Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

The SWI
⁄
SNF protein BAF60b is ubiquitinated through a
signalling process involving Rac GTPase and the RING
finger protein Unkempt
Patrick Lore
`
s
1,2,
*, Orane Visvikis
1,2,
*, Rosa Luna
1,2
, Emmanuel Lemichez
3,4
and Ge
´
rard Gacon
1,2
1 Institut Cochin, Universite
´
Paris Descartes, CNRS (UMR8104), Paris, France
2 INSERM, U567, Paris, France
3 INSERM, U895, Centre Me
´
diterrane
´
en de Me
´
decine Mole
´

culaire, C3M, Toxines Microbiennes dans la relation ho
ˆ
te pathoge
`
nes, Nice, France
4 Universite
´
de Nice Sophia-Antipolis, UFR Me
´
decine, Nice, France
Keywords
BAF60; Rac GTPase; RING finger; SWI ⁄ SNF
complex; ubiquitination
Correspondence
G. Gacon, De
´
partement Ge
´
ne
´
tique et
De
´
veloppement, Institut Cochin, 24 rue du
Faubourg Saint-Jacques, 75014 Paris,
France
Fax: +33 1 44 41 24 48
Tel: +33 1 44 41 24 70
E-mail:
*These authors contributed equally to this

work
(Received 4 September 2009, revised 30
November 2009, accepted 8 January
2010)
doi:10.1111/j.1742-4658.2010.07575.x
The SWI ⁄ SNF chromatin remodelling complexes are important regulators
of transcription; they consist of large multisubunit assemblies containing
either Brm or Brg1 as the catalytic ATPase subunit and a variable subset of
approximately 10 Brg⁄ Brm-associated factors (BAF). Among these factors,
BAF60 proteins (BAF60a, BAF60b or BAF60c), which are found in most
complexes, are thought to bridge interactions between transcription factors
and SWI ⁄ SNF complexes. We report here on a Rac-dependent process
leading to BAF60b ubiquitination. Using two-hybrid cloning procedures,
we identified a mammalian RING finger protein homologous to drosophila
Unkempt as a new partner of the activated form of RacGTPases and dem-
onstrated that mammalian Unkempt specifically binds to BAF60b and pro-
motes its ubiquitination in a Rac1-dependent manner. Immunofluorescence
studies demonstrated that Unkempt is primarily localized in the cytoplasmic
compartment, but has the ability to shuttle between the nucleus and the
cytoplasm, suggesting that the Rac- and Unkempt-dependent process lead-
ing to BAF60b ubiquitination takes place in the nuclear compartment.
Ubiquitinated forms of BAF60b were found to accumulate upon treatment
with the proteasome inhibitor MG132, indicating that BAF60b ubiquitina-
tion is of the degradative type and could regulate the level of BAF60b in
SWI ⁄ SNF complexes. Our observations support the new idea of a direct
connection between Rac signalling and chromatin remodelling.
Structured digital abstract
l
MINT-7543606: Rac1 (uniprotkb:P63000) physically interacts (MI:0915) with Unkempt (uni-
protkb:

B1GXI8)bytwo hybrid (MI:0018)
l
MINT-7543198: Unkempt (uniprotkb:B1GXI8) physically interacts (MI:0915) with Rac1 (uni-
protkb:
P63000)bypull down (MI:0096)
l
MINT-7543251: Unkempt (uniprotkb:B1GXI8) physically interacts (MI:0915) with BAF60b
(uniprotkb:
B4DV56)bypull down (MI:0096)
l
MINT-7543745: Unkempt (uniprotkb:B1GXI8) physically interacts (MI:0915) with BAF60b
(uniprotkb:
B4DV56)bytwo hybrid (MI:0018)
l
MINT-7543182: Ubiquitin (uniprotkb:P61864) physically interacts (MI:0915) with Unkempt
(uniprotkb:
B1GXI8)bypull down (MI:0096)
l
MINT-7543805: Ubiquitin (uniprotkb:P61864) physically interacts (MI:0915) with Unkempt
(uniprotkb:
Q6RUT6)bypull down (MI:0096)
l
MINT-7543760: Ubiquitin (uniprotkb:P61864) physically interacts (MI:0915) with BAF60b
(uniprotkb:
B4DV56)bypull down (MI:0096)
Abbreviations
BAF, Brg ⁄ Brm-associated factor; GST, glutathione S-tranferase; HA, hemagglutinin; UNK-C-ter, Unkempt C-terminal region; UNK-fl, full-
length Unkempt; shRNA, short hairpin RNA.
FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1453
Introduction

The SWI ⁄ SNF chromatin remodelling complexes are
evolutionary conserved multimeric enzymes using ATP
hydrolysis to mobilize nucleosomes and remodel
chromatin structure [1–4]; these complexes are large
multisubunit assemblies containing either Brm or Brg1
as the catalytic ATPase subunit and a variable subset
of approximately 10 Brg ⁄ Brm-associated factors
(BAF). Among the later, the 60 kDa subunit BAF60 is
found in most complexes; it can be represented by
BAF60a, BAF60b or BAF60c, which are encoded by
the smarcd1, smarcd2 and smarcd3 genes, respectively
[1]. BAF60 proteins have been shown to interact with
multiple transcription factors and are thought to
bridge interactions between these transcription factors
and SWI ⁄ SNF complexes, thereby allowing the recruit-
ment of SWI ⁄ SNF to target genes [5–9].
Biochemical purification and analysis of SWI ⁄ SNF
complexes have revealed that few to no free subunits are
present within the cells, suggesting that most, if not all,
subunits are assembled into the complexes [1]. Thus,
cells must co-ordinate the expression and degradation of
SWI ⁄ SNF subunits in order to maintain the stoichiome-
try of the complexes. Recent studies have demonstrated
the role of protein–protein interactions, ubiquitination
and proteasomal degradation in regulating SWI⁄ SNF
subunit levels [10,11]. However, the mechanisms leading
to ubiquitination of specific SWI ⁄ SNF subunits and
their regulation have not been molecularly defined.
Ubiquitination consists of the covalent attachment
to proteins of ubiquitin, a highly conserved 76 amino

