCCAGT Primer for pUC18
a
The IUPAC-code was used; N denotes an inosine residue.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 461
genes of B. subtilis, respectively (Fig. 1,A3). Thus, ¯ anking
ORFs indicated the B. amyloliquefaciens sipV(ba) gene to
occupy a similar genomic position as c ompared to sipV(bs)
of B. subtilis [12].
Search for
sipU
Several attempts were made, but failed to identify a sipU
homologous gene in B. amyloliquefaciens. The degenerate
primers U1, CH5, CH6 and HV11, CH7, and CH8
(Table 2) based on several regions (MNAKTITLKK,
MIAALIFTI, FKPFLIEG, YFVMGDN, NGMGMP-
SED, PFGEMRQAK) were chosen, which were most
speci®c for the B. subtilis SipU, when compared to other
Sip p roteins. In nine independent primer combinations,
parallel PCR ampli®cation reactions were carried out with

genomic DNA from B. subtilis 168 or B. amyloliquefac-
iens. Although the former template always resulted in the
generation of a DNA fragment of the expected size, no
ampli®cation products were obtained with B. a mylolique-
faciens DNA (data not shown). In extension, the forward
primers CH1 and C H2 were designed for conserved
regions HFGAGNIG and HGSAPDIAG of the genes
mtlD and ycsA, which map in B. subtilis upstream of the
searched sipU, and used in combination with reverse
primers HV11, CH7 and CH8. Speci®c ampli®cation
Fig. 1. Identi®cation of the sipV(ba) and sipW(ba) gene regions of B. amyloliquefaciens. (A1/B1) PCR reactions with genomic DNA of B. amy-
loliquefaciens and the degenerative primers V1/V3 and V2/V3 or W1 and W2, led to the isolation of core DNA fragments of about 0.5 kb (lane b)
and 0.4 kb (lane c), or 0.2 kb, respectively. (A2/B2) The respective 0.5 o r 0.2 kb-DNA fragments were u sed as a p robe fo r South ern hybridization o f
either PstI(lanea)orEcoRI (lane b) digested c hromosomal DN A in c ase of sipV or Hin dIII (lane a) or EcoRI-SacI (lane b) digested genomic DNA
in case of sipW. Hybridization indicated DNA fragments of about 2.5 and 1.6 kb or 0.8 and 1.2 k b, respectively. Each digest indicated one speci®c
signal and suggested the existence of sipV or sipW like genes in B. amyloliquefaciens.(A3/B3)TheRAGEprotocol[30]wasusedforPCR
ampli®cation as follows: The DNA of B. amyloliquefaciens was cut with either PstIandEcoRI in case of sipV or EcoRI-SacIincaseofsipW and
ligated into corresponding sites of pUC18 DNA. The ligation mixes were used for PCR with oligo nucleotides Uni1 or Uni2 and pairs of primers
V6/V7 a nd V4/V5 or W 9/W10 and W11/W12 (T able 2) for fo rward or reverse react ions, respectively. The latter were chosen according the
indicated regions within the 0.5 kb- or 0.2 kb-PCR fragments from step A1 or step B1. The PCR fragments were cloned and sequenced. Ultimate
PCR led to fragments covering 1.2 or 1.3 kb of DNA, respectively. The nucleotide sequence was submitted t o GenBank and given the accession
number AF085497 or AF084950, re spectively. The detected open reading f rames are indicated.
462 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
products were obtained with DNA of B. subtilis, but not
with DNA of B. amyloliquefaciens (data not shown).
Southern hybridization e xperiments with a 0.4-kb DNA
fragment for a sipU-speci®c probe, that had been PCR
ampli®ed with primers CH5 and CH7 from B. subtilis
DNA (Table 2) were carried out with B. subtilis as well as
B. amyloliquefaciens genomic DNA. Even at low strin-

gency, B. amyloliquefaciens yielded no hybridizing band,
but with DNA from B. subtilis 168, a positive band
appeared (data not shown).
Cloning of a
sipW
-like gene
In order t o isolate a sipW-likegenefromB. amylolique-
faciens a similar strategy a s outlined in Fig. 1 was
followed. PCR ampli®cation was done with degenerative
primers W1 and W2 according to conserved regions
VLSGSMEPEFNTG and TKGDNNAAAD of B. subtilis
SipW (Fig. 1,B1). The core DNA fragment of about 0.2 kb,
was in S outhern h ybridization experiments found to
hybridize with B. amyloliquefaciens DNA (Fig. 1,B2). Sub-
sequent RAGE ampli®cation with B. amyloliquefaciens
genomic DNA and primers W7, W8 and W9, W10
(Table2),aswellasa®nalampli®cationstepwithterminal
primers y ielded a DNA fragment of 1.3 kb. The nucleotide
sequence demonstrated the presence of three ORFs, and the
deduced proteins to have 42, 73, and 82% of identity to
Fig. 2. Abundance of sipW- like DNA in several Bacillus species representing d ierent 16S rRNA phylogenetic groups [26,48]. Gro up 1, B. subtilis
(13), B. amyloliquefaciens (1), B. circulans (2), B. lentus (3), B. licheniformis (4), B. megaterium (5), B. thuringiensis (6); From group 2, B. sphaericus
(7); From group 3, B. macerans (8), B. polymyxa (9); From group 4, B. brevis (10); From group 5, B. stearothermophilus (11); Thermoactinom yces
vulgaris (12). PCR was under standard conditions using about 2 lg of genomic DNA and primers W1 and W2 (Table 2). The brightness of DNA
bands correlates with the amount of PCR product per run.
Fig. 3. EcoliLepBts compleme ntatio n after Sip(ba) protein expression.
(A) Growth of E.coli IT41 transformants containing following
plasmids: (s), pTK 100; (r), pO pacBh; (.), pOpacSh; pTK99; (d),
pOpacTh; (j), pOpacVh; (h), pOpacWh. The cultures were grown in
TBY medium at 42 °C without IPTG. Dierent transformant colonies

