Báo cáo khoa học: Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling docx

Mutants of Saccharomyces cerevisiae deficient in
acyl-CoA synthetases secrete fatty acids due to
interrupted fatty acid recycling
Michael Scharnewski
1
, Paweena Pongdontri
1,
*, Gabriel Mora
1
, Michael Hoppert
2
and Martin Fulda
1
1 Department of Plant Biochemistry, Albrecht-von-Haller Institute, Georg-August University Goettingen, Germany
2 Institute for Microbiology and Genetics, Georg-August University Goettingen, Germany
Fatty acid metabolism pervades large areas of cellular
life. In all known ramifications of this metabolism,
fatty acids almost never undergo direct metabolic
conversion as free molecules. The fatty acid molecule
usually requires the activation of its carboxyl group
via esterification to either acyl-carrier-protein (ACP) or
to CoA. Only as thioesters are fatty acids able to accom-
plish any of their possible metabolic fates. In Saccha-
romyces cerevisiae, the fatty acids are synthesized by a
large multienzyme complex designated as fatty acid
synthase (FAS) on the basis of ACP [1]. In S. cerevi-
siae, the ACP is an integral component of the FAS
complex and, therefore, free acyl-ACP is not available
for any other metabolic purposes. The synthetic cycle
is terminated by transferring the generated acyl chain
directly to CoA [2]. Due to this mechanism, the direct

product of fatty acid de novo synthesis in S. cerevisiae
is acyl-CoA, which consequently is the only activated
fatty acid molecule serving all other metabolic path-
ways [1]. Besides deriving from de novo synthesis, lipid
degradation as well as import of exogenous fatty acids
may feed into the pool of intracellular fatty acids. In
both cases, enzymatic activation with CoA is required
to allow further metabolization of these fatty acids. In
Keywords
endoplasmic reticulum; FAA; FAT1; fatty
acid accumulation; lipid remodelling
Correspondence
M. Fulda, Department of Plant
Biochemistry, Albrecht-von-Haller Institute
for Plant Sciences, Georg-August University
Goettingen, Justus-von-Liebig-Weg 11,
D-37077 Goettingen, Germany
Fax: +49 551 39 5749
Tel: +49 551 39 5750
E-mail:
*Present address
Department of Biochemistry, Faculty of
Science, Khon Kaen University, Thailand
(Received 9 January 2008, revised 12 March
2008, accepted 20 March 2008)
doi:10.1111/j.1742-4658.2008.06417.x
In the present study, acyl-CoA synthetase mutants of Saccharomyces
cerevisiae were employed to investigate the impact of this activity on cer-
tain pools of fatty acids. We identified a genotype responsible for the secre-
tion of free fatty acids into the culture medium. The combined deletion of

Faa1p and Faa4p encoding two out of five acyl-CoA synthetases was
necessary and sufficient to establish mutant cells that secreted fatty acids in
a growth-phase dependent manner. The mutants accomplished fatty acid
export during exponential growth-phase followed by fatty acid re-import
into the cells during the stationary phase. The data presented suggest that
the secretion is driven by an active component. The fatty acid re-import
resulted in a severely altered ultrastructure of the mutant cells. Additional
strains deficient of any cellular acyl-CoA synthetase activity revealed an
almost identical phenotype, thereby proving transfer of fatty acids across
the plasma membrane independent of their activation with CoA. Further
experiments identified membrane lipids as the origin of the observed free
fatty acids. Therefore, we propose the recycling of endogenous fatty acids
generated in the course of lipid remodelling as a major task of both
acyl-CoA synthetases Faa1p and Faa4p.
Abbreviations
ACP, acyl-carrier protein; ER, endoplasmic reticulum; FAS, fatty acid synthase; Fat1p, fatty acid transport protein 1; Fat2p, fatty acid
transport protein 2; YPR, yeast proteose raffinose medium.
FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2765
S. cerevisiae, five genes coding for acyl-CoA syntheta-
ses have been identified. All these activities are poten-
tially able to mediate between the pool of free fatty
acids and the pool of acyl-CoA molecules. Four genes,
termed FAA1 to FAA4 (fatty acid activation), were
characterized in pioneering work by Gordon et al. [3–
9]. FAA1 and FAA4 encode acyl-CoA synthetases
involved in the activation of imported fatty acids [10].
Although Faa1p represents the major cellular activity,
both enzymes display partial redundancy and a lack of
either one can be compensated by the activity of the
other [6]. Faa1p localizes to the endoplasmic reticulum

(ER), the plasma membrane and vesicles, whereas
Faa4p is found at the ER as well as at lipid droplets
[11]. FAA2 encodes a peroxisomal activity involved in
the activation of fatty acids scheduled for b-oxidation
whereas the biological role of Faa3p has remained
unclear to date. In addition to the four FAA genes,
FAT1 was identified as the fifth source of activity feed-
ing into the acyl-CoA pool [12]. Initially isolated as a
protein involved in fatty acid transport across the
plasma membrane [13,14], it finally proved to have
acyl-CoA synthetase activity as well, with a preference
for fatty acids with chain length longer than 22 car-
bons. The protein was localized to lipid droplets and
to the ER [11], but was also reported at the plasma
membrane [15].
Given the diverse functions of fatty acids within the
metabolism, a carefully regulated distribution of fatty
acids within the cell can be anticipated. In this respect,
it is of relevance that, besides the pure enzymatic reac-
tion, acyl-CoA synthetase activity is also involved in
fatty acid transport across membranes. Cellular uptake
as well as subcellular distribution of fatty acids could
be influenced by this enzymatic activity converting a
hydrophobic substrate into a water soluble CoA-ester.
It was first established in a mutant of Escherichia coli
that a defective acyl-CoA synthetase abolished the
uptake of fatty acids from the medium. To emphasize
the tight link between fatty acid transport and acyl-
CoA synthetase activity, the mechanism was termed
‘vectorial acylation’ [16]. In S. cerevisiae, a comparable

model was proposed and evidence was provided for a
participation of Fat1p in transport in concert with the
two acyl-CoA synthetases Faa1p and Faa4p [17]. In
this model, Fat1p is involved in the import mechanism
directly, whereas acyl-CoA synthetases Faa1p and
Faa4p is proposed to be responsible for the abstraction
of the delivered fatty acid from the membrane and
concomitantly rendering the fatty acid water soluble
by esterification, thereby trapping the molecule in the
cytoplasm. On the other hand, the model is not with-
out controversy and, alternatively, a concept has been
developed describing fatty acid movement across a
membrane as a passive process. This mechanism of
simple diffusion is based on the fast flip-flop of fatty
acids through the membrane and has been reviewed
comprehensively [18,19].
Reviewing the currently available data, the precise
role of acyl-CoA synthetases in regulating certain
pools of fatty acids as well as their potential impact on
fatty acid transport across membranes both remain
elusive. In this context, we were intrigued by two
reports [20,21] linking the disruption of FAA1 in
Candida lipolytica and in S. cerevisiae to a fatty acid
secretion phenotype. In the mutant strains described,
the control over certain fatty acid pools appeared to
be restricted and, in addition, fatty acid transport
could also be affected. Because the mutant strains
derived in both cases from random mutagenesis experi-
ments, the exact genetic constitutions were not
unequivocally established and the molecular basis for