acid polypeptide. It is catalysed by three enzymes: a
ubiquitin-activating enzyme (E1), a ubiquitin-conjugat-
ing enzyme (E2) and a ubiquitin protein ligase (E3),
acting sequentially to form an isopeptide bond between
the ubiquitin C-terminus and the e-amino group of
lysines of the protein substrate; ubiquitin contains
seven lysine residues that can be attached to other
ubiquitins in a highly processive reaction to form a
polyubiquitin chain [12,13]. The specificity of protein
ubiquitination is conferred by E3 ligases, which have
the ability to bind both to an E2 and to the substrate;
consistently, in contrast to two E1 genes and less than
40 E2 genes, a genome-wide annotation of human E3
ligases recently identified more than 600 genes encod-
ing putative E3s, the vast majority of which exhibit a
RING finger domain [14]. Ubiquitination, which was
initially found to target proteins to proteasomal degra-
dation, has emerged more recently as a central regula-
tory mechanism that controls not only protein
stability, but also localization, interactions and func-
tions of modified proteins [15,16].
We report here on the occurrence of BAF60 ubiqui-
tination. We have identified and characterized a signal-
ling process involving Rac GTPase and a novel
partner of activated Rac, the RING finger protein
Unkempt, which binds to BAF60b and promotes its
specific ubiquitination.
Results
Unkempt protein binds specifically to activated
forms of RacGTPases

In a two-hybrid screen for partners of activated
RacGTPase, we isolated a human cDNA sequence
with a partial ORF showing a strong homology with a
previously described drosophila protein, d-Unkempt
[17], and with Unkempt-like sequences from human
and mouse origin (accession UniProtKB ⁄ TrEMBL
Q9H9P5 and Q6RUT6, respectively). Northern blot
analysis revealed ubiquitous expression of a 4.4 kb
mRNA in mouse tissues (not shown). Iterative 5¢
RACE PCR amplification starting from mouse and
human RNA resulted in ORFs encoding two predicted
proteins of 678 and 680 amino acids, respectively, with
quasi-identical sequences (87% identity; 95% similar-
ity) and significant homology with the full-length dro-
sophila d-Unkempt (40% identity; 64% similarity)
(Fig. 1A). The novel human mRNA sequence that
encodes the 680 amino acid Unkempt-like protein has
been assigned the accession number AM944365 by the
EMBL nucleotide sequence database. Alignment of
drosophila Unkempt protein with mouse and human
Unkempt-like sequences revealed conserved zinc finger
motifs in the N-terminal part of the protein and a
RING finger at the C-terminal end (Fig. 1A). For
further studies, we constructed plasmids encoding
glutathione S-transferase (GST)- and hemagglutinin
(HA)-tagged human Unkempt C-terminal region
(UNK-C-ter) and murine full-length Unkempt (UNK-
fl), as well as mutated versions of these proteins, as
shown in Fig. 1B.
Interestingly, the putative interaction between acti-

vated Rac and UNK-C-ter could be validated by GST
pull-down experiments. Indeed, the results confirmed
the specificity of the binding of activated Rac to
UNK-C-ter, as the GTP-bound form Rac1L61 showed
a strong binding to UNK-C-ter, whereas Rac1 WT
(predominantly GDP bound) and Rac1N17 (a domi-
nant negative form of Rac) did not interact with
UNK-C-ter (Fig. 2) and neither RhoAL63 nor
Cdc42L61, i.e. the activated forms of archetypal mem-
BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore
`
s et al.
1454 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS
bers of Rho and Cdc42 subfamilies, was able to bind
to UNK-C-ter (Fig. 2). Of note, the disruption of the
RING finger in the mutant form UNK-C-ter double
mutant (C639A ⁄ C670A double mutant) did not impair
the binding of RacGTP.
The data indicate that Unkempt is a specific partner
of the GTP-bound form of RacGTPases and therefore
suggest that its function, whatever it is, may be
regulated by Rac signalling.
Little is known about the role of Unkempt in dro-
sophila: homozygous inactivation of d-unkempt
resulted in larval lethality, whereas heterozygous flies
bearing an hypomorphic allele showed roughened eyes,
splayed wings and crossed scutellar bristles, i.e. the
so-called Unkempt phenotype [17]. Moreover, the
biochemical activity of d-Unkempt protein has not
been documented.

Unkempt ubiquitination is stimulated by
activated Rac
As mentioned above (Fig. 1A, B), Unkempt contains
in its C-terminal region a conserved RING finger,
a motif that is typical of a large group of E3 ubiquitin
ligases known as RING E3s [14,18]; this prompted us
to investigate whether self-ubiquitination and ubiquitin
A
B
Fig. 1. Structure of Unkempt proteins. (A) Sequence alignment of human, mouse and drosophila Unkempt proteins. Triple identity is shown
in red, double identity in orange. Zinc finger and RING finger motifs are indicated by blue and green bars, respectively, the conserved C ⁄ H
being indicated by asterisks. The position of the C-terminal RING finger deletion in UNK-fl-DRF is indicated by a red arrowhead. (B) Sche-
matic representation of the Unkempt-derived proteins used in the present study. Zinc finger and RING finger motifs are in dark and light
grey, respectively. The C to A mutations of the RING finger in UNK-C-ter double mutant (UNK-C-ter-DM) are indicated.
P. Lore
`
s et al. BAF60b ubiquitination is controlled by Rac and Unkempt
FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1455
ligase activity were associated with mammalian
Unkempt.
HA-tagged versions of Unkempt and 6-His-tagged
ubiquitin were coexpressed in cultured cells and the
resulting 6-His-tagged ubiquitinated proteins were col-
lected on cobalt beads and analysed by western blot-
ting. Following this procedure, we were able to
demonstrate Unkempt ubiquitination in various cell
lines, including CHO, HEK 293 (not shown) and HeLa.
As shown in Fig. 3A, UNK-C-ter ubiquitination
was clearly detected in HeLa cells; interestingly, the
ubiquitination pattern was enhanced by activated