were used in repeated experiment s. (B) Processing of p re-OmpA in
E. coli IT41 was a nalysed after pulse-chase labelling, immunoprecipi-
tation, SDS/PAGE and ¯uorography. Samples were withdrawn at the
intervals indicated. p, precursor; m, mature protein. (a), IT41/pOpac;
(b),IT41/pTK100;(c),pOpacSh;(d),pOpacTh;(e),pOpacVhor(f),
pOpacWh, respectively. (C) Expression of His-tagged Bacillus SipS(ba)
proteins in E. coli IT41 was detected by Western blotting. L anes 1/2,
3/4, 5/6 a nd 7/8 refer to His-tagged Sip(ba) protein detection in cells
with SipS(ba), SipT(ba), SipV(ba)orSipW(ba) expression either grown
without or with the a ddition of IPTG a t 30 °C.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 463
proteins encoded by yqxM-sipW-tasA genes of B. subtilis,
respectively (Fig. 1,B3). This map position also indicated
the B. amyloliquefaciens sipW(ba) gene to be similar to
sipW(bs) of B. subtilis [12].
Abundance of sipW-encoding DNA in diverse
Bacillus
groups
After successful application of primers W1 and W2 for PCR
ampli®cation of a sipW gene homologue from B. amyloliq-
uefaciens (Fig. 1B), the same strategy was a pplied to search
for the abundance of similar genes in other, distantly related
Bacillus species. Genomic DNA of several species, including
at least on e strain of each Bacillus 16S rRNA-phylogentic
group [26,48], was used to carry out the above mentioned
PCR approach. T he abundance of the sipW-like genes was
indeed con®rmed for distantly related Bacillus species, b ut
not found in DNA of B. stearothermophilus and Thermo-
actinomyces vulgaris ( Fig. 2 ). The latter might have been
overlooked due to primer speci®city.

Genetic complementation of an
E. coli lepBts
mutant
E. coli strain IT41, a lep-9 Tet
r
P1 transductant of E. coli
W3110, contains an amber muta tion in the lepB gene. D ue
to heat sensitivity of its type I-signal peptidase LepB [22], the
mutant stops growth and accumulates precursor proteins,
i.e. of pre-OmpA, at non permissive temperature conditions.
It has been repeatedly s hown that growth of this mutant at
high temperature can be restored after transformation with
lepB-like genes from Gram-negative as well as Gram-
positive bacterial origin, i.e. of Bradyrhizobium japonicum
[18,19], Staphylococcus aureus [20], Streptococcus pneumo-
niae [49] and Streptomyces lividans TK21 [17]. In order to
verify the functionality o f the four Sip( ba) proteins, the
SPases and OmpA were coexpressed in a single expression
cassette in this E. coli mutant. The expression cassette of
plasmids pOpacSh, p OpacTh, pOpacVh, and p OpacWh,
was basically as follows: Pspac-ompA-sipHis-tag-Ppen-lacI,
whereby the C-terminal His-tag enabled immunodetection
of Sip protein expression (Fig. 3). For a control, the LepB
protein of E. coli was H is-tagged and the gene likewise
cloned on plasmid pOpacBh. The plasmids pTK100 and
pTK99, carrying a sipS-like gene of Bradyrhizobium japon-
icum in either sense or antisense orientation [19] served for
an additional control. E. coli IT41 transformants were
maintained at 30 °C. After growth in TBY with or without
IPTG expression of Sip(ba)- and LepB- proteins were in

respective transformants con® rmed by immunodetection
using His-tag antibodies (Fig. 3). Without IPTG induction,
IT41 transformants with expression of LepB, SipS(ba), or
SipS(bj)ofB. japonicum revealed growth at 42 °C, but not
with SipT(ba), SipV(ba)orSipW(ba) (Fig. 3). Moreover, all
Sip(ba) e xpressing IT41 cultures, grow signi®cantly slowed
after IPTG addition indicating overexpression lethality
(data not shown). Processing of pre-OmpA was thus studied
without IPTG induction at the non permissive temperature
and found in SipS(ba) and SipT(ba) expressing IT41
cultures, but not with SipV(ba)orSipW(ba) expression
(Fig. 3).
Sip disruption mutants
In order to s tudy the phenotype of sipS(ba), sip T(ba),
sipV(ba) and sipW(ba) mutants, B. amyloliquefaciens
strains GB13, GBA14, GBA15 and GBA16 were grown
and tested under certain conditions. Inspecting the
changed characters o f the mutants, it should be s tressed
that secondary mutant allels (see Material and methods),
translation of front portions of each sip gene as well as
promoter activities on downstream genes from the large
DNA i nsert (Fig. 4), are unlikely but ®nally not
excluded.
Growth and protein secretion
The growth of sip(ba) mutants was compared at either 37 or
45 °C in TBY and SMM medium. Under each condition,
the sipV(ba) mutant exhibited s lower growth rate, com-
pared to the wild type and other sip(ba) mutant strain (data
not shown). The yields of protein s ecreted after 24 h of
growth in TBY medium as well as the protein changed