the phenotype may have been not fully understood.
However, if the underlying mechanisms of this pheno-
type could be elucidated, such a strain might provide a
valuable tool to study the role of distinct acyl-CoA
synthetases in regulating certain pools of fatty acids.
To assess the role of acyl-CoA synthetases in regu-
lating particular pools of fatty acids, we used mutants
of S. cerevisiae characterized by various combinations
of deletions in the corresponding genes. In mutants
defective for Faa1p and Faa4p, we observed a tran-
sient fatty acid secretion phenotype. We demonstrate
fatty acid transport in the absence of any acyl-CoA
synthetase activity, and data are presented demonstrat-
ing that the direction of transport is dependent on the
growth phase of the mutants. In addition, we provide
evidence for the hypothesis that Faa1p and Faa4p are
involved in the recycling of fatty acids deriving from
lipid remodelling processes.
Results
faa1D faa4D mutant cells secrete a large amount
of free fatty acids into the medium
In a first attempt to explore the fatty acid secretion
phenotype for the faa1D mutant described earlier by
Michinaka et al. [21], we employed the faa1D mutant
strain YB497 instead (similar to the other YB strains
generously provided by J. I. Gordon) and tested its
ability to secrete fatty acids. By contrast to the data
presented by Michinaka et al. [21], we were unable to
detect even traces of free fatty acids in the culture
medium by using this different strain harbouring the

same mutation. Because the strains investigated by
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2766 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS
Michinaka et al. [21] resulted from a repeatedly
employed mutagenesis with ethyl-methane sulfonate,
the precise genotype of their mutant was not well
established. Nevertheless, the data presented appeared
to indicate a role of Faa1p in the fatty acid secretion
phenotype. Assuming that one of the additional four
acyl-CoA synthetases in S. cerevisiae could mask the
phenotype by overlapping functions, we assumed that
a combined elimination of two or more of those activi-
ties might induce fatty acid secretion. Therefore, we
tested strains deficient in combinations of FAA1 and
one or more additional FAA. The experiments were
complicated by the fact that strains carrying deletions
in both FAA1 and FAA4 were flocculent in liquid cul-
ture, as described previously [10]. This characteristic
trait resulted in large cellular lumps swimming in an
essentially clear medium, making it impossible to
determine the status of the culture by measuring cell
density. By testing alternative medium compositions, a
YP medium containing raffinose (YPR) instead of dex-
trose was identified to allow proper growth as homoge-
nous cultures for all strains tested. Because the use of
raffinose was essential for the accurate measurement of
cell density in different stages of the cultures, this
sugar was used as carbon source for all following
experiments unless otherwise noted. The different
strains were grown for 48 h in YPR before the cells

were removed by centrifugation and the supernatant
was extracted and tested for free fatty acids. For
strains carrying a combined deletion of FAA1 and
FAA2 or of FAA1 and FAA3, we did not observe any
fatty acid secretion phenotype. However, the combined
deletion of FAA1 and FAA4 resulted in the accumula-
tion of significant amounts of free fatty acids in the
culture medium. Whereas no fatty acids were detected
in the media of wild-type cells of 48-h-old cultures,
approximately 220 lmolÆL
)1
free fatty acids were
found in the media of the mutant strain YB525 (see
supplementary Fig. S1). To investigate whether the
deletion of additional Faap would further increase the
amount of secreted fatty acids, we also tested the qua-
druple mutant YB526 deficient in four Faap activities.
The detected fatty acid concentrations in the media
proved to be similar for the double and for the qua-
druple mutant, indicating that Faa2p and Faa3p are
not significantly involved in the observed phenotype.
Surprisingly, the detected amounts of free fatty acids
in the media were high enough to result in whitish
flakes on the surface of the culture. The composition
of the secreted fatty acids reflects the profile of fatty
acids found in membrane lipids of yeast and consists
of myristic acid (14:0), palmitic acid (16:0), palmitoleic
acid (16:1), stearic acid (18:0) and oleic acid (18:1) (see
supplementary Fig. S1). We conclude from this experi-
ment that the deletion of FAA1 and FAA4 is necessary

and sufficient to produce the fatty acid secretion
phenotype. No other combination of FAA deletions
keeping either FAA1 or FAA4 intact resulted in a com-
parable phenotype.
To characterize the observed phenotype in more
detail, we first determined the progress of fatty acid
secretion in a growing culture. Therefore, we measured
the concentration of free fatty acids in the media at
several time points during the exponential and station-
ary growth phases. In these experiments, a tight corre-
lation between stage of growth and fatty acid secretion
was observed, revealing several striking characteristics
(Fig. 1A). First, the total amount of fatty acids in the
media increased continuously during early exponential
phase. Second, the fatty acid concentration in the
media did not reach a stable plateau. Instead, the total
amount of fatty acids in the media started to decline
during the late exponential phase and continued to
decrease during the stationary phase. Third, the point
in time of maximum concentration in the media was
different for specific fatty acids. Whereas 16:0 reached
its maximum concentration at 48 h and subsequently
declined, the level of the unsaturated fatty acids 16:1
and 18:1 kept their maximum concentration until
approximately 70 h before they also began to decline.
Taken together these results clearly identified the
growth stage of the culture as being an important
parameter influencing the fatty acid secretion pheno-
type.
In the next step, the underlying mechanisms were

analysed. Whereas export of free fatty acids from the
cells during early exponential growth phase most prob-
ably explains the accumulation of fatty acids in the
media, several alternative models may explain the
subsequent decline in fatty acid concentration. One
possible interpretation would be a re-import of the ini-
tially secreted fatty acids back into the cells. If this
assumption is correct, this transport should result in
an increase of free fatty acids within the cells because
the mutant cells are unable to utilize these fatty acids
due to the lack of acyl-CoA synthetase activity. To
evaluate this possibility, we measured the concentra-
tion of intracellular free fatty acids at the same time
points during the exponential and stationary growth
phases that had been used for the estimation of the
extracellular fatty acids. In addition, we determined
the amount of lipid-bound fatty acids to cover all
major pools of fatty acids (Fig. 1B,D).
The amount of cellular free fatty acids could be
easily affected by lipid hydrolysis during the extraction
procedure. To rule out the possibility that major
M. Scharnewski et al. Fatty acid secretion in mutants of yeast
FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2767
proportions of the detected free fatty acids are result-
ing from such effect, we analysed extractions with and
without boiling and the results obtained were not sig-
nificantly different. Therefore, boiling was omitted in
subsequent experiments. To differentiate between free
fatty acids and esterified fatty acids, the cellular lipid
extracts were subjected to two different protocols to