Rac1(Rac1L61) and decreased by the dominant nega-
tive mutant Rac1N17, thus suggesting that Rac activa-
tion positively regulates Unkempt ubiquitination. Of
note, the substitution of two cysteine residues in the
RING finger motif (C639A ⁄ C670A double mutant; see
Fig. 1B) did not drastically impair UNK-C-ter ubiqui-
tination; the stimulating effect of activated Rac was
also maintained in the mutant (Fig. 3A). Analysis of
UNK-fl ubiquitination led to similar observations, as
shown in Fig. 3B: UNK-fl ubiquitination was found to
be inhibited by Rac1N17 and stimulated by activated
Rac1 and deletion of the RING finger in UNK-fl
(UNK-fl DRF) did not abrogate, but rather enhanced,
ubiquitination and did not alter the stimulating effect
of activated Rac.
In all cases, proteasome inhibition through MG132
treatment resulted in the accumulation of ubiquitinated
forms (as illustrated for UNK-C-ter in Fig. 3A).
Collectively, the above data indicate that Unkempt
does undergo ubiquitination; this process is clearly up-
regulated by activated Rac. Surprisingly, the RING
finger domain appears to be dispensable for Unkempt
ubiquitination, thus suggesting the involvement of
partner protein(s) contributing Ubiquitin ligase activ-
ity. In this connection, it is noteworthy that several
Fig. 2. Unkempt interacts specifically with activated Rac GTPase.
HeLa cells were transfected with plasmids encoding myc-tagged
GTPases RhoA, Rac1 and Cdc42, either wild-type (Rac1WT and
Cdc42WT), inactive mutant form (Rac1N17) or activated mutant
forms (RhoAL63, Rac1L61, Cdc42L61).The expression level of GTP-

ases in total cellular lysates is shown (input). The GTPases were
extracted from lysates with GST-UNK-C-ter (WT or RING finger
double mutant) beads, or with GST beads as a control, and pull-
down proteins were revealed by anti-myc western blotting (pull-
down). The results are representative of three experiments.
A
B
Fig. 3. Ubiquitination of Unkempt is dependent on activated Rac.
Ubiquitination of Unkempt was assessed by transfecting HeLa cells
with a combination of expression plasmids encoding 6His-Ub,
myc-Rac1L61 ⁄ N17 and HA-UNK-C-ter or HA-UNK-fl as indicated.
Ubiquitinated proteins were extracted on cobalt beads and immu-
noblotted with anti-HA IgG. The expression of transfected proteins
was monitored on total protein extracts by immunoblotting using
the indicated antibodies. Where indicated, cells were treated with
the proteasome inhibitor MG132 for 4 h prior to lysis. (A) Ubiquiti-
nation of UNK-C-ter. WT, UNK-C-ter wild-type; DM, UNK-C-ter dou-
ble mutant C639A, C670A. (B) Ubiquitination of UNK-fl. WT, UNK-fl
wild-type; DRF, UNK-fl with RING finger deletion. The results are
representative of at least three experiments.
BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore
`
s et al.
1456 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS
RING finger proteins devoid of intrinsic ubiquitin
ligase activity have been found to form oligomeric
complexes, especially with other RING finger proteins,
resulting in active E3 ligases [19–22].
We therefore reasoned that Unkempt may partici-
pate in a protein complex showing an E3 ligase

activity regulated by Rac and directed towards
Unkempt itself and possibly other substrates to be
identified.
BAF60b, a component of the SWI
⁄
SNF chromatin
remodelling complex, shows a Rac
⁄
Unkempt-
dependent ubiquitination
In a search for Unkempt interacting proteins, a
two-hybrid screen using UNK-C-ter as bait allowed
the isolation of several independent cDNA clones
encoding the C-terminal part of BAF60b ⁄ SMARCD2
(see Materials and methods, and Fig. 4A); BAF pro-
teins are constitutive of the SWI ⁄ SNF multiprotein
chromatin remodelling complexes that contain either
Brm or Brg1 as the core ATP hydrolysing subunit
[1–3]. BAF60a, b and c are homologous proteins,
thought to bridge interactions between transcription
factors and SWI ⁄ SNF complexes [5–9].
Despite the overall homology among BAF60
family members, pull-down experiments demonstrated a
clear interaction of UNK-C-ter only with BAF60b
(Fig. 4B). Sequencing our BAF60a, b and c encoding
plasmids revealed significant differences between
BAF60b and both BAF60a and BAF60c within the
region involved in UNK-C-ter interaction, which
could explain their differential binding (Fig. 4A).
Substitution of two conserved cysteine residues in the

A
B
Fig. 4. BAF60 proteins and their interactions with UNK-C-ter. (A) Sequence alignment of human BAF60a, b and c proteins used in the pres-
ent study. Triple identity is indicated in red, double identity in orange. The region of BAF60b involved in UNK-C-ter interaction, as mapped
from two-hybrid clones, is underlined (green bar). (B) UNK-C-ter interacts specifically with BAF60b. HeLa cells were transfected with expres-
sion plasmids encoding FLAG-tagged BAF60a, b or c. Proteins were extracted from lysates with GST-UNK-C-ter (WT or RING finger double
mutant) beads, or by GST beads as a control, and pull-down proteins were revealed by anti-FLAG western blotting. Identical results were
obtained in two independent experiments.
P. Lore
`
s et al. BAF60b ubiquitination is controlled by Rac and Unkempt
FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1457
RING finger motif of UNK-C-ter (C639A ⁄ C670A
double mutant) did not significantly alter the binding of
BAF60b (Fig. 4B).
Considering that BAF60b may be a partner of
Unkempt, we investigated BAF60b ubiquitination and
its regulation by Rac and Unkempt. Attempts to
detect the ubiquitinated fraction of endogenous
BAF60b were unsuccessful, possibly due to the low
sensitivity of available antibodies (not shown). There-
fore, a FLAG-tagged version of BAF60b was
expressed in HeLa cells, and the resulting ubiquitina-
tion of FLAG-BAF60b could be analysed.
As illustrated in Fig. 5A, ubiquitinated forms of
BAF60b were detected in HeLa cells in the absence of
ectopic expression of Unkempt; they were found to
accumulate upon treatment with the proteasome inhibi-
tor MG132, indicating that BAF60b ubiquitination is at
least partly of the degradative type. Interestingly, simi-

lar patterns of BAF60b ubiquitination were observed
in HEK 293 and CHO cell lines (Fig. 5A). Most
AB
CD
Fig. 5. Ubiquitination of BAF60b. (A) Ubiquitinated BAF60b is detected in HeLa, HEK 293 and CHO-K1 cells in the absence of exogenous
Unkempt and accumulates upon treatment with proteasome inhibitor MG132. Ubiquitination of BAF60b was assessed by transfecting cells
with plasmids encoding 6His-Ub and FLAG-BAF60b; where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior
to lysis. Ubiquitinated proteins were collected on cobalt beads and immunoblotted with anti-FLAG IgG. (B) BAF60b ubiquitination is downreg-
ulated by an Unkempt-specific shRNA. HeLa cells were transfected with pSUPER plasmids containing either no additional sequence (h), a
scrambled sequence (SCR) or an Unkempt targeting sequence (UNK) prior to performing ubiquitination assays (see Experimental procedures
for details and sequences). The same experiment was performed four times with similar results. (C) BAF60b is the preferred substrate of
Unkempt-dependent ubiquitination. Ubiquitination of BAF60a, b and c was assessed by transfecting HeLa cells with a combination of expres-
sion plasmids encoding 6His-Ub, FLAG-BAF60a, b or c, and HA-UNK-C-ter. Ubiquitinated proteins were collected on cobalt beads and immu-
noblotted with anti-FLAG Ig. Where indicated, cells were treated with the proteasome inhibitor MG132 for 4 h prior to lysis. (D) BAF60b
ubiquitination is strongly dependent on Rac activation. Ubiquitination assays were carried out as previously described, in HeLa cells express-
ing either no exogenous Unkempt, UNK-C-ter, or UNK-fl and Rac1N17 or Rac1L61, as indicated. The results are representative of at least
three experiments.
BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore
`
s et al.
1458 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS
importantly, in HeLa cells, the expression of an
Unkempt-specific short hairpin RNA (shRNA) led to a
more than 80% knockdown of Unkempt mRNA, as
measured by semiquantitative RT-PCR, and resulted in
a clear decrease in the amount of ubiquitinated BAF60b
(Fig. 5B), implying that endogenous Unkempt is
involved in BAF60b ubiquitination.
As expected, expression of UNK-C-ter resulted in
enhanced ubiquitination of BAF60b (Fig. 5C, left

panel); of note, ubiquitination assays run in parallel
with BAF60a, b and c demonstrated that, in agreement
with interaction studies (see Fig. 4), BAF60b is the
preferred substrate of Unkempt-dependent ubiquitina-
tion. Similar to the pattern observed in the absence of
ectopic expression of Unkempt (Fig. 5A), ubiquiti-
nated forms of BAF60b generated in the presence of
UNK-C-ter strongly accumulated upon MG132 treat-
ment (Fig. 5C, right panel).
Next, we analysed the effects of Rac activation on
BAF60b ubiquitination. When coexpressed with the
dominant negative mutant Rac1N17 (i.e. in the
absence of activated Rac), BAF60b was poorly ubiqui-
tinated; by contrast, the ubiquitination profile was
strikingly enhanced by coexpression of Rac1L61
(Fig. 5D, lane 1 versus 4). Similarly, in the presence of
exogenous Unkempt, either UNK-C-ter or UNK-fl,
the amount of BAF60b ubiquitination appeared
strongly dependent on Rac activation (Fig. 5D, lane 2
versus 5 and lane 3 versus 6). Interestingly, the stimu-
lation of BAF60b ubiquitination could be replicated
by treating HeLa cells with CNF1, a toxin from uro-
pathogenic Escherichia coli known to strongly activate
endogenous Rac [23], thus confirming the results of
ectopic expression of activated Rac (not shown).
Although Unkempt seems to play a critical role in
BAF60b ubiquitination, it is noteworthy that muta-
ted ⁄ deleted forms UNK-C-ter and UNK DRF retained
full efficiency in BAF60b ubiquitination and Rac-
dependent regulation (Fig. S1), thus suggesting that

the RING finger domain of ectopically expressed
Unkempt is not critical for these effects.
The above data indicate that BAF60b ubiquitination
is an Unkempt-dependent process and is tightly regu-
lated by Rac GTPase.
Unkempt protein shuttles between cytosolic and
nuclear compartments in HeLa cells
Assuming that BAF60b is ubiquitinated through a
process depending on Unkempt and activated Rac, the
question arises of the cellular compartment where this
process takes place. Indeed, although Rac activation is
believed to occur primarily at the plasma membrane,
BAF60b, as well as BAF60a and BAF60c, were found,
as expected, entirely localized to the nuclear compart-
ment (Fig. 6A). Conversely, UNK-fl was detected
mostly in the cytosol; however, it was found to accu-
mulate in the nucleus upon treatment of the cells with
leptomycin B, a specific inhibitor of the nuclear export
protein exportin 1 (Fig. 6B). This observation is strong
evidence that UNK-fl has the ability to shuttle between
the nucleus and the cytoplasm and can therefore reach
its putative substrate BAF60b in the nuclear compart-
ment. Interestingly in this regard, several studies have
reported on the localization of Rac1GTPase in the
nuclear compartment; specifically, it has been shown
that the polybasic sequence in the Rac1 C-terminal
region behaves like an active nuclear localization signal
(NLS) [24]. Moreover, Rac1, in association with Mgc-
RacGAP, has also been implicated in the nuclear entry
of signal transducer and activator of transcription

(STAT) transcription factors [25]. Finally, recent
studies have convincingly demonstrated a cell cycle-
dependent modulation of the amount of Rac1 in the
nucleus (i.e. accumulation in late G2 and exclusion in
early G1) [26]. These results prompted us to investigate
whether the binding of activated Rac might influence
the shuttling of Unkempt between cytosol and nucleus:
so far we have not been able to demonstrate any dif-
ferential effect of Rac1L61 or Rac1N17 on nuclear
accumulation of Unkempt (not shown).
However, taken together, these data support the idea
that Rac and Unkempt can translocate in the nuclear
compartment and activate BAF60b ubiquitination;
how these processes are co-ordinated remains to be
analysed.
Discussion
Although the results reported above are consistent
with BAF60b being ubiquitinated through a Rac- and
Unkempt-dependent process, the molecular composi-
tion of the E3 ligase involved and the role of Unkempt
RING finger remain uncertain. On the basis of the
results of a mutational analysis (Figs 3 and S1), it
appears that the RING finger of exogenously
expressed Unkempt is not critically involved in the
ubiquitination reaction. A possible explanation is that
exogenously expressed mutants of Unkempt form
dimers ⁄ oligomers with endogenous Unkempt and ⁄ or
associates with other RING finger protein(s), resulting
in active E3 ligase. As already mentioned, there are
multiple examples of RING E3s, the activity of which

critically depends on multiprotein complexes, including
homo- or hetero-oligomers of RING finger proteins.
Of note, interaction between RING finger proteins
P. Lore
`
s et al. BAF60b ubiquitination is controlled by Rac and Unkempt
FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1459
does not necessarily depend on the RING finger motif
itself. Thus, yBRE1, a RING finger protein involved
in H2B ubiquitination in budding yeast, forms a
homomeric complex, possibly a tetramer, through
multiple intermolecular interactions, implicating only
minimally the C-terminal RING finger [27]. Similarly,
in human, the RING finger type paralogs hBRE1A
and hBRE1B form a heterotetramer and are both
required for H2B ubiquitination, but the hBRE1B
RING finger is dispensable [28]. Another interesting
example is provided by Pirh2, a p53-induced RING
finger E3 ligase promoting ubiquitination and degrada-
tion of p53; very recently, isoforms of Pirh2 with a dis-
rupted RING finger motif have been found capable of
promoting p53 ubiquitination, possibly through their
ability to interact directly with MDM2, the principal
E3 ligase for p53 [24,29]. The RING finger protein
Unkempt may share similarities with these models. We
have recently observed that UNK-C-ter is capable of
forming homomeric complexes in GST pull-down
experiments (unpublished results); however, it remains
to be demonstrated that an E3 ligase activity is associ-
ated with Unkempt homomers (or with heteromers

involving an unidentified RING finger protein) and
whether and how RacGTP regulates this putative E3
ligase. To address these issues, in vitro studies aimed at
analysing intrinsic E3 ligase activity of recombinant
Unkempt will be required.
Our results also raise the questions of the physiolog-
ical relevance and significance of BAF60b ubiquitina-
tion. Unfortunately, using available antibodies to
BAF60b, we were not able to detect ubiquitinated
forms of endogenous BAF60b. However, in HeLa cells
expressing exogenous BAF60b, we found that BAF60b
is significantly ubiquitinated, even in the absence of
exogenous Unkempt; in addition, the ubiquitinated
forms of BAF60b strongly accumulated in the presence
of MG132, suggesting that the fate of ubiquitinated
BAF60b is proteasomal degradation. Thus, it may be
that ubiquitination results in degradation of an excess
of BAF60b subunits, thereby allowing the stoichiome-
try of SWI ⁄ SNF complexes to be maintained. Another
interesting possibility would be that BAF60b, alone or
in complex with Unkempt, interacts with other uniden-
A
B
Fig. 6. Subcellular localization of BAF60 and
Unkempt proteins. (A) Nuclear localization of
BAF60 proteins. HeLa cells were trans-
fected with FLAG-BAF60a, b or c, and FLAG
immunofluorescence was carried out on
fixed cells the following day. (B) Nucleocyto-
plasmic shuttling of Unkempt. HeLa cells

were transfected with HA-UNK-fl expression
vector, and left untreated or treated over-
night with the nuclear export inhibitor lepto-
mycin B (LMB). Unkempt accumulated in
the cytoplasm of untreated cells (upper
panels), but could also be detected in the
nucleus of LMB-treated cells (lower panels).
BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore
`
s et al.
1460 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS
tified substrates of Unkempt-dependent E3 ligase. As
previously mentioned, BAF60 proteins are thought to
bridge interactions between transcription factors and
SWI ⁄ SNF complexes [5–9]; therefore, candidate sub-
strates include other constituents of SWI ⁄ SNF com-
plexes, some of which have been found to be regulated
by proteasomal degradation [10,11], and transcription
factors targeted by BAF60b that remain to be defined.
Whatever the precise mechanisms are, Unkempt
may be importantly linked to the physiological control
of the SWI ⁄ SNF complexes, thus opening up a direct
connection between Rac signalling and chromatin
remodelling.
Experimental procedures
cDNA cloning
Two-hybrid cloning procedures using RacL61 as a bait to
screen a Jurkat cDNA library have been previously
described [30]. Among others, we isolated a series of overlap-
ping clones homologous to drosophila Unkempt [17].

Several rounds of 5¢ RACE were performed (5¢RACE
System; Invitrogen, Carlsbad, CA, USA) to complete the
human and mouse cDNA sequences, using as templates
human and mouse polyA
+
-enriched fractions extracted from
peripheral blood leukocytes and kidney, respectively. cDNA
sequences deduced from sequencing overlapping 5¢ RACE
fragments were confirmed by resequencing both strands of
the complete cDNAs amplified by RT-PCR (Access RT-
PCR System; Promega, Madison, WI, USA) using 5¢- and
3¢-specific primers.
In the search for Unkempt-interacting proteins, a human
placental cDNA library was screened with UNK-C-ter as
the bait (Hybrigenics S.A., Paris, France); this resulted in
the isolation of four ‘high confidence’-independent clones
encoding overlapping regions of hSMARCD2 ⁄ BAF60b.
DNA plasmids and mutagenesis
Mouse and human Unkempt cDNA were inserted in N-ter-
HA pcDNA-3 (Invitrogen) and in pGEX-4T2 (Pharmacia,
Pfizer, New York, NY, USA) plasmid vectors.
A RING finger deletion mutant was generated from the
full-length sequence in pCDNA3 by NcoI digestion, Kle-
now extremities fill-in and re-ligation. Human cDNAs of
WTRac1 and WTCdc42, dominant negative mutant
Rac1N17 and constitutively activated forms Rac1L61,
Cdc42L61 and RhoAL63, cloned in pRK5-myc plasmids
were obtained from A. Hall (Memorial Sloan-Kettering
Cancer Center, New York, NY, USA); the pRBG4-6His-
myc-Ub plasmid has been used previously [31,32]. Expres-

sion vectors encoding FLAG-BAF60a, b and c were
generated by inserting BAF60a, b and c cDNAs (a gift
from W. Wang, National Institutes of Health, Baltimore,
MD, USA) into a p3XFLAG-myc-CMV
Ò
-24 expression
vector (Sigma, St Louis, MO, USA).
The point mutations were generated with primers
5¢CCGCTCCCGGCAGGCCACAGC CTGCCTGGCGCG
GAGCTGG (for C639A mutation) and 5¢CCTTGCAG
TAGGGGGCCTCAGGTGCGGTGGC (for C670A m uta-
tion) and their respective reverse complement primers, using
the QuickChange-Site Directed Mutagenesis Kit (Strata-
gene, La Jolla, CA, USA ) following the manufacturer’s
procedure. In all cases, the absence of additional mutations
was verified by sequencing the entire coding region.
Unkempt mRNA silencing
pSUPER.basic (Oligoengine, Seattle, WA, USA) was used
as a shRNA expression vector, to target the Unkempt
mRNA sequence 5¢GCAGAACCACCTGGCCGTG. The
scrambled sequence 5¢CGGACCGGACTTCGACGCAC
was used as a control. The construction of pSUPER
vectors was carried out following the manufacturer’s
instructions. In silencing experiments, HeLa cells were
transfected twice with pSUPER plasmids (with a 24 h inter-
val) and RNAs were extracted 24 h after the second trans-
fection, using RNAxel (Eurobio, Les Ulis, France).
Unkempt cellular mRNA levels were monitored by
RT-PCR (Access RT-PCR system; Promega, Madison, WI,
USA) using Unkempt-specific primers 5¢TCTTCGAGTG

CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC,
and normalized against endogenous glutamic acid decar-
boxylase mRNA levels, detected by RT-PCR with specific
primers 5¢GTCAGCCGCATCTTCTTTTG and 5¢GCAGA
GATGATGACCCTTT.
Cell culture, reagents and transfections
HeLa (ATCC reference CCL-2), HEK 293 (ATCC reference
CRL-1573) and CHO-K1 (ATCC reference CCL-61) cells
were grown in Dulbecco’s modified Eagle’s medium (Gibco-
BRL, Rockville, MD, USA) supplemented with 10% fetal
bovine serum (Gibco-BRL), 100 lgÆmL
)1
streptomycin,
100 lgÆmL
)1
penicillin and 250 ngÆmL
)1
fungizone (Gibco-
BRL), in a humidified atmosphere of 5% CO
2
at 37 ° C.
Where indicated, cells were treated with proteasome inhibitor
MG132 20 lm (Sigma) for 4 h. Cells were transiently trans-
fected using FuGENE 6 Transfection Reagent (Roche, Basel,
Switzerland) following the manufacturer’s instructions.
Antibodies
The primary antibodies used were M2 mouse monoclonal
antibody to FLAG
Ò
epitope (Sigma), 9E10 mouse mono-

clonal antibody to myc-tag (Roche), 16B12 mouse mono-
clonal antibody to HA-tag (Roche).
P. Lore
`
s et al. BAF60b ubiquitination is controlled by Rac and Unkempt
FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1461
For western blotting, the secondary peroxidase-conju-
gated rabbit anti-mouse IgG (Dako, Glostrup, Denmark),
the secondary peroxidase-conjugated swine anti-rabbit IgG
(Dako) or the secondary peroxidase-conjugated rabbit anti-
goat IgG (Dako) were used. The secondary fluorescent anti-
body used in immunofluorescence studies was Alexa Fluor
488-labelled goat anti-mouse IgG (Molecular Probes,
Eugene, OR, USA).
Western blotting
Proteins were resolved in SDS ⁄ PAGE mini-gels and electro-
transferred onto BA85 nitrocellulose membranes (Schleicher
& Schuell, Millipore, Billerica, MA, USA). Membranes
were probed using the indicated primary antibodies and
secondary peroxidase-conjugated antibodies followed by
chemiluminescence using the ECL
Ô
western blotting detec-
tion reagent (Amersham Biosciences, Piscataway, NJ, USA).
Pull-down assay
HeLa cells seeded in 100 mm Petri dishes were transfected
with a total amount of 5 lg of the indicated GTPase and
BAF60 expression vectors. The following day, the cells were
lysed in 500 lL lysis buffer [50 m m Hepes pH 7.5, 10 mm
MgCl

2
, 150 mm NaCl, 1% Triton X-100, 0.5% NP40 and a
protease inhibitor cocktail (Amersham)]. In total, 500 lg
protein in 150 lL was incubated for 2 h at 4 °C with 15 lg
GST or GST-UNK-C-ter coupled to 20 lL glutathione-
sepharose beads (Amersham Biosciences). Pelleted beads
were washed twice with washing buffer (50 mm Tris ⁄ HCl
pH 7.5, 150 mm NaCl, 10 mm MgCl
2
,1mm dithiothreitol,
0.1% Triton X-100, 0.2 mgÆmL
)1
BSA and a protease
inhibitor cocktail). Bound proteins were recovered by
boiling beads in Laemmli sample buffer 2· (Sigma) and
analysed by western blotting.
Ubiquitination assay
HeLa, HEK 293 and CHO-K1 cells seeded in 100 mm Petri
dishes were transfected with a plasmid mix containing
1–3 lg each plasmid encoding 6His-myc-Ub and the indi-
cated proteins; in silencing experiments, HeLa cells were
transfected twice (with a 24 h interval) with plasmid mix
including pSUPER. Twenty hours after transfection, the
cells were washed in phosphate-buffered saline and lysed in
1 mL denaturating buffer (8 m urea, 20 mm Tris ⁄ HCl pH
7.5, 200 mm NaCl, 10 mm imidazole, 0.1% Triton X-100,
5mm N-ethylmaleimide, 10 mm iodoacetic acid); 50 lL
lysate was resuspended in Laemmli sample buffer 2X to
evaluate the total quantity of proteins. 6His-myc-ubiquiti-
nated proteins were recovered by incubating the remaining

lysate for 90 min with 30 lL cobalt-chelated resin (BD
TALON metal affinity resin; BD Bioscience, Lexington,
KY, USA), previously incubated in denaturating buffer
with 0.2 mgÆmL
)1
BSA. The beads were then washed four
times in 1 mL denaturating buffer, and resuspended in
25 lL Laemmli sample buffer 2X. Total lysates and ubiqui-
tinated protein fractions were resolved by SDS ⁄ PAGE and
analysed by western blotting.
Leptomycin treatment
HeLa cells plated at low confluence on 18 mm diameter
glass coverslips in 12-well plates were transfected with
0.5 lg HA-UNK-fl expression vector. The cells were treated
overnight with 10 ngÆmL
)1
leptomycin B (Sigma). The fol-
lowing day, HA immunofluorescence was performed on
fixed cells, as described previously [32].
Acknowledgements
We thank Dr W. Wang for BAF60 cDNAs. We also
thank Dr A. Doye for help with ubiquitination assays,
and F. Letourneur for assistance in sequencing work.
This work was supported by funding from INSERM,
CNRS, Universite
´
Paris Descartes and the Agence
Nationale pour la Recherche (ANR 05-MRAR-033-
02) to G.G. O.V. is the recipient of a fellowship from
the Association pour la recherche sur le cancer.

References
1 Wang W, Cote J, Xue Y, Zhou S, Khavari PA, Biggar
SR, Muchardt C, Kalpana GV, Goff SP, Yaniv M
et al. (1996) Purification and biochemical heterogeneity
of the mammalian SWI-SNF complex. EMBO J 15,
5370–5382.
2 Olave IA, Reck-Peterson SL & Crabtree GR (2002)
Nuclear actin and actin-related proteins in chromatin
remodeling. Annu Rev Biochem 71, 755–781.
3 de la Serna IL, Ohkawa Y & Imbalzano AN (2006)
Chromatin remodelling in mammalian differentiation:
lessons from ATP-dependent remodellers. Nat Rev
Genet 7, 461–473.
4 Reyes JC, Muchardt C & Yaniv M (1997) Components
of the human SWI ⁄ SNF complex are enriched in active
chromatin and are associated with the nuclear matrix.
J Cell Biol 137, 263–274.
5 Hsiao PW, Fryer CJ, Trotter KW, Wang W & Archer
TK (2003) BAF60a mediates critical interactions
between nuclear receptors and the BRG1 chromatin-
remodeling complex for transactivation. Mol Cell Biol
23, 6210–6220.
6 Debril MB, Gelman L, Fayard E, Annicotte JS, Rocchi
S & Auwerx J (2004) Transcription factors and nuclear
receptors interact with the SWI ⁄ SNF complex through
the BAF60c subunit. J Biol Chem 279, 16677–16686.
7 Ito T, Yamauchi M, Nishina M, Yamamichi N,
Mizutani T, Ui M, Murakami M & Iba H (2001)
BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore
`

s et al.
1462 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS
Identification of SWI.SNF complex subunit BAF60a as
a determinant of the transactivation potential of Fos ⁄ -
Jun dimers. J Biol Chem 276, 2852–2857.
8 Lickert H, Takeuchi JK, Von Both I, Walls JR,
McAuliffe F, Adamson SL, Henkelman RM, Wrana
JL, Rossant J & Bruneau BG (2004) Baf60c is essential
for function of BAF chromatin remodelling complexes
in heart development. Nature 432, 107–112.
9 Flajollet S, Lefebvre B, Cudejko C, Staels B & Lefebvre
P (2007) The core component of the mammalian
SWI ⁄ SNF complex SMARCD3 ⁄ BAF60c is a coactiva-
tor for the nuclear retinoic acid receptor. Mol Cell
Endocrinol 270, 23–32.
10 Chen J & Archer TK (2005) Regulating SWI ⁄ SNF
subunit levels via protein-protein interactions and prote-
asomal degradation: BAF155 and BAF170 limit expres-
sion of BAF57. Mol Cell Biol 25, 9016–9027.
11 Sohn DH, Lee KY, Lee C, Oh J, Chung H, Jeon SH &
Seong RH (2007) SRG3 interacts directly with the
major components of the SWI ⁄ SNF chromatin remod-
eling complex and protects them from proteasomal
degradation. J Biol Chem 282, 10614–10624.
12 Hershko A & Ciechanover A (1998) The ubiquitin
system. Annu Rev Biochem 67, 425–479.
13 Pickart CM & Fushman D (2004) Polyubiquitin chains:
polymeric protein signals. Curr Opin Chem Biol 8, 610–
616.
14 Li W, Bengtson MH, Ulbrich A, Matsuda A, Reddy

VA, Orth A, Chanda SK, Batalov S & Joazeiro CA
(2008) Genome-wide and functional annotation of
human E3 ubiquitin ligases identifies MULAN, a
mitochondrial E3 that regulates the organelle’s dynam-
ics and signaling. PLoS ONE 3, e1487.
15 Pickart CM (2004) Back to the future with ubiquitin.
Cell 116, 181–190.
16 Kirkin V & Dikic I (2007) Role of ubiquitin- and
Ubl-binding proteins in cell signaling. Curr Opin Cell
Biol 19, 199–205.
17 Mohler J, Weiss N, Murli S, Mohammadi S, Vani K,
Vasilakis G, Song CH, Epstein A, Kuang T, English J
et al. (1992) The embryonically active gene, unkempt,
of Drosophila encodes a Cys3His finger protein. Genet-
ics 131, 377–388.
18 Joazeiro CA & Weissman AM (2000) RING finger
proteins: mediators of ubiquitin ligase activity. Cell 102,
549–552.
19 Buchwald G, van der Stoop P, Weichenrieder O,
Perrakis A, van Lohuizen M & Sixma TK (2006) Struc-
ture and E3-ligase activity of the Ring-Ring complex of
polycomb proteins Bmi1 and Ring1b. EMBO J 25,
2465–2474.
20 Poyurovsky MV, Priest C, Kentsis A, Borden KL, Pan
ZQ, Pavletich N & Prives C (2007) The Mdm2 RING
domain C-terminus is required for supramolecular assem-
bly and ubiquitin ligase activity. EMBO J 26, 90–101.
21 Xia Y, Pao GM, Chen HW, Verma IM & Hunter T
(2003) Enhancement of BRCA1 E3 ubiquitin ligase
activity through direct interaction with the BARD1

protein. J Biol Chem 278, 5255–5263.
22 Singh RK, Iyappan S & Scheffner M (2007) Hetero-
oligomerization with MdmX rescues the ubiqu-
itin ⁄ Nedd8 ligase activity of RING finger mutants of
Mdm2. J Biol Chem 282, 10901–10907.
23 Flatau G, Lemichez E, Gauthier M, Chardin P, Paris S,
Fiorentini C & Boquet P (1997) Toxin-induced activa-
tion of the G protein p21 Rho by deamidation of
glutamine. Nature 387, 729–733.
24 Lanning CC, Ruiz-Velasco R & Williams CL (2003) Novel
mechanism of the co-regulation of nuclear transport of
SmgGDS and Rac1. J Biol Chem 278, 12495–12506.
25 Kawashima T, Bao YC, Nomura Y, Moon Y,
Tonozuka Y, Minoshima Y, Hatori T, Tsuchiya A,
Kiyono M, Nosaka T et al. (2006) Rac1 and a GTPase-
activating protein, MgcRacGAP, are required for
nuclear translocation of STAT transcription factors.
J Cell Biol 175, 937–946.
26 Michaelson D, Abidi W, Guardavaccaro D, Zhou M,
Ahearn I, Pagano M & Philips MR (2008) Rac1 accumu-
lates in the nucleus during the G2 phase of the cell cycle
and promotes cell division. J Cell Biol 181, 485–496.
27 Kim J & Roeder RG (2009) Direct Bre1-Paf1 complex
interactions and RING finger-independent Bre1-Rad6
interactions mediate H2B ubiquitylation in yeast. J Biol
Chem 284, 20582–20592.
28 Kim J, Guermah M, McGinty RK, Lee JS, Tang Z,
Milne TA, Shilatifard A, Muir TW & Roeder RG
(2009) RAD6-mediated transcription-coupled H2B
ubiquitylation directly stimulates H3K4 methylation in

human cells. Cell 137, 459–471.
29 Corcoran CA, Montalbano J, Sun H, He Q, Huang Y
& Sheikh MS (2009) Identification and characterization
of two novel isoforms of Pirh2 ubiquitin ligase that
negatively regulate p53 independent of RING finger
domains. J Biol Chem 284, 21955–21970.
30 Toure A, Dorseuil O, Morin L, Timmons P, Jegou B,
Reibel L & Gacon G (1998) MgcRacGAP, a new human
GTPase-activating protein for Rac and Cdc42 similar to
Drosophila rotundRacGAP gene product, is expressed in
male germ cells. J Biol Chem 273, 6019–6023.
31 Doye A, Mettouchi A, Bossis G, Clement R, Buisson-
Touati C, Flatau G, Gagnoux L, Piechaczyk M,
Boquet P & Lemichez E (2002) CNF1 exploits the
ubiquitin-proteasome machinery to restrict Rho GTPase
activation for bacterial host cell invasion. Cell 111,
553–564.
32 Visvikis O, Lores P, Boyer L, Chardin P, Lemichez E &
Gacon G (2008) Activated Rac1, but not the tumori-
genic variant Rac1b, is ubiquitinated on Lys 147
through a JNK-regulated process. FEBS J 275,
386–396.
P. Lore
`
s et al. BAF60b ubiquitination is controlled by Rac and Unkempt
FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS 1463
Supporting information
The following supplementary material is available:
Fig. S1. Ubiquitination of BAF60b by RING mutants
of Unkempt.

This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
BAF60b ubiquitination is controlled by Rac and Unkempt P. Lore
`
s et al.
1464 FEBS Journal 277 (2010) 1453–1464 ª 2010 The Authors Journal compilation ª 2010 FEBS