banding pattern were compared after SDS/PAGE (data not
shown). Although t he total protein of sipS(ba) and
sipT(ba) mutants, was about 30% lower compared to wild
type cultures, s lab gel SDS/PAGE was not suf®cient to
demonstrate more than vague differences which might
correlate with a distinct sip(ba) gene de®ciency (data not
shown, but see Fig. 6).
Sporulation
In order to study the effect of sip(ba) gene disruption on
sporulation, strains were grown in SSM for 8±48 h at 37 °C
and respective samples tested fo r heat r esistant c.f.u. Under
these c onditions, wild-type cultures contained after 24 and
48 h about 25 and 43% of spores, respectively. No
signi®cant differences were observed for sipS(ba), sipV(ba)
and sipW(ba) mutant cultures, whereas spores were rarely
found at frequencies of about 0.001% in the sipT(ba)
Fig. 4. Scheme of construction of sip(ba) gene disruption mutants of
B. amyloliquefaciens. The integrative plasmids pEAS*, pEAT*,
pEAV* and pEAW* were transformed into ALKO2718 cells, and
integration was achieved after several rounds of cultivation with Em
selection at 42 °C [41]. Campbell-type integration of the 6.3 kb-DNA
cassette disrupted the r espect ive sip(ba) gene. Integ ration of the
sip::pE* cassette a t the desired sip (ba) gene locus was co n®rm ed after
PCR ampli®cation using primers with speci®city for either chromo-
somal DNA outside of the integration cassette or pUC18 primer Uni1
(Table 2) . The rela tive positions and orientation of open reading
frames (amp and ery stand for antibiotic resistan ce genes o f the plas-
mids) as well as proposed tanscription terminator elements (t) are
shown.
464 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002

mutant cultures. These experiments were several times
repeated. This distinct gene d isruption was always found to
correlate with low s pore frequencies and cell lysis of SSM
cultures after 8 h of growth ( data not shown). The few
sporulating cells from sipT(ba) mutant cultures in this
incubation period exhibited the structure of stage III
forespores and e xhibited obvious abnormalities in either
coat or cortex structures (Fig. 5). The progeny from SMM
cultures without antibiotica selection, was Em sensitive to
about 80%, and exhibited restored spore frequencies (data
not shown). This correlation underlined sipT(ba) gene
disruption to correlate with spore formation de®cien cy.
Autolysis and cell motility
Microscopical inspection of stationary cultures indicated
cells of the sipV(ba) mutant to grow in TBY as ®laments,
while c ultures of the wild-type and other mutants grow as
rod shaped cells. This observation indicated a de®ciency in
either cell division or cell wall formation. We therefore
compared the mutants for cell autolysis, cell m otility as w ell
as autolysin activities of puri®ed CWBP fractions by
SDS/PAGE. After the addition of sodium azide (0.05
M
)
cultures of the sipV(ba) mutant were exceptionally less
affected by autolysis, compared to wild-type and the other
sip(ba) mutants ( Fig. 6). As changed cell autolysis was
expected to correlate with changed cell motility [43], the halo
diameter of colonies of wild type and m utant cultures was
compared after plating on soft agar and growth at 25 or
37 °C. The sipV(ba) mutant colonies in the average had

swarming halo diameters of  49% compared to the
diameter of wild type as well as other mutant colonies,
except that o f the sipW(ba) mutant, w hich was r educed to
about 70% (data not shown). CWBP preparations of wild
type and mutant cells were analysed for autolysin activities
after SDS/PAGE and enzymography (Fig. 6). The CWBP
pattern of sipV(ba) mutant cells was indeed found to differ
with respect to th e p resence and the r elative amount of
several CWBP's. However, at least one out of about ®ve
major autolysin activities of wild type cells, which runs in a
double band of proteins of about 35 kDa was missing.
Nuclease activities
Occasionally we observed that after plasmid isolation higher
yields of DNA could be obtained from distinct mutants.
The respective sipS (ba) and sipT(ba) mutants were t here-
fore suspected to have either changed content of plasmid
DNA or reduced DNA degradation due to loss or reduction
of nuclease activities. A pronounced zone of nuclease
activity was a fter SDS/PAGE and enzymography found in
Fig. 5. Electron microscopy of B. amylolique-
faciens wild type (A) and S ipT(ba)mutant
forespore structures (B). Cells were c ollected
after 8 h of growth in SSM and processed for
ultrathin-section e lectron micrography as
describedinMaterialsandmethods.
Fig. 6. Cell autolysis, CWBP pattern and autolysin activities of
B. amyloliquefaciens and of sip(ba) mutants. (A) Sodium azide (0.05
M
)
was added to exponential-phase TBY-cultures (D

600
 0.5±0.6). Cell
lysis was followed spectrophotometrically at 600 nm (d) wild type
GBA12; (s), sipS(ba) mutant GBA13; (.), sipT(ba) GBA14; (,),
sipV(ba) mutant GBA 15; (j) sipW(ba) mutant GBA16. (B) SDS/
PAGE separation of the CWBP fraction of B. amyloliquefaciens
GBA12 and sipV(ba) mutant G BA15 (a) and enzymography of
autolysin activities a fter renaturing SDS/PAGE of gels containing
puri®ed B. amyloliquefaciens cell wall material as substrate (b). Sample
preparation is described in Methods and renaturation of the SDS/
PAGE gel was according to Foster [45]. Lane 1, GBA15; lane 2,
GBA12. The arrows indic ate protein bands reduced or lacking in the
mutant. The labels a
1
and a
2
point to autolysins w hich are most sig-
ni®cantly aected. The data are from one representative experiment
after three tim es of r epetition.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 465
the area of 30 kDa-proteins of supernatant fractions of wild
type and several sip(ba) mutant cultures. T his nuclease
activities were strongly reduced in the sipT(ba), about nearly
lacking in the supernatant of sipS(ba)mutantcultures
(Fig. 7). In spite of numerous attempts to purify that
suspected nuclease, likely due to low protein concentration,
it could not be isolated from wild type cultures. Conse-
quently, the identity of the suspected nuclease activity, even
of its export protein character has not been veri®ed.
DISCUSSION

Here we present evidence f or the existence of sipV- and
sipW-like genes in chromosomal DNA of B. amylolique-
faciens as compared to B. subtilis [12]. The similarity of the
deduced proteins, conserved sequence motifs, the protein
length, as well as same neighbourhood of genes, also
con®rm gene homology with sipV and sipW of B. subtilis as
previously shown for SipS(ba) and SipT(ba) of B. amylo-
liquefaciens [12,13,23,30,31]. In contrast, sipU-encoding
DNA was not found. Although, its absence could have
been overlooked due to sequence diversity, one of these two
species might have gained or lost a sipU-type gene paralogue
after evolutionary constrains [1]. Variation of the sip gene
multiplicity was already indicated by the presence of
additional plasmidal sipP genes in Bacillus strains [ 5,31].
In this study, SipW-encoding DNA was ampli®ed from
10 out of 12 strains representing four distant 16S rRNA-
groups of the phylogenetic Bacillus tree [26,48], but not
found in group 5 strains B. stearothermophilus and Ther-
moactinomyces vulgaris. A s indicated for SipU, the PCR
approach could have also been failed due to DNA sequence
diversity of these remote Gram-positive spore- forming
bacilli [27]. Diversity of paralogous Sip proteins i s also
indicated from phenetic distance analysis as illustrated in
Fig. 8. As much as 23 Bacillus Sip proteins known from
B. subtilis, B. amyloliquefaciens, B. licheniformis, B. stearo-
thermophilus, B. caldolyticus, B. halodurans and B. anthra-
cis were included. The Neighbor-Joining algorism was used
to compare the Bacillus sequences with E. coli LepB and
yeast Sec11 ER-type SPase. The phylogenetic tree strength-
en the distinction between P- and ER-type SPases as

previously proposed [13], but also the clustering of P-type
Sip proteins into at least three subgroups represented by
B. subtilis SipV-, SipS,T,U- and B. anthracis Sip3,5-like
SPases, respectively. This analysis showed close relationship
between Sip proteins of B. amyloliquefaciens and B. subtilis
as well as their relatedness to other SPases, where the Sip-
isoforms of these t wo Bacillus species. Basically these data
are similar to those of van Roosmalen et al.[15],where15
different SPases w ere included and the authors claimed the
distinction between major and minor SPases upon similar
phylogenetic analyses. According to our data, which include
additional SPases from B. halodurans, as well as from
B. anthracis, the given criteria for major a nd minor SPases
might differ from one species t o another. For instance,
SipV(Bha)ofB. halodurans, apparently plays the role of a
major SPase, but according t o its phylogenetic character
would not belong to the group of major SPases.
With respect to their group character of Sip isoforms, it
was a sked, whether SPases of one group genetically
complement each other more likely, than SPases from
another group. Each of the four Sip(ba) proteins was in a
LepBts mutant of E. co li tested for its ef®ciency to restore
de®ciencies of LepB, i.e. the complementation of the mutant
TS phenotype as well as pre-OmpA processing. Only
SipS(ba) and SipT(ba) were active in processing pre-OmpA,
while SipV(ba) and SipW(ba) failed. The lack of processing
activities of the latter correlates with enhanced degradation,
as indicated by degradation products of the SipV(ba)aswell
as SipW( ba)proteinfromE. coli after i mmunodetection
(Fig. 3). These observation could re¯ect inactivation by self-

cleavage of these SPases in E. coli, as it was shown for a
truncated SipS( ba) protein lacking its unique N-terminal
membrane anchor [50]. The processing data might be
compared to the p rocessing activities of t heir B. subtilis
homologues in E. coli, tested w ith the pre(A13i)-b-lactam-
ase precursor, where SipV was also inactive [14].
Moreover, the growth of the LepBts mutant was only
restored after SipS(ba) but not after SipT(ba) expression.
These likely re¯ects differences in the spe ci®city or capacity
to cope with the range of growth-limiting LepB processing
functions. These differences for the ®rst time demonstrated
differences between SipS- and SipT-like SPases w ith respect
to their activities in E. coli and could be due to their
different mode of membrane insertion as well as enzyme
activities [15,50].
Mutant studies in E. coli implemented LepB to be
essential [21,22], while in B. subtilis, heat inactivation o f
SipSts in a SipT mutant background, i.e. a SipS/SipT
double de®ciency, had lethal consequences [5,13]. So far, n o
distinct phenotype was found to distinguish B. subtilis sip
mutants, although SipW activities in pre-TasA processing
and transport into B. subtilis endospores provided a ®rst
example of speci®cation of this SPase isoform for spore-
Fig. 7 . Enzymogram o f nu clea se ac tivity of culture super natan t o f
B. amyloliquefaciens sip(ba) mutants. Aliquots (50 lL) o f cell-free
supernatant of 24 h TBY-cultures of wild type GBA12 (1) mutant
strains sipS(ba) GBA13 (2), sipT(ba)GBA14(3),sipV(ba)GBA15(4)
and sipW(ba) GBA 16 (5) were separated after 12% SDS/PAGE
containing calf thymus DNA (10 mgáL
)1

). The gel was renatured and
stained with ethidium bromide. The bright areas indicate zones of
DNA hydrolysis.
466 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
speci®c protein sorting [13,24,25]. Inactivation of either SipS
or SipT in B. subtilis just decreased the total yields of export
proteins compared to the wild type, a s it w as also found in
B. amyloliquefaciens to  30% (data not shown). A ll of the
B. amyloliquefaciens Sip(ba) disruption mutants were via-
ble, but some had impaired growth, sporulation and cell
division properties. Strict correlation of a distinct mutant
phenotype with that distinct sip gene disruption, as well as
restoration of the mutant phenotype after spontaneous
excision of the insertion cassette from B. amyloliquefaciens
mutants, strongly indicated gene disruption to c orrelate
with the distinct mutant de®ciencies, which were preliminary
analysed.
Disruption of sipT(ba) in B. amyloliquefaciens correlated
with a drastic reduction of sporulation and rare forespores
stalled in stage III development with apparently changed
cortex or coat structures [45]. Similar, sporulation de®ciency
of B. subtilis sipT-sipV doub le-deletion mutants have been
reported [51]. These two ®ndings would suggest a distinct
role of those SPases in the processing and export of
sporulation-related proteins in both species.
The same might be true for export of a not yet de®ned
nuclease in B. amyloliquefaciens, which was most affected
by sipS(ba),andtoalesserextendalsobysipT(ba) gene
disruption. The respective nuclease of B. amyloliquefaciens
is appar ently not a homologue of the 1 2 kDa-B. subtilis

extracellular NucB [ 52], as the size of t he protein w as about
30 kDa. Its nature remains unknown, as any attempt to
isolate the protein from B. amyloliquefa ciens failed (data not
shown).
Moreover, impaired growth, inhibited cell autolysis and
reduced motillity s peci®ed sipV(b a) mutants. I ndeed,
changed pattern of CWBP's as well as loss of at least
one (major) 35-kDa autolysin correlated with SipV(ba)
de®ciency. In B. subtilis, LytC (50 kDa amidase), LytD
(90 kDa glucosaminidase) or a sigD controlled (minor)
49-kDa autolysin are shown to change cell wall turnover,
septation, cell lysis as well as swarming motility [43]. An
autolysin of B. amyloliquefaciens might correlate with that
distinct SipV(ba) mutant phenotype which seems to differ
from known autolysins of B. subtilis [12,45].
In summary, more detailed studies are required to explain
the mystery of multiple Sip proteins with m ore or less
different characters in various Bacillus species. As B. amyl-
oliquefaciens strains have only recently ranked to a distinct
taxon [26,27], t he indicated d ifferences of B. amyloliquefac-
iens S ip c andidates compared to B. subtilis homologues
could indicate these species have slightly changed characters
of their processing apparatus with respect to the presence
and specialization of Sip protein homo logous.
ACKNOWLEDGEMENTS
We thank Susanne Ko
È
nig and Christian Horstmann for nucleotide and
amino acid sequencing, and Renate Manteuel for preparation of
antibodies, respectively. Peter Mu

È
ller kindly provided plasmids pKT99
Fig. 8. Unrooted phe nogram of t he Neighbor±
Joining analysis of known Bacillus Sip proteins
including Saccharomyces cerevisiae Sec11_Sce
(NP012288). The Bacillus Sip proteins ana-
lysed are: B. amyloliquefaciens SipS_Bam
(P41026), SipT_Bam (P41025), SipV_Bam
(AAF02219), SipW_Bam (A AF02220);
B. subtilis SipS_Bsu (P28 628), SipT_Bsu
(G69707), SipU_Bsu (I39890), SipV_Bsu
(A69708), SipW_Bsu (B69 708), pTA1015
(I40470), pTA1040 (I40552); B. halodurans
SipV_Bha (BAB04749), SipW_Bha
(BAB05849); B. licheniformis Sip_Bli
(CAA53272); B . caldolyticus Sip_Bca
(I40175); B. anthracis Sip1_Ban,Sip2_Ban,
Sip3_Ban,Sip4_Ban,Sip5_Ban,SipW_Ban;
B. stearothermophilus Sip1_Bst,Sip2_Bst
(preliminary sequence d ata from the website
). The l ength of e ach pair
of branches represents the d istance between
sequence pairs and bootstrap values are given.
The cluster of major SPases as d e®ned by
Roosmalen et al. [15] is circled.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 467
and pKT100 as well as valuable data about sipSgenesofB. japonicum.
Roland Freudl kindly provided the anti-OmpA- antibodies. We are
indebted to Adam Driks for helpful c omments about forespore
structures as well as Frank Blattner's professional h elp with phylogentic

analyses. The work was funded by grants from the Bundesministerium
fu
È
r Bildung, W issenschaft, Forschung u nd Technologie BEO 0319689
and HO 1494 f rom the Deutsche Forschungsgemeinschaft.
REFERENCES
1. Pohlschro
È
der,M.,Prinz,W.A.,Hartmann,E.&Beckwith,J.
(1997) Protein translocation in the three domains of life: variations
on a theme. Cell 91 , 563±566.
2. Dricks, A. (1999) Bacillus subtilis spore coat. Microbiol. Mol. Biol.
Rev. 63, 1±20.
3. Driessen, A.J., Fekkes, P. & van der Wolk, J.P. (1998) The Sec
system. Curr. Opin. Microbiol. 1, 216±222.
4. Tjalsma, H., Bolhuis, A., Jongbloed, J., Bron, S. & van Dijl, J.M.
(2000) Signal peptide-dependent protein transport in Bacillus
subtilis: a genome-based survey of the secretome. Mir obiol. Mol.
Biol. Rev. 64, 515±547.
5. Bron, S., Bolhuis, A., Tjalsma, H ., Holsappel, S., Venema, G. &
van Dijl, J.M. (1998) Protein secretion and possible roles for
multiple signal peptidases for precursor processing in Bacilli.
J. Biotechnol. 64 , 3±13.
6. Akita, M., Sasaki, S., Matsuyama, S. & Mizushima, S. (1990)
SecA interacts with s ecretory proteins by recognizing t he positive
charge at the amino terminus of the signal p eptide in Esch erichia
coli. J. Biol. Chem. 26 5 , 8164±8169.
7. Ng, D.T., Brown, J.D. & Walter, P. (1996) Si gnal sequences
specify the targeting route to the endoplasmic reticulum mem-
brane. J. Cell Biol. 134, 269±278.

8.vanVoorst,F.&DeKruij,B.(2000)Roleoflipidsinthe
translocation o f proteins across m embranes. Biochem. J. 347,
601±612.
9. Wu, L.F., Chanal, A. & Rodrigue, A. (2000) Membrane targeting
and translocation of bacterial hydrogenases. Arch. Microbiol. 173,
319±324.
10. Dalbey, R.E., Lively, M.O., Bron, S. & van Dijl, J.M. (1997) The
chemistry and enzymology of the type I signal peptidases. Protein
Sci. 6, 1129±1138.
11. Paetzel, M., Dalbey, R.E. & Strynadka, N.C. (2000) The structure
and mechanism of bacterial type I signal peptidases. A novel
antibiotic target. Pharmacol. The r. 87, 27±49.
12. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G.,
Azevedo, V., Bertero, M.G., Bessieres, P., Bolotin, A ., Borchert, S.
et al. (1997) The complete genome sequence of the Gram-positive
bacterium Bacillus subtilis. Nature 390, 249±256.
13. Tjals ma, H., Bolhuis, A., van Roosmalen, M.L., Wiegert, T.,
Schumann, W., Broekhuizen, C.P., Quax, W., Venema, G., Bron,
S. & van Dijl, J.M. (1998) Functional analysis of the secretory
precursor p rocessin g machinery of Bacillus subtilis: i denti®cation
of an eubacterial homolog of archaeal and eukaryotic signal
peptidases. Genes Dev. 12 , 2318±2331.
14. Tjalsma,H.,Noback,M.A.,Bron,S.,Venema,G.,Yamane,K.&
van Dijl, J.M. (1997) Bacillus subtilis contains four closely related
type I signal peptidases with overlapping substrate speci®cities:
constitutive and temporally controlled expression of dierent
genes. J. Biol. Chem. 272, 25983±25992.
15. van Roosmalen, M.L., Jongbloed, J.D.H., Dubois, J Y.F.,
Venema, G ., Bron, S. & van Dijl, J.M. (2001) Distinction
betweenmajorandminorBacillus signal peptidases based on

phylogenetic and structural criteria. J. Biol. C hem. 276, 25230±
25235.
16. Klenk, H.P., Clayton, R.A., Tomb, J.F., White, O., Nelson, K.E.,
Ketchum, K . A., D od son, R.J., Gwinn, M., Hickey, E .K ., Peter-
son, J.D. et al. (1997) The complete genome sequence of the
hyperthermophilic, sulphate-reducing arch aeon Archaeoglobus
fulgidus. Nature 390, 3 64±370.
17. Parro, V., Schacht, S., Anne, J. & Mellado, R.P. (1999) Four genes
encoding dierent type I signal peptidases are organized in a c luster
in Streptomyces lividans TK21. M icrobiology 145 , 2255±2263.
18. Bairl, A. & Mu
È
ller, P. (1998) A second gene for type I signal
peptidase in Bradyrhizobium japonicum, sipF, is located near genes
involved in RNA processing and cell division. Mol. Gen. Genet.
260, 346±356.
19. Mu
È
ller, P., Ahrens, K., Keller, T. & Klaucke, A. (1995) A TnphoA
insertion w ithin the Bradyrhizobium japonicum sipS gen e, homol-
ogous to prokaryotic signal peptidases, results in extensive ch anges
in the expression of PBM-spe ci®c no dulins of infected soybe an
(Glycine max) c ells. Mol. Microbiol. 18 , 831±840.
20. Cregg, K.M., Wilding, I. & Black, M.T. (1996) Molecular cloning
and expression of the spsB gene encoding an essential type I signal
peptidase from Staphylococcus aureus. J. Bacteriol. 178, 5712±
5718.
21. Date, T. (1983) Demonstration by a novel genetic technique that
leader peptidase is an essential enzyme of Escherichia c oli.
J. Bacteriol. 154, 7 6±83.

22. Inada, T., Court, D .L., Ito, K. & Nakamura, Y. (1989) Condi-
tionally lethal amber mutations in the leader peptidase gene of
Escherichia coli. J. Bacteriol. 171, 585±587.
23. Tjalsma, H., van den Dolder, J., Meijer, J.J., Venema, G., Bron, S.
& van Dijl, J.M. (1999) The plasmid-encoded signal peptidase
SipP can functionally replace the major signal peptidase SipS and
SipT of Bacillus s ubtilis. J. Bacteriol. 181, 2448±2454.
24. Serrano, M., Zilhao, R., Ricca, E., Ozin, A.J., Moran Jr, C .P. &
Henriques, A.O. (1999) A Bacillus subtilis secreted protein with a
role in endospore coat assembly an d function. J. Ba ct eriol. 181,
3632±3643.
25. Sto
È
ver, A.G. & Driks, A . ( 1999) Secretion, localization, and
antibacterial activity of TasA, a Bacillus subtilis spore-associated
protein. J. Bacteriol. 181, 1664±1672.
26. Priest, F.G. (1993) Systematic and ecology of Bacillus.InBacillus
subtilis and Other G ram-Positive Bacteria (Sonenshein, A .L.,
Hoch, J.A. & Losick, R., eds), pp. 3±16. American Society for
Microbiology, Washington, DC.
27. Stackebrandt, E., Ludwig, W., Weizenegger, M., Dorn, S.,
McGill, T., Fox, G.E., Woese, C.R., Schubert, W. & Schleifer,
K H. (1987) Comparative 16S rRNA oligonucleotide analyses
and m urein t ypes of round-spore-fo rming bacilli and non -spore-
forming relatives. J. Gen e ral Microbiol. 133, 2523±2529.
28. Debabov, V.G. (1982) The industrial use of bacilli. In Th e
Molecular Biology of the Bacilli (Dubnau, D.A., ed.), pp. 331±370.
Academic Press, Boston.
29. Bron, S., Meima, R., van Dijl, J.M., Wipat, A. & Harwood, C.
(1999) Molecular biology and genetics of Bacillus spp. In Manual

of Industrial Microbiology and Biotechnol ogy (Demain, A.L. &
Davies, J.E., eds), pp. 392±416. ASM Pres s, Washington, DC.
30. Hoang, V. & Hofemeister, J. (1995) Bacillus amyloliquefaciens
possesses a second type I signal peptidase with extensive sequence
similarity to other Bacillus SPases. Biochim. Biophys. Acta. 1269,
64±68.
31. Meijer, W.J.J., de Jong, A., Bea, G., Wisman, A., Tjalsma, H.,
Venema, G., Bron, S . & van Dijl, J .M. (1995) The endogenous
Bacillus subtilis (natto) plasmids pTA1015 and pTA1040 contain
signal peptidase- encoding genes: identi®cation of a new structural
module on cr yptic plasmids. Mol. Microbiol. 17, 621±631.
32. Hof emeister, B., Ko
È
nig, S., Hoang, V., Engel, J., Mayer, G.,
Hansen, G. & Hofemeister, J. (1994) The gene amyE (TV1) codes
for a nonglucogenic a-amylase from Thermoactinomyces vulgaris
94±2A in Bacillus subtilis. Appl. Environ. Microbiol. 60, 3381±3389.
33. Cutting, S.M. & Horn, P.B.V. (1990) Genetic analysis. In
Molecular Biology Methods for Bacillus (Harwood,C.R.&
Cutting, S.M., eds), pp. 66. J ohn Wiley & Sons Ltd, New York.
468 H. H. Chu et al. (Eur. J. Biochem. 269) Ó FEBS 2002
34. Nicholsen, W.L. & Setlow, P. (1990) Sporulation, germination
and o utgrowth. I n Molecular Biological M ethods for Bacillus
(Harwood, C.R. & Cutting, S.M., eds), pp. 391±450. John Wiley &
Sons Ltd, New York.
35. Ausu bel, F.M., Bre nt, R., Kingston, R.E., Moore, D .D., Seidman,
J.G., Smith, J .A. & Struhl, K. (1995) Current Protocols i n
Molecular Biology. John Wiley & S ons, Inc, New York.
36. Sambrook, J., Fritsch, E .J. & Maniatis, T . (1989) Molecular
Cloning: a Laboratory Manual, Cold S pring H arbor L aborator y

Press, Cold Spring Harbor, New York.
37. Chang, S. & Cohen, S.N. (1979) High frequency transformation of
Bacillus subtilis protoplasts by plasmid DNA. Mol. Gen. Genet.
168, 111±115.
38. V eh maa nper a
È
, J. (1989) Transformation of Bacillus amylo-
liquefaciens by electroporation. FEMS Microbiol. Lett. 61, 165±
170.
39. Swoord, D.L. (2001) PAUP*. Phylogenetic Analysis Using Par-
simony (*and Other Methods), Version 4. Sinauer Associates,
Sunderland, Massachusetts.
40. Stragier, P., Bonamy, C. & Karmazyn-Campelli, C. (1988) Pro-
cessing of a sporulation sigma factor in Bacillus subtilis:How
morphological structure could control gene expression. Cell 52 ,
697±704.
41. Hofemeister, J., Israelis-Reches, M. & Dubnau, D. (1983) Inte-
gration of plasmid pE194 at multiple sites on the Bacillus subtilis
chromosome. Mol. Gen. Genet. 189, 58±68.
42. Edens, L., Heslinga, L., Klok, R., Ledeboer, A.M., Maat, J.,
Toonen,M.Y.,Visser,C.&Verrips,T.(1982)CloningofcDNA
encoding the sweet-tasting plant protein thaumatin and its
expression in Escherichia coli. Gene 18 , 1±12.
43. Blackman,S.A.,Smith,T.J.&Foster,S.J.(1998)Theroleof
autolysins during vegetative growth of Bacillus subtilis 168.
Microbiology 144, 73±82.
44. Harwood, C.R., Coxon, R.D. & Hancock, I.C. ( 1990) The
Bacillus cell envelope and secretion. In: Molecular Biological
Methods for Bacillus (Harwood, C.R. & Cutting, S.M., eds),
p. 374. John Wiley & S ons Ltd, New York.

45. Foster, S.J. (1992) Analysis of the autolysins of Bacillus subtilis 168
during vegetative growth and dierentiation by using renaturing
polyacrylamide gel electrophoresis. J. Bacteriol. 174, 464±470.
46. Rosenthal, A.L. & Lacks, S.A. (1977) Nuclease detection in SDS-
polyacrylamide gel electrophoresis. Anal Biochem. 80, 76± 90.
47. Meyer, S., Melzer, M., Truernit, F., Hu
È
mmer, C., Besenbeck, R.,
Stadler, R . & Sauer, R. (20 00) AtS UC3 , a gene encoding a new
Arabidopsis sucrose transporter, is expressed in cells adjacent to
the vascular tissue and in a carpel cell layer. Plant J. 24, 869±882.
48. Ash, C., Farrow, J.A., Dorsch, M., Stackebrandt, E. & Collins,
M.D. (1991) Comparative analysis of Bacillus anthracis, Bacillus
cereus, and related species on the basis of reverse transcriptase
sequencing o f 16S rRNA. Int. J. Syst. B acteriol. 41, 343±346.
49. Zhang, Y.B., Greenberg, B. & L acks, S.A. (1997) Analysis of a
Streptococcus pneumoniae gene encoding signal peptidase I and
overproduction of the e nz yme. Gene 194, 249±255.
50. van Roosmalen, M.L., Jongbloed, J.D.H., Kuipers, A., Venema,
G., Bron, S. & v an Dijl, J.M. (2000) A truncated soluble Bacillus
signal peptidase produced in Escherichia coli is subject to self-
cleavage at its active site. J. Bacteriol. 182, 5765±5770.
51. Jiang,M.,Grau,R.&Perego,M.(2000)Dierentialprocessingof
propeptide inhibitors of Rap phosphatases in Bacillus subtilis.
J. Bacteriol. 18 2 , 303±310.
52. van Sinderen, D., Kiewiet, R. & V enema, G. (1995) Dierential
expression of two closely ralated deoxyribonuclease genes, nucA
and nucB. Bacillus subtilis. Mol. Microbiol. 15, 213± 223.
53. Vehmaanpera
È

, J., Steinborn, G. & Hofemeister, J. (1991) Genetic
manipulation of Bacillus amyloliquefaciens. J. Biotechnol. 19,
221±240.
Ó FEBS 2002 Signal peptidases of B. amyloliquefaciens (Eur. J. Biochem. 269) 469