achieve either methylation of free fatty acids or trans-
methylation of esterified fatty acids [22,23].
The concentration of bound fatty acids at different
time points resulted in a typical curve corresponding
to the growth of the culture and is independent of the
observed changes in the pools of free fatty acids
(Fig. 1C,D). For the free fatty acids, the results clearly
demonstrated that the decline of fatty acid concentra-
tion in the media was indeed paralleled by a constant
increase of the concentration of intracellular free fatty
acids (Fig. 1D). This could indicate an import of fatty
acids into the cells. On the other hand, the increase of
intracellular fatty acids in absolute amounts was
approximately three-fold greater than the concomitant
decrease of extracellular fatty acids. Therefore, besides
the import of exogenous fatty acids, additional release
of internal fatty acids had to contribute to the increase
of intracellular fatty acids. However, analysis of the
previously mentioned fatty acid specificity of the trans-
port appeared to provide additional indications for
ongoing fatty acid import. As described earlier, the
amount of 16:0 specifically decreased strongly in
the media between time points 48 h and 65 h ()30.0
lmolÆL
)1
), whereas the concentration of the other fatty
acids in the media changed only moderately during
this period ()4.6 to +5.6 lmolÆL
)1
). Strikingly, it was

also 16:0 that increased within the cells during this
time interval in a much stronger fashion than any
other fatty acid (+68.8 lmolÆL
)1
versus +3.6 to
+30.3 lmolÆL
)1
), suggesting re-import of 16:0 into the
cell during this growth stage. In summary, the results
demonstrated an export of free fatty acids out of the
A
B
C
D
Fig. 1. Relationship between fatty acid concentration and stage of
the culture. (A) Extracellular free fatty acids in the culture medium
of YB526 were determined at the time points indicated. The bars
representing individual fatty acids are indicated as 14:0 (black), 16:0
(dark gray), 16:1 (spotted), 18:0 (hatched), 18:1 (light gray). (B)
Time-course of intracellular free fatty acid accumulation. Intracellu-
lar free fatty acids accumulated by cells of YB526 were determined
at the time points indicated. (C) Growth curve of the culture
[YB332 (triangle), YB526 (diamonds) and MS51 (square)]. (D) Con-
centration of fatty acids in the pools of free fatty acids in the media
(diamonds), of free fatty acids in the cells (square) and of esterified
fatty acids (triangle). The error bars represent the SEM from three
independent experiments.
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2768 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS
cells during the early exponential growth phase,

whereas the strong increase of intracellular free fatty
acids at the late exponential phase is compatible with
the hypothesis that the reduction of fatty acid concen-
tration in the media is due to a significant re-import of
free fatty acids into the cells.
Fatty acid transport across the plasma membrane
is functional in absence of all known acyl-CoA
synthetases
The translocation of fatty acids across the plasma
membrane in the absence of Faap activity appeared to
be in contrast to the model suggesting vectorial acyla-
tion as a basis for fatty acid transport [17]. On the
other hand, the strains used so far might contain resid-
ual acyl-CoA synthetase activity due to the presence of
Fat1p, which was shown to possess this enzymatic
activity also. To address the question of whether fatty
acid transport protein 1 (Fat1p), or even fatty acid
transport protein 2 (Fat2p) for which no enzymatic
activity has been demonstrated to date, is responsible
for the fatty acid transport observed in the previous
experiment, we generated knockout deletions of FAT1
and FAT2 in the background of the well established
FAA quadruple mutant YB526 [6]. The obtained
strains with five (MS51) and six gene deletions
(MS612), respectively, are devoid of any detectable
acyl-CoA synthetase activity (data not shown). Both
strains were subjected to the same measurements of
free and bound fatty acids as described for the quadru-
ple mutant. The results indicated that the additional
gene deletions did not change the capacity of the cells

to transport fatty acids. As shown in Fig. 2, the loss of
Fat1p resulted in even higher levels of intracellular free
fatty acids during the stationary phase. More impor-
tantly, the same two phases of early fatty acid export
followed by re-import at later stages were observed in
exactly the same chronological order as in the quadru-
ple mutant. Therefore, it was concluded that cells of
S. cerevisiae lacking any cellular acyl-CoA synthetase
activity are nevertheless able to transport fatty acids
efficiently across the plasma membrane.
Fat1p is responsible for remaining acyl-CoA
synthetase activity of strain YB526
As shown above, the deletion of Fat1p in the back-
ground of the FAA quadruple mutant further
increased the concentration of intracellular accumu-
lated free fatty acids. This suggested a capacity for
Fat1p to access the pool of free fatty acids, most likely
via its proven acyl-CoA synthetase activity [12].
Despite in vitro assays for the acyl-CoA synthetase
activity of Fat1p showing a strong specificity for very
long chain fatty acids [12], our data also appeared to
indicate activity against C16 and C18 fatty acids. To
test this possibility in vivo, we incubated the different
strains with radiolabelled oleic acid. Successful feeding
of the exogenous fatty acid into the cellular acyl-CoA
pool should result in incorporation of the label in the
various lipid classes. Cells of wild-type, YB526, MS51,
MS52 and MS612 were grown in YPR to the early sta-
tionary phase before radiolabelled oleic acid was
added. Following incubation for 24 h, the cellular

lipids were extracted and subjected to TLC (Fig. 3).
As expected, the lipid extract of wild-type cells showed
the label spread to phospholipids and neutral lipids. In
comparison, the level of incorporation in YB526 cells
was drastically reduced, but the label was still clearly
detectable in phospholipids as well as an additional
spot tentatively identified by co-migration with lipid
standards as fatty acid ethyl ester (Fig. 3). By contrast,
there was no longer any incorporation of labelled fatty
acids to either phospholipids or TAG if, in addition to
the FAA genes, FAT1 was deleted, as shown by the
lipid extracts of MS51 and MS612. The combined
deletion of all FAA genes and FAT2 in strain MS52,
on the other hand, resulted in the same level of incor-
poration as in YB526, indicating that Fat2p is not
responsible for the remaining capacity to channel exog-
enous fatty acids into lipids. Control strains carrying
deletions in only FAT1 or FAT2, or in both FAT1 and
FAT2, incorporated labelled fatty acids comparable to
the wild-type (see supplementary Fig. S2). Surprisingly,
Fig. 2. Total amount of intracellular and extracellular fatty acids of
YB526 and MS51. The cells were grown in YPR medium and har-
vested at different time points during the exponential and stationary
phases. Medium and cells were extracted and the total fatty acid
concentrations of the different pools were determined. The fatty
acid concentrations are given for YB526 intracellular (square),
YB526 extracellular (diamonds), MS51 intracellular (circle), and
MS51 extracellular (triangle). The error bars represent the SEM
from three independent experiments.
M. Scharnewski et al. Fatty acid secretion in mutants of yeast

FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2769
even in MS51 and MS612, the radioactive label
showed up in the spot identified as fatty acid ethyl
ester, demonstrating a potential to incorporate free
fatty acids into fatty acid ethyl esters in absence of any
acyl-CoA synthetase activity. This observation sup-
ports a recent description of enzymatic activity found
in microsomal preparations from plants and yeast that
is able to acylate aliphatic alcohols without prior acti-
vation to acyl-thioesters [24]. Irrespective of this side
reaction, the labelling experiments identified Fat1p as
the remaining acyl-CoA synthetase activity in the
strain YB526 that is able to activate imported fatty
acids prior to their incorporation into phospholipids.
The accumulated free fatty acids derive from lipid
remodelling processes
The strong accumulation of free fatty acids in the
media and within the mutant cells raised questions
regarding the metabolic origin of these molecules.
Obviously, acyl-CoA synthetase activity in wild-type
cells is masking a permanent internal generation of sig-
nificant amounts of free fatty acids. To test whether
these fatty acids were derived from lipid turn-over pro-
cesses, we aimed to achieve a fatty acid modification
that is restricted to lipid bound fatty acids. For this
purpose, we introduced a D12 specific lipid desaturase
from sunflower into strain MS51. By contrast to the
endogenous stearoyl-CoA desaturase, the heterologous
D12-desaturase converts exclusively lipid-bound 18:1 to
18:2 [25,26]. Due to the nature of this desaturase, the

generated 18:2 was considered as marker for the pool
of bound fatty acids. Therefore, the occurrence of 18:2
in the pool of free fatty acids would argue for lipid
turnover as the source of fatty acid accumulation. The
expression of the D12-desaturase resulted in diminished
growth of the yeast cells, causing reduced levels of
fatty acids in all pools measured. However, analysis of
lipid extracts of the transformed cells demonstrated
18:2 to be a significant constituent of the pool of ester-
ified fatty acids, indicating successful expression of the
D12-desaturase (Fig. 4A). More interestingly, the pool
of free fatty acids contained 18:2 as well; indicating a
release of formerly lipid bound fatty acids into this
pool (Fig. 4B,C). Moreover, the ratio of the sum of all
natural fatty acids of S. cerevisiae (14:0 to 18:1) to the
artificially produced 18:2 was almost identical in the
fraction of bound fatty acids compared to the fraction
of free fatty acids (11.19 and 11.03, respectively; see
supplementary Table S1). This constant ratio would be
in line with lipid remodelling processes as a source
for the accumulated fatty acids in the mutant cells,
provided that the release of the fatty acids is rather
unspecific.
The direction of fatty acid transport is dependent
on the metabolic state of the cells
To gain further insight into the correlation of growth
phase of the culture and the direction of fatty acid
transport, we investigated the possibility of manipulat-
ing the transport by changing the medium conditions
of the growing culture. Therefore, we grew cells as

described above in raffinose containing medium.
Approximately 3 h after the cultures reached the sta-
tionary phase and the cells already started to re-import
fatty acids from the media, we again fed raffinose to
the cultures (Fig. 5A–C). In controls, water was added
to the cells. As expected, the culture fed with raffinose
started to grow again indicated by increasing attenu-
ance (data not shown). We then analyzed the amount
of fatty acids in the medium and inside the cells.
Fig. 3. TLC of lipid extracts of yeast strains fed with radiolabelled
oleic acid. Cells of wild-type and the mutants indicated were grown
for 24 h in the presence of radiolabelled oleic acid. The cells were
harvested by centrifugation, lipids were extracted, and these
extracts were separated by solvent A [acetic acid methyl ester ⁄ iso-
propanol ⁄ chloroform-methanol ⁄ 0.75% KCl (25 : 25 : 28 : 10 : 7,
v ⁄ v)] followed by solvent B (chloroform ⁄ acetone (8 : 2. v ⁄ v) + 1%
NH
3
) on silica plates. Comparison between YB526 and MS51
clearly indicate that Fat1p in YB526 is responsible for the incorpora-
tion of exogenous oleate into phospholipids. The band labelled as
EE was tentatively identified as fatty acid ethyl esters produced by
all strains even in absence of any acyl-CoA synthetase activity.
Lipid classes were determined by co-migration of lipid standards
and staining with copper sulfate. TAG, triacylglycerol; EE, fatty acid
ethyl ester; OA, oleic acid; PC, phosphatidylcholine; PI, phosphati-
dyinositol; PS, phosphatidylserine. The figure shows one represen-
tative result out of three independent experiments.
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2770 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS

Surprisingly, the accumulation of free fatty acids inside
the cells stopped immediately after adding raffinose
(Fig. 5A). Simultaneously, large quantities of free fatty
acids were secreted by the cells (Fig. 5B). At the same
time, the concentration of the total esterified fatty
acids remained constant (Fig. 5C). To allow for simple
comparison, the amount of fatty acids in the medium
prior to the addition of either water or of raffinose
was set as 100%. In control experiments, we observed
A
B
C
Fig. 4. Profile of free and esterified fatty acids upon expression of
D12-desaturase in MS51. Cells of strain MS51 expressing a D12-
desaturase of sunflower were grown for 70 h in minimal media
before the cells were harvested and lipids were extracted. The dif-
ferent pools of fatty acids were analyzed and presented as: (A)
intracellular esterified fatty acids; (B) intracellular free fatty acids;
(C) extracellular free fatty acids. As a control, cells transformed
with empty vector were extracted. The bars representing individual
fatty acids are depicted as 14:0 (dark gray), 16:0 (hatched),
16:1 (gray), 18:0 (spotted), 18:1 (light gray), 18:2 (black). The error
bars represent the SEM from three independent experiments.
A

B
C
Fig. 5. Feeding of raffinose to MS51 cells in stationary phase. Total
fatty acid concentration in different pools was measured in cultures
fed with raffinose (diamonds) at time point 65 h (arrows) during the

stationary phase (A–C). As a control, the same amount of water
was added to separate cultures (square). (A) Free fatty acids inside
the cells. (B) Free fatty acids in the medium. (C) Esterified fatty
acids. The error bars represent the SEM from three independent
experiments.
M. Scharnewski et al. Fatty acid secretion in mutants of yeast
FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2771
a decrease of free fatty acids in the medium by 25%
within 30 h. This decrease is accompanied by an
increase of cellular free fatty acids partly due to
re-import, as described earlier. By contrast, the
amount of free fatty acids in the medium of the
cultures fed with raffinose increased by 100% within
30 h after adding the raffinose. The supply of raffinose
allowed the cells, on the other hand, to maintain the
concentration of free fatty acids inside the cells at a
constant level. When the supply of raffinose was finally
exhausted, after approximately 95 h of the experiment,
the cells again started to re-import fatty acids from the
medium and to accumulate these fatty acids intra-
cellularly in even higher amounts than in the control
culture. From these results, it was concluded that the
direction of transport was reversible and that it was
regulated by the metabolic state of the cells.
Cytological features of MS51
During the stationary phase of the culture, the concen-
tration of free fatty acids found in the mutant cells
was up to 50-fold greater than that observed in wild-
type cells. High concentrations of free fatty acids are
believed to be rather unfavourable to cells due to their

detergent character. Nevertheless, the mutant cells
were not only viable, but also showed only minor dif-
ferences in their growth behaviour compared to wild-
type. To investigate whether the level of free fatty
acids might have observable consequences for the cell,
we inspected the subcellular morphology by electron
microscopy. Whereas most organelles, the cytoplasm
and the plasma membrane showed no obvious anom-
aly, we observed a strikingly enlarged ER in the
mutant cells (Fig. 6). The mutant cells were pervaded
by strands of ER with conspicuously dilated lumen.
This is especially apparent in the cortical ER, which is
closely apposed to the cytoplasmic membrane
(Fig. 6C,D). The lumen appears darker than the cyto-
plasm (Fig. 6B–D) and is filled with dark stained, lam-
inated material. This striking phenotype was observed
in all mutant cells inspected, whereas it was never
found in wild-type cells. To a moderate extent, the
dilated ER-phenotype was visible already in cells har-
vested during the exponential phase but it became
A
B
C
D
Fig. 6. Electron microscopic analysis of cells of wild-type and
MS51 in stationary phase. Overview of wild-type (A) and mutant
cells (B,C). In wild-type cells, the ER lumen is inconspicuous, ER
lumen in mutant cells appears to be dilated; the ER is marked by
arrows. The ER lumen appears darker than the cytoplasm (C,D) and
is filled with dark stained, laminated material. (D) A detail of (C) is

shown at higher magnification.
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2772 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS
drastically enhanced in cells harvested from stationary
phase (see supplementary Fig. S3). Therefore, the
severity of the symptoms appeared to correlate directly
with the level of accumulated free fatty acids. This
observation might suggest that the mutant cells are
able to deposit excess of free fatty acids specifically in
the ER, thereby excluding an excess of free fatty acids
from other cellular compartments.
Discussion
The present study was designed to improve our under-
standing of acyl-CoA synthetase activity on different
pools of fatty acids in S. cerevisiae. The experiments
were initiated by data showing a fatty acid secretion
phenotype for different yeast cells deficient of Faa1p
[20,21]. Despite not verifying the fatty acid secretion
phenotype for strains of S. cerevisiae deficient of
Faa1p alone [21], we did observe fatty acid secretion
in strains deficient not only in Faa1p, but also in
Faa4p. Because the faa1D mutant strain employed in
the previous study [21] was isolated by a screen involv-
ing two independent rounds of mutagenesis with ethyl-
methane sulfonate, one possible explanation for the
observed phenotype would be an unidentified addi-
tional mutation in FAA4 resulting in a faa1D faa4D
genotype for the strain finally described. The fatty acid
secretion phenotype observed in the present study indi-
cated that the presence of either Faa1p or Faa4p is

necessary during exponential growth to keep endoge-
nous free fatty acids inside the cell. During the station-
ary phase, we then observed a re-import of those fatty
acids previously secreted during the exponential
growth phase. This re-import finally resulted in a ratio
of approximately 10 : 1 of free fatty acids to esterified
fatty acids in the mutant cells, whereas this ratio was
approximately 1 : 20 in wild-type cells. The fatty acid
secretion and re-import was observed not only in the
faa1D faa4D double mutant, but also in the strains
YB526, MS51 and MS612, indicating fatty acid uptake
even in the absence of any cellular acyl-CoA synthetase
activity. Surprisingly, the direction of transport proved
to be reversible. Upon addition of raffinose to cells in
the stationary growth phase, the import of fatty acids
stopped immediately and export was again initiated.
The fast response resulting in an instantaneous rever-
sion of the direction of net transport strongly argues for
an active mechanism to achieve fatty acid export.
It is important to note that the additional deletion
of FAT1 did not change the biphasic mode of fatty
acid transport but it did further increase the amount
of accumulated free fatty acids. Whereas convincing
data had been presented showing that Fat1p is impor-
tant for fatty acid import in S. cerevisiae [27], the
transport processes of fatty acid export and re-import
observed in the present study were essentially indepen-
dent of this previously described activity. Instead, our
results for Fat1p suggest partly overlapping functions
with Faa1p and Faa4p with respect to the capacity to

channel released fatty acids back into lipids. This was
demonstrated not only by the increased amounts of
accumulated free fatty acids in the fivefold mutant
MS51, but also by feeding experiments with radiola-
belled fatty acids. On the other hand, the activity of
Fat1p alone was not strong enough to prevent the
secretion of fatty acids upon combined deletion of
FAA1 and FAA4.
To allow for speculation about the biological role of
the release of fatty acids, it was essential to gain infor-
mation about their precise metabolic origin. By
expressing a lipid specific D12-desaturase from sun-
flower in the five-fold mutant MS51, we obtained data
supporting the hypothesis that the majority of the
secreted fatty acids were released from phospholipids.
The reasons for this release are not clear yet, but it
appears to be legitimate to assume that lipid remodel-
ling processes are involved that ensure continuous
adaptation of membrane parameters to cellular needs.
Initial evidence for prominent lipid remodelling was
obtained from analyses of the fatty acid composition
of different lipid classes described as molecular species.
Despite the fact that the biosynthesis of each different
phospholipid class involves common precursors, strong
differences in the molecular species were detected [28].
To establish distinct molecular species, a system
involving sequential deacylation by phospholipases and
reacylation by acyltransferases was proposed [29].
Lipid labelling experiments strongly supported this
model for S. cerevisiae [28] and the results obtained

from studies with rat hepatocytes provided information
suggesting, for phosphatidylcholine and phosphatidyl-
ethanolamine, a similar rate of de novo synthesis and
of remodelling activities [30]. Taken together, these
data indicate lipid remodelling as a quantitatively
important process, which probably is responsible for
the establishment of distinct molecular species of cer-
tain lipid classes. In this respect, the free fatty acids
observed in the present study are most likely the result
of interrupted lipid remodelling processes. Conse-
quently, we propose the activation of endogenous free
fatty acids produced within this recycling mechanism
as a most important role for Faa1p and Faa4p.
Although being metabolically inaccessible to the
mutant cells, the re-import of the released free fatty
acids during stationary phase finally resulted in the
accumulation of large amounts of free fatty acids
M. Scharnewski et al. Fatty acid secretion in mutants of yeast
FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2773
inside the cells. By electron microscopy, the effect of
this accumulation on cellular morphology was
inspected and diagnosed as a severe phenotype of the
ER. To our knowledge, similar structures of the ER
have not been described previously. Because the
strength of the phenotype corresponded to the level of
accumulated free fatty acids, it is fair to assume that
the free fatty acids themselves account for the dark
stained dilated lumen of the ER. How the free fatty
acids are organized in these structures is currently
unknown. The accumulation of free fatty acids result-

ing in electron-dense material has recently been
described in lipid bodies of pex5D cells that are unable
to degrade fatty acids by b-oxidation [31]. The
observed structures were termed gnarls and it was
speculated that they could represent self assembled
fatty acid structures. Different to the conspicuous ER
phenotype of the faaD mutant cells, the gnarls were of
a delicate nature and visible only upon permanganate
staining [31]. This might reflect the significantly lower
amount of free fatty acids in cells containing gnarls
compared to cells described in the present study. Given
the significant concentrations of free fatty acids, it
was, nevertheless, remarkable to note that the morpho-
logical changes were limited to the ER, whereas the
plasma membrane or membranes of other organelles
were essentially unaffected. This selectivity appeared to
rule out passive dissolving of fatty acids into the lipo-
philic phase of membranes in general, but rather indi-
cates specific channelling to the ER. Such targeted
intracellular transport of free fatty acids strongly sug-
gests the existence of an active and most likely protein
mediated process.
Taken together, the data obtained so far clearly
demonstrate fatty acid uptake into the cell in the
absence of any cellular acyl-CoA synthetase activity.
Therefore, the observed fatty acid transport and acti-
vation are not coupled but rather are separate tasks
that are independent of each other. These results
appear to be in contradiction to the model of vectorial
acylation postulating acyl-CoA synthetase activity as a

prerequisite of fatty acid import. In this model, it was
suggested that fatty acids might be removed from the
inner leaflet of the plasma membrane by acyl-CoA
synthetase activities releasing acyl-CoA into the cyto-
plasm, thereby giving space for newly incoming fatty
acids. The model was based on a complete set of
experiments showing severely diminished capacity of
the strains faa1Dfaa4D and fat1D to metabolize exo-
genous fatty acids [10,27]. The results obtained were
interpreted as consequence of impeded fatty acid trans-
port. The crucial question is why these experiments
failed to detect the transport that we observed in our
investigations. Initially, the cells in the previous studies
were taken from cultures in the exponential growth
phase. During this stage, we showed, at least for
mutants deficient of Faa1p and Faa4p, a phenotype of
active fatty acid secretion obviously causing conflict
with simultaneous fatty acid import. By contrast, the
strong capacity to import fatty acids in our experi-
ments was observed for mutant cells in the stationary
phase. In addition, a comparison of the results
obtained by uptake assays with C
1
-BODIPY-C
12
[10,27] to those of the present study revealed the time
scale as being another important difference. The fatty
acid uptake described in the present study is a rather
slow process, observed over hours during the station-
ary phase, whereas the uptake involving acyl-CoA

synthetase was measured with a fluorescent fatty acid
analogue in the range of 60 s. Nevertheless, the two
different velocities in transport might fit into a
common model describing the removal of fatty acids
from the inner leaflet of the membrane by two differ-
ent active components. On the one hand, acyl-CoA
synthetase activities were shown to make a contribu-
tion. On the other hand, a targeted channelling of free
fatty acids from the inner leaflet of the plasma mem-
brane towards the endoplasmic reticulum could
provide an alternative mechanism for removing free
fatty acids from the membrane. This alternative
removal system might be less efficient and result in a
slower net transfer across the membrane. On the other
hand, the proposed model is able to balance the results
obtained in the present study with the model of vecto-
rial acylation and would also reconcile previous results
from other studies showing fatty acid transport in the
absence of acyl-CoA synthetase activity [8,32].
Experimental procedures
Yeast strains and media
The yeast strains used are shown in the supplementary
(Table S2). YPR consisted of 1% yeast extract, 2% peptone
and 2% raffinose. Yeast proteose dextrose medium con-
sisted of 1% yeast extract, 2% peptone and 2% dextrose.
Yeast supplemented minimal media contained 0.67% yeast
nitrogen base, 2% raffinose, amino acid content according
to Brent Supplement Mixture Dropout Powder (MP
Biomedicals, LCC, Illkirch, France) (1.16 gÆL
)1

). 2% agar
was added for solid media.
Cell growth
Yeast cultures were grown for 18 h in YPR and diluted
until D
600
of 0.02 was reached in triplicate in flasks contain-
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2774 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS
ing 100 mL of YPR. The cells were grown at 30 °C and
harvested at time points specified. Cell growth was moni-
tored by D
600
. Cells were harvested by centrifugation and
the cell pellet was resuspended in water to achieve appro-
priate densities (D
600
in the range 0.1–0.8).
Mutagenesis
Gene deletions were carried out by a PCR-based deletion
strategy, as previously described [33]. Within the present
study, two genes were targeted for deletion: FAT1 and
FAT2, coding for Fat1p and Fat2p, respectively. These
genes were deleted in the strain YB526 already deficient of
all four FAA genes [6]. For the deletion of FAT1, the kan-
MX4 cassette was used as selection marker. The resulting
strain was termed MS51. For deletion of FAT2, the hygro-
mycin phosphotransferase under control of translation elon-
gation factor EF-1a promoter and cytochrome C (CYC1)
terminator from S. cerevisiae was employed. The strain

lacking FAT1 as well as FAT2 was designated as MS612.
The deletion cassettes were transformed into the cells using
a modified version of the protocol described previously [34].
Primers used for deletion of FAT1: FAT1forward,
ATTCTATATCTGTGAACTTTTAATAGGCTGCGAAT
ACCGACTATGCGTACGCTGCAGGTCGAC; FAT1-
reverse, CATCCAAACCCTTTGGTAATTTTTGCTCTCT
ATAAACCTTCTTCAATCGATGAATTCGAGCTCG.
Primers used for deletion of FAT2: FAT2forward,
GTGCTGCAAGAGGTTAGACGCTTCACGCACATTTT
TGCTACAATGCGTACGCTGCAGGTCGAC; FAT2-
reverse, GATAGAAGCTTTCAGAGAGCATAAAATTGT
ACAGGATACTGCCTAATCGATGAATTCGAGCTCG.
Expression of D12-desaturase and fatty acid
isomerase
FAD2-1 from sun flower encoding a D12-desaturase cloned
in pYES2 was generously provided by J. M. Martinez-
Rivas [35] and was transformed into MS51. Transformed
yeast cells were grown for 18 h in synthetic complete med-
ium (2% raffinose) and diluted until D
600
of 0.3 was
reached in duplicate in flasks containing 20 mL of synthetic
complete medium (2% galactose). The cell suspension was
harvested at 72 h and subjected to lipid extraction.
Preparation of yeast cells and extracellular
fraction
Yeast cells suspension (2 mL) was collected at the time points
specified. Cells and extracellular fraction were separated by
centrifugation at 1500 g for 3 min. Extracellular fraction or

supernatant (1 mL) was transferred to a new 2 mL micro-
centrifuge tube. The remainder of the supernatant was
discarded. The cell pellet was washed once with water.
Lipid analytical methods
Yeast cell pellet and supernatant were transferred to 10 mL
glass tubes with glass-stop corks. The cell pellet was resus-
pended in 1 mL of distilled water and glass beads (425–
600 lm) were added to break the cells. Intracellular and
extracellular lipid extractions were performed using hepta-
decanoic acid (17:0) as internal standard for free fatty acids
(1 lg for wild-type and 10 lg for mutant cells) and trihep-
tadecanoylglycerol as internal standard for esterified fatty
acid (10 lg) [36].
Free fatty acids from intracellular and extracellular lipid
extracts were methylated according to a modified protocol
described previously [22]. In brief, the lipid extract (50 lL)
was transferred to a new glass tube and dried under a
stream of nitrogen. Methanol (400 lL) was added together
with 10 lL of 1-ethyl-3-(3-dimethylaminopropylcarbodii-
mide) (0.1 mgÆlL
)1
in methanol) and incubated for 2 h at
22 °C. The reaction was stopped by adding 200 lL of satu-
rated NaCl solution. The methyl esters of free fatty acids
were extracted with 1 mL of hexane followed by centrifuga-
tion at 200 g for 2 min. The upper hexane phase was trans-
ferred to a 1.5 mL microcentrifuge tube, dried and
resuspended in acetonitrile (10 lL) and analyzed by gas
chromatography.
Esterified fatty acids from intracellular lipid extracts were

transmethylated according to a modified protocol described
previously [23]. Lipid extract (50 lL) was transferred to a
2 mL microcentrifuge tube and dried under a stream of
nitrogen. 333 lL methanol ⁄ toluene (1 : 1, v ⁄ v) and 167 lL
0.5 m sodium methoxide were added and left at 22 °C.
After 20 min, the reaction was stopped by adding 500 lL
of 1 m NaCl and 50 lL of 32% hydrochloric acid. The
methyl esters of free fatty acids were extracted with 1 mL
of hexane followed by centrifugation at 2300 g for 2 min.
The upper hexane phase was transferred to a new 1.5 mL
microcentrifuge tube, dried and resuspended in acetonitrile
(10 lL). The fatty acid methyl esters were analyzed by gas
chromatography using an Agilent 6890 series gas chromato-
graph equipped with a capillary DB-23 column (Agilent
Technologies, Waldbronn, Germany).
Lipid labelling using radiolabelled oleic acid
Yeast strains were grown for 18 h in YPR and diluted to
until D
600
of 0.03 was reached in a flask containing 20 mL
of YPR. After dilution, yeast strains were grown to late
exponential stage (48 h). Aliquots (4 mL) were transferred
to 10 mL flasks in duplicate prior to addition of 0.27 lCi
14
C-18:1 (Amersham Biosciences, Bucks, UK) (5 nmol).
The specific activity of the
14
C oleic acid was 56 mCiÆ
mmol
)1

. After 24 h of incubation, a 3 mL cell suspension
was collected and cells were harvested by centrifugation
and subjected to lipid extraction. Lipid extracts were
M. Scharnewski et al. Fatty acid secretion in mutants of yeast
FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2775
separated by TLC in a single dimension using methylace-
tate ⁄ isopropyl alcohol ⁄ chloroform ⁄ methanol ⁄ 0.25% KCl
(25 : 25 : 28 : 10 : 7, v ⁄ v) as solvent. Neutral lipids and free
fatty acids were separated using chloroform ⁄ acetone (8 : 2,
v ⁄ v) and 1% NH
3
as second solvent. Lipid standards were
included on each TLC plate. Radiolabelled lipids were visu-
alized by fluorography.
Raffinose feeding to cells in stationary phase
The strain MS51 was grown for 18 h in YPR and diluted
until D
600
of 0.02 was reached in flasks containing 100 mL
of YPR. The cells were grown at 30 °C to early stationary
phase before 2% raffinose (or the same volume H
2
Oas
control) was added to the culture. Subsequently, the cells
were harvested at specified time points. The experiment was
performed in duplicate.
Electron microscopy
Yeast cells were grown in YPR medium. Samples were
removed during the exponential and stationary growth
phases and the cells were harvested by centrifugation at

5000 g for 10 min. The pellet was then resuspended in
50 mm potassium phosphate buffer, chemically fixed in
0.5% (w ⁄ v) formaldehyde and 0.3% (w ⁄ v) glutardialde-
hyde solution for 90 min at 0 °C. Cells were then washed
by two rounds of centrifugation and resuspension in
potassium phosphate buffer. A 100 lL portion of a resus-
pended cell pellet was embedded in 1.5% (w ⁄ v) molten
agar (final concentration). The agar block was cut to
small pieces of 1 mm
3
volume, and the pieces were then
dehydrated in a graded methanol series (15%, v ⁄ v, 30%
for 15 min; 50%, 75%, 95% for 30 min; 100% for 1 h)
under concomitant temperature reduction to )40 °C. The
samples were infiltrated with Lowicryl K4M resin (Sigma,
Heidelberg, Germany) (50%, v ⁄ v, in methanol for 1 h;
66%, v ⁄ v, for 2 h;100% for 10 h), then polymerized for
24 h at –40 °C and for 3 days at 22 °C [37,38]. Resin sec-
tions of 80–100 nm in thickness were cut with glass kni-
ves, mounted on formvar-coated specimen grids and
stained with 3% (w ⁄ v) phosphotungstic acid (pH 7.0).
Electron microscopy was performed in a Philips EM 301
transmission electron microscope (Philips, Eindhoven, the
Netherlands) at 80 kV and calibrated magnifications.
Acknowledgements
We thank Jeffery I. Gordon for generously providing
yeast strains and Ingo Heilmann and Ivo Feussner for
critical reading of this manuscript. We obtained cas-
settes for disruptional mutations from EUROSCARF
(Frankfurt, Germany). We thank Jose

´
Martinez-Rivas
for the plasmid encoding the desaturase FAD2-1 of
Helianthus annuus L. This work was supported in part
by grant DFG FU430 ⁄ 2-3.
References
1 Schweizer E & Hofmann J (2004) Microbial type I
fatty acid synthases (FAS): major players in a network
of cellular FAS systems. Microbiol Mol Biol Rev 68,
501–517.
2 Schweizer E, Lerch I, Kroeplin-Rueff L & Lynen F
(1970) Fatty acyl transferase. Characterization of the
enzyme as part of the yeast fatty acid synthetase
complex by the use of radioactively labeled coenzyme
A. Eur J Biochem 15, 472–482.
3 Duronio RJ, Knoll LJ & Gordon JI (1992) Isolation of
a Saccharomyces cerevisiae long chain fatty acyl:CoA
synthetase gene (FAA1) and assessment of its role in
protein N-myristoylation. J Cell Biol 117, 515–529.
4 Knoll LJ & Gordon JI (1993) Use of Escherichia coli
strains containing fad mutations plus a triple plasmid
expression system to study the import of myristate, its
activation by Saccharomyces cerevisiae acyl-CoA
synthetase, and its utilization by S. cerevisiae myristoyl-
CoA:protein N-myristoyltransferase. J Biol Chem 268,
4281–4290.
5 Knoll LJ, Johnson DR & Gordon JI (1994) Biochemi-
cal studies of three Saccharomyces cerevisiae acyl-CoA
synthetases, Faa1p, Faa2p, and Faa3p. J Biol Chem
269, 16348–16356.

6 Johnson DR, Knoll LJ, Levin DE & Gordon JI (1994b)
Saccharomyces cerevisiae contains four fatty acid acti-
vation (FAA) genes: an assessment of their role in regu-
lating protein N-myristoylation and cellular lipid
metabolism. J Cell Biol 127, 751–762.
7 Johnson DR, Knoll LJ, Rowley N & Gordon JI
(1994a) Genetic analysis of the role of Saccharomyces
cerevisiae acyl-CoA synthetase genes in regulating pro-
tein N-myristoylation. J Biol Chem 269, 18037–18046.
8 Knoll LJ, Johnson DR & Gordon JI (1995a) Comple-
mentation of Saccharomyces cerevisiae strains contain-
ing fatty acid activation gene (FAA) deletions with a
mammalian acyl-CoA synthetase. J Biol Chem 270,
10861–10867.
9 Knoll LJ, Schall OF, Suzuki I, Gokel GW & Gordon
JI (1995b) Comparison of the reactivity of tetradecenoic
acids, a triacsin, and unsaturated oximes with four
purified Saccharomyces cerevisiae fatty acid activation
proteins. J Biol Chem 270, 20090–20097.
10 Faergeman NJ, Black PN, Zhao XD, Knudsen J &
DiRusso CC (2001) The Acyl-CoA synthetases encoded
within FAA1 and FAA4 in Saccharomyces cerevisiae
function as components of the fatty acid transport
system linking import, activation, and intracellular utili-
zation. J Biol Chem 276, 37051–37059.
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2776 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS
11 Natter K, Leitner P, Faschinger A, Wolinski H,
McCraith S, Fields S & Kohlwein SD (2005) The spa-
tial organization of lipid synthesis in the yeast Saccha-

romyces cerevisiae derived from large scale green
fluorescent protein tagging and high resolution micros-
copy. Mol Cell Proteomics 4 , 662–672.
12 Watkins PA, Lu JF, Steinberg SJ, Gould SJ, Smith KD
& Braiterman LT (1998) Disruption of the Saccharomy-
ces cerevisiae FAT1 gene decreases very long-chain fatty
acyl-CoA synthetase activity and elevates intracellular
very long-chain fatty acid concentrations. J Biol Chem
273, 18210–18219.
13 Schaffer JE & Lodish HF (1994) Expression cloning
and characterization of a novel adipocyte long chain
fatty acid transport protein. Cell 79, 427–436.
14 Faergeman NJ, DiRusso CC, Elberger A, Knudsen J
& Black PN (1997) Disruption of the Saccharomyces
cerevisiae homologue to the murine fatty acid transport
protein impairs uptake and growth on long-chain fatty
acids. J Biol Chem 272, 8531–8538.
15 Obermeyer T, Fraisl P, DiRusso CC & Black PN
(2007) Topology of the yeast fatty acid transport pro-
tein Fat1p: mechanistic implications for functional
domains on the cytosolic surface of the plasma mem-
brane. J Lipid Res 48, 2354–2364.
16 Overath P, Pauli G & Schairer HU (1969) Fatty acid
degradation in Escherichia coli. An inducible acyl-
CoA synthetase, the mapping of old mutants, and the
isolation of regulatory mutants. Eur J Biochem 7,
559–574.
17 Zou Z, Tong F, Faergeman NJ, Borsting C, Black PN
& DiRusso CC (2003) Vectorial acylation in Saccharo-
myces cerevisiae. Fat1p and fatty acyl-CoA synthetase

are interacting components of a fatty acid import
complex. J Biol Chem 278, 16414–16422.
18 Hamilton JA, Guo W & Kamp F (2002) Mechanism of
cellular uptake of long-chain fatty acids: do we need
cellular proteins? Mol Cell Biochem 239, 17–23.
19 Kamp F & Hamilton JA (2006) How fatty acids of
different chain length enter and leave cells by free
diffusion. Prostaglandins Leukot Essent Fatty Acids 75,
149–159.
20 Miyakawa T, Nakajima H, Hamada K, Tsuchiya E,
Kamityo K & Fukui S (1984) Isolation and character-
ization of a mutant of Candida lipolytica which excretes
long-chain fatty acids. Agric Biol Chem 48, 499–503.
21 Michinaka Y, Shimauchi T, Aki T, Nakajima T,
Kawamoto S, Shigeta S, Suzuki O & Ono K (2003)
Extracellular secretion of free fatty acids by disruption
of a fatty acyl-CoA synthetase gene in Saccharomyces
cerevisiae. J Biosci Bioeng 95, 435–440.
22 Stumpe M, Kandzia R, Gobel C, Rosahl S & Feussner
I (2001) A pathogen-inducible divinyl ether synthase
(CYP74D) from elicitor-treated potato suspension cells.
FEBS Lett 507, 371–376.
23 Christie WW (1982) A simple procedure for rapid trans-
methylation of glycerolipids and cholesteryl esters.
J Lipid Res 23, 1072–1075.
24 Neal A, Banas A, Banas W, Stahl U, Carlsson AS &
Stymne S (2006) Microsomal preparations from plant
and yeast acylate free fatty acids without prior activa-
tion to acyl-thioesters. Biochim Biophys Acta 1761, 757–
764.

25 Browse J, Roughan PG & Slack CR (1981) Light con-
trol of fatty acid synthesis and diurnal fluctuations of
fatty acid composition in leaves. Biochem J 196, 347–
354.
26 Slack CR, Roughan PG & Terpstra J (1976) Some
properties of a microsomal oleate desaturase from
leaves. Biochem J 155, 71–80.
27 DiRusso CC, Connell EJ, Faergeman NJ, Knudsen J,
Hansen JK & Black PN (2000) Murine FATP alleviates
growth and biochemical deficiencies of yeast fat1Delta
strains. Eur J Biochem 267, 4422–4433.
28 Wagner S & Paltauf F (1994) Generation of glycero-
phospholipid molecular species in the yeast Saccharomy-
ces cerevisiae. Fatty acid pattern of phospholipid classes
and selective acyl turnover at sn-1 and sn-2 positions.
Yeast 10, 1429–1437.
29 Lands WEM & Crawford CG (1976) Enzymes of
membrane phospholipid metabolism. In The Enzymes of
Biological Membranes (Martonosi AN, ed), pp. 3–85.
Plenum Press, New York, NY.
30 Schmid PC, Deli E & Schmid HH (1995) Generation
and remodeling of phospholipid molecular species in rat
hepatocytes. Arch Biochem Biophys 319, 168–176.
31 Binns D, Januszewski T, Chen Y, Hill J, Markin VS,
Zhao Y, Gilpin C, Chapman KD, Anderson RG &
Goodman JM (2006) An intimate collaboration between
peroxisomes and lipid bodies. J Cell Biol 173, 719–731.
32 Blobel F & Erdmann R (1996) Identification of a yeast
peroxisomal member of the family of AMP-binding
proteins. Eur J Biochem 240, 468–476.

33 Wach A, Brachat A, Pohlmann R & Philippsen P
(1994) New heterologous modules for classical or PCR-
based gene disruptions in Saccharomyces cerevisiae.
Yeast 10, 1793–1808.
34 Ito H, Fukuda Y, Murata K & Kimura A (1983)
Transformation of intact yeast cells treated with alkali
cations. J Bacteriol 153, 163–168.
35 Martinez-Rivas JM, Sperling P, Luehs W & Heinz E
(2001) Spatial and temporal regulation of three different
microsomal oleate desaturase genes (FAD2) from nor-
mal-type and high-oleic varieties of sunflower (Helian-
thus annuus L.). Mol Breeding 8, 159–168.
36 Bligh EG & Dyer WJ (1959) A rapid method of total
lipid extraction and purification. Can J Biochem Physiol
37, 911–917.
37 Roth J, Bendayan M, Carlemalm E, Vilinger W &
Garavito M (1981) Enhancement of structural
M. Scharnewski et al. Fatty acid secretion in mutants of yeast
FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS 2777
preservation and immunocytochemical staining in low
temperature embedded pancreatic tissue. J Histochem
Cytochem 29, 663–671.
38 Hoppert M & Holzenburg A (1998) Electron Micros-
copy in Microbiology. Bios Scientific Publishers
(Bios-Springer), New York, NY.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Secretion of free fatty acids of FAA-deficient
cells.

Fig. S2. TLC of lipid extracts of yeast strains fed with
radiolabelled oleic acid.
Fig. S3. Electron microscopic analysis of MS51 cells in
the exponential phase.
Table S1. Ratio of the sum of natural fatty acids to
18:2 produced by the expression of a D12-desaturase
of sunflower.
Table S2. Yeast strains used in this study.
This material is available as part of the online article
from
Please note: Blackwell Publishing are not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
Fatty acid secretion in mutants of yeast M. Scharnewski et al.
2778 FEBS Journal 275 (2008) 2765–2778 ª 2008 The Authors Journal compilation ª 2008 FEBS