Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

The pH dependence of kinetic isotope effects in
monoamine oxidase A indicates stabilization of the
neutral amine in the enzyme–substrate complex
Rachel V. Dunn
1
, Ker R. Marshall
2
, Andrew W. Munro
1
and Nigel S. Scrutton
1
1 Faculty of Life Sciences, Manchester Interdisciplinary Biocentre, University of Manchester, UK
2 Department of Biochemistry, University of Leicester, UK
The mammalian monoamine oxidases (MAO) (EC
1.4.3.4) are flavoproteins localized to the outer mito-
chondrial membrane, and contain a FAD cofactor
covalently linked via the 8a-methyl group to an active
site cysteine residue [1]. They catalyse the oxidative
deamination of neurotransmitters (e.g. dopamine and
serotonin) and exogenous alkylamines, and are there-
fore important pharmaceutical targets for the develop-
ment of antidepressants and neuroprotective agents [2].
The catalytic cycle for monoamine oxidase activity is
shown in Scheme 1.
A number of mechanisms for MAO-catalysed amine
oxidation have been proposed over the years, and sev-
eral reviews are available [3–5]. There are currently
Keywords
kinetic isotope effect; mechanism;
monoamine oxidase; pH dependence
Correspondence

N. S. Scrutton, Faculty of Life Sciences,
Manchester Interdisciplinary Biocentre,
University of Manchester, 131 Princess
Street, Manchester M1 7DN, UK
Fax: +44 161 3068918
Tel: +44 161 3065152
E-mail:
(Received 10 April 2008, revised 25 May
2008, accepted 2 June 2008)
doi:10.1111/j.1742-4658.2008.06532.x
A common feature of all the proposed mechanisms for monoamine oxidase
is the initiation of catalysis with the deprotonated form of the amine sub-
strate in the enzyme–substrate complex. However, recent steady-state
kinetic studies on the pH dependence of monoamine oxidase led to the sug-
gestion that it is the protonated form of the amine substrate that binds to
the enzyme. To investigate this further, the pH dependence of monoamine
oxidase A was characterized by both steady-state and stopped-flow tech-
niques with protiated and deuterated substrates. For all substrates used,
there is a macroscopic ionization in the enzyme–substrate complex attrib-
uted to a deprotonation event required for optimal catalysis with a pK
a
of
7.4–8.4. In stopped-flow assays, the pH dependence of the kinetic isotope
effect decreases from approximately 13 to 8 with increasing pH, leading to
assignment of this catalytically important deprotonation to that of the
bound amine substrate. The acid limb of the bell-shaped pH profile for the
rate of flavin reduction over the substrate binding constant (k
red
⁄ K
s

, report-
ing on ionizations in the free enzyme and ⁄ or free substrate) is due to
deprotonation of the free substrate, and the alkaline limb is due to unfa-
vourable deprotonation of an unknown group on the enzyme at high pH.
The pK
a
of the free amine is above 9.3 for all substrates, and is greatly per-
turbed (DpK
a
$ 2) on binding to the enzyme active site. This perturbation
of the substrate amine pK
a
on binding to the enzyme has been observed
with other amine oxidases, and likely identifies a common mechanism for
increasing the effective concentration of the neutral form of the substrate
in the enzyme–substrate complex, thus enabling efficient functioning of
these enzymes at physiologically relevant pH.
Abbreviations
ES, enzyme–substrate; KIE, kinetic isotope effect; MAO, monoamine oxidase; PEA, phenylethylamine; TMADH, trimethylamine
dehydrogenase.
3850 FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
three main mechanistic proposals for MAO catalysis.
These comprise: (a) the concerted polar nucleophilic
mechanism; (b) the direct hydride transfer mechanism;
and (c) the single electron transfer mechanism. Recent
support for the concerted polar nucleophilic mecha-
nism has come from kinetic and structural studies on
tyrosine mutants of MAO B [6], and also from compu-
tational studies [7,8]. However, analysis of nitrogen
isotope effects conducted on a related amine oxidase,

N-methyltryptophan oxidase, supported either a direct
hydride transfer mechanism or, possibly, a discrete
electron transfer mechanism [9]. Support for a modi-
fied single electron transfer mechanism came following
the identification of a stable tyrosyl radical in partially
reduced MAO A [10]. More recent EPR studies have
questioned this assignment and suggested that the rad-
ical species detected in partially reduced MAO is due
solely to the covalently linked flavin semiquinone,
leading to support for the direct hydride transfer
mechanism [11].
A common feature of all the proposed mechanisms
is the initiation of catalysis with the deprotonated
form of the amine substrate, and it is widely accepted
that it is the deprotonated form of the substrate that
binds in the functional enzyme–substrate (ES) com-
plex [12–14]. By contrast, recent kinetic studies on
the pH dependence of the steady-state kinetic param-
eters for MAO A were interpreted to indicate that it
is the protonated form of the substrate that binds to
the enzyme [15]. Due to the conflicting evidence from
the relatively few studies on the effects of pH on
MAO catalysis, a more comprehensive analysis is
required.
The present study reports on the pH dependence of
recombinant human liver MAO A as characterized by
both steady-state and stopped-flow techniques. The
effect of pH on the kinetic isotope effect (KIE) of the
reductive half-reaction is also presented. The results
obtained provide insight into how monoamine oxidases

are able to function efficiently at physiological pH with
the deprotonated amine substrate, despite the high pK
a
values of common substrates.
Results and Discussion
Catalytically influential macroscopic ionizations
The pH dependence of the catalytic rate was studied
by both stopped-flow and steady-state techniques.
Although the catalytic activity of MAO A has been
shown to be dominated by the reductive half-reaction,
this may change with pH, leading to a different pH
dependence for the reductive half reaction compared
to complete catalytic turnover. Also, a range of sub-
strates were analysed to establish whether the observed
kinetic trends were applicable for all amine substrates.
For example, although benzylamine is a well character-
ized substrate for MAO A, all naturally occurring sub-
strates contain an ethylamine group in the structure.
All steady-state kinetic measurements were per-
formed in air-saturated buffers, which have been
shown to saturate the enzyme with the second sub-
strate, oxygen [16]. The k
cat
values for benzylamine
(see supplementary Fig. S1) and kynuramine exhibit a
sigmoidal dependence upon pH, as shown in Fig. 1A
for kynuramine, indicating the presence of a single
macroscopic ionization with a pK
a
value of 7.9 ± 0.1

obtained from curve fitting for both substrates. The
observed macroscopic ionization corresponds to a
group in the ES complex that must be deprotonated
for optimal activity. The k
cat
⁄ K
m
values exhibit a bell-
shaped pH profile with corresponding pK
a
values of
8.5 ± 0.1 and 9.2 ± 0.1 for benzylamine (see supple-
mentary Fig. S1), and 8.0 ± 0.2 and 8.8 ± 0.2 for
kynuramine (Fig. 1B). These results indicate that, with
increasing pH, a favourable deprotonation step is
followed by an unfavourable deprotonation event,
either in the free enzyme or free substrate, to produce
the bell-shaped pH profile.
At pH 7.5 and below, the flavin monitored reductive
half-reaction transients from stopped-flow assays were
fitted using a single exponential function to determine
the apparent rate constants for FAD reduction. How-
ever, above pH 7.5, the reaction traces were fitted
instead with a double-exponential function, as a second,
slower process was resolved in the flavin reductive reac-
tion. This biphasic behaviour has been observed previ-
ously with para-substitued phenylethylamines, and the
slow phase was attributed to the release of the imine
product from the reduced enzyme [17]. Because the slow
phase was only a minor component of the total ampli-

tude change (20–30% at most) and did not vary with
substrate concentration, only the substrate dependence
of the fast phase was analysed further. As expected, the
pH dependence of the kinetic parameters for the reduc-
tive half-reaction of benzylamine oxidation exhibited
Scheme 1. Catalytic cycle of monoamine oxidase.
R. V. Dunn et al. Isotope effects and their pH dependence in MAO A
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS 3851
similar pH profiles to those obtained for the equivalent
steady-state parameters (see supplementary Fig. S2). At
each pH, the value of k
red
was found to be less than
that of k
cat
, which has been observed previously in
kinetic studies with MAO A [12]. This was attributed to
aggregation of the detergent solubilized enzyme at the
high concentrations required for stopped-flow assays.
To minimize this potential effect, the same concentra-
tion of MAO A was used in all stopped-flow experi-
ments. The k
red
exhibited a single ionization with a
corresponding pK
a
of 7.4 ± 0.1, and the k
red
⁄ K
s

exhib-
ited a bell-shaped profile with pK
a
values of 8.6 ± 0.7
and 8.3 ± 0.7 obtained from curve fitting.
By contrast to all other substrates, the pH depen-
dence of k
red
for MAO A-catalysed phenylethylamine
(PEA) oxidation displayed a bell-shaped profile, with
corresponding pK
a
values of 8.4 ± 0.2 and 8.7 ± 0.2
(Fig. 1C). The cause of the additional macroscopic ioni-
zation on the alkaline side of the pH profile for PEA is
unknown. For benzylamine and PEA, it has been estab-
lished that the rate-limiting step of flavin reduction is
due to aC-H bond cleavage, and it is unlikely that a dis-
tinct catalytic step affects flavin reduction to produce
the different pH dependence. From quantitative struc-
ture activity studies with MAO A, it has been shown
that different factors influence the correct positioning
of para-substituted phenylethylamines compared to
para-substituted benzylamines, and that these are
required for efficient catalysis [12,17]. It was suggested
that the greater steric flexibility of the ethylamine side
chain allows efficient aC-H bond cleavage without con-
fining the phenyl ring to a specific orientation. There-
fore, the greater flexibility of the substrate when bound
to the active site may allow it to contact additional

ionizable residues that influence the correct orientation
for catalysis and affect the resulting pH profile. The
k
red
⁄ K
s
data also exhibit a bell-shaped pH profile, but
meaningful pK
a
values cannot be determined due to the
large errors associated with these data (Fig. 1D). A
summary of all pK
a
values is given in Table 1.
pH dependence of KIEs identifies substrate
ionization in the ES complex
As the amine substrates are able to ionize over the pH
range investigated, some of the observed macroscopic
0.0
0.5
1.0
1.5
2.0
2.5
3.0
AB
CD
k
cat
(s

–1
)
pH
0
10
20
30
40
50
k
cat
/K
m
(s
–1
mM
–1
)
pH
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
k
red

(s
–1
)
pH
6.0
6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0
6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0 6.0 6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0
-20
0
20
40
60
80
100
120
140
k
red
/K
s
(s
–1
mM
–1
)
pH
Fig. 1. (A, B) pH dependence of the steady-
state kinetic parameters of MAO A-cataly-
sed oxidation of kynuramine at 20 °C. (C, D)
pH dependence of the reductive half-reac-

tion of MAO A-catalysed oxidation of phen-
ylethylamine at 20 °C.
Table 1. pK
a
values obtained from curve fitting for MAO A at 20 °C. ND, not determined.
Substrate Method
ES complex Free E or S
pK
a1
pK
a2
pK
a1
pK
a2
Benzylamine Steady-state 7.9 ± 0.1 – 8.5 ± 0.1 9.2 ± 0.1
Kynuramine Steady-state 7.9 ± 0.1 – 8.0 ± 0.2 8.8 ± 0.2
Benzylamine Stopped-flow 7.4 ± 0.1 – 8.6 ± 0.7 8.3 ± 0.7
PEA Stopped-flow 8.4 ± 0.2 8.7 ± 0.2 ND ND
Isotope effects and their pH dependence in MAO A R. V. Dunn et al.
3852 FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
ionizations may be due to the substrate rather than to
groups on the enzyme. A potential way to identify sub-
strate ionizations is to perturb the substrate pK
a
(e.g.
by deuteration) and to observe a corresponding shift
in the macroscopic ionization. Deuteration of the
atoms bonded to the amine nitrogen is known to cause
an increase in the amine pK

a
; in part due to: (a) the
shorter C-D bond length leading to a greater charge
density on the carbon and hence greater nitrogen lone
pair availability and (b) the greater reduced mass of
the deuterated analogue for the N-H stretching fre-
quency, causing it to lie lower in the asymmetric
potential energy well (lower zero point energy) relative
to the protiated substrate [18–20]. The pH dependence
of the reductive half-reaction of benzylamine oxidation
was determined at a saturating substrate concentration
of 5 mm, for both the protiated and deuterated forms.
The pH profile of k
red
for both substrates is shown in
Fig. 2, and a small alkaline shift is observed for deu-
terated benzylamine relative to protiated benzylamine,
which results in a decrease of the calculated KIE from
13 to 8 with increasing pH (Fig. 2, inset). A similar
effect has been seen in studies with trimethylamine
dehydrogenase (TMADH), where substrate perdeutera-
tion caused a shift in the observed macroscopic ioniza-
tion in the ES complex, resulting in a strong
dependence of the KIE upon pH [21]. This result, com-
bined with mutagenesis work on TMADH, led to the
assignment of the ionization as that of bound sub-
strate. It is likely that a similar effect is observed with
MAO A, where the observed macroscopic ionization is
due to deprotonation of the bound amine substrate.
The effect of substrate deuteration was more signifi-

cant for TMADH, and may be explained by the
greater increase in substrate pK
a
upon perdeuteration
of trimethylamine (DpK
a
= 0.3) [18] compared to a-C
deuteration of benzylamine (expected DpK
a
= 0.032)
[19]. A mechanism describing the ionization of the sub-
strate and its effect on flavin reduction is shown in
Scheme 2, where K
A
S
and K
A
ES
are the dissociation
constants for the free substrate and the enzyme-bound
substrate, respectively [22]. It is assumed that the rate
of flavin reduction (k
red
) is slow relative to the dissoci-
ation steps, so that they remain in thermodynamic
equilibrium. It can be seen that if the pK
a
of the amine
substrate is increased (e.g. in the deuterated analogue),
this will lead to a greater proportion of the unreactive

ESH
+
form relative to ES at a given pH. Therefore,
the observed KIE will appear inflated at low pH, and
be greater than that due purely to bond breakage
effects.
Perturbation of amine pK
a
mechanism of
monoamine oxidase
The accuracy of the derived pK
a
values from the bell-
shaped pH profiles for k
red
⁄ K
s
or k
cat
⁄ K
m
is quite low.
This is partly due to the error associated with fitting
the particular functions to narrow plots because the
width of the curve is relatively insensitive to the differ-
ence in pK
a
values when pK
a1
)pK

a2
is < 0.6 [22].
Despite this drawback, the pH profiles are still of qual-
itative value. Based upon the assignment of the ioniza-
tion in the ES complex to that of the bound substrate,
it follows that the acid limb of the bell-shaped k
red
⁄ K
s
or k
cat
⁄ K
m
profile is due to deprotonation of the free
substrate and that the alkaline limb is due to the unfa-
vourable deprotonation of an unknown group on the
enzyme at high pH. The stated pK
a
values of the free
substrates (9.3–9.9) are higher than those obtained
from curve fitting (8.0–8.6) and may simply reflect the
error in curve fitting as mentioned above. The main
effect of substrate binding is to perturb the amine pK
a
to more acidic values; as the bound substrate has a
pK
a
of 7.4–8.4, this corresponds to a DpK
a
of approxi-

mately 2 relative to the free substrate. Such an effect
has been seen with other amine oxidases. For example,
6 7 8 9 10
0.00
0.01
0.02
0.03
0.04
0.05
0.06
0.07
0.08
0.09
p
H
k
red
(s
–1
)
0.000
0.002
0.004
0.006
0.008
0.010
0.012
6.5 7.0 7.5 8.0 8.5 9.0 9.5
6
8

10
12
14
16
18
KIE
pH
k
red
(s
–1
)
Fig. 2. pH dependence of the reductive half-reaction of MAO A-ca-
talysed oxidation at 20 °C with 5 m
M benzylamine (filled circles, left
axis) or 5 m
M deuterated benzylamine (open circles, right axis).
Inset: calculated KIE as a function of pH.
ES + SH
k
1
k
1
k
2
k
2
'
'
K

A
K
A
S
ES
k
red
+
ESH
+
E + S ES E + P
Scheme 2. Control of flavin reduction by substrate ionization.
R. V. Dunn et al. Isotope effects and their pH dependence in MAO A
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS 3853
trimethylamine dehydrogenase, mouse polyamine oxi-
dase and monomeric sarcosine oxidase exhibit acidic
shifts in substrate pK
a
values of 3.3–3.6, 0.8 and 2.6,
respectively, upon substrate binding to the active site
[18,23,24]. Therefore, the active site of each of these
enzymes is organized to stabilize the neutral form of
the amine substrate by approximately 11 kJÆmol
)1
rela-
tive to the charged, protonated form.
The steady-state oxidation of kynuramine by
MAO A has been studied previously, and the overall
trends of the data are very similar to those reported in
the present study, which suggests that variations in

buffer composition have minimal effect [15]. However,
the interpretation of the results was different in the
previous study. It was suggested that, due to the initial
increase in rate with increasing pH and the relative
invariance of the K
m
values over the same pH range
(in which the concentration of the neutral form of the
substrate would be insignificant compared to the pro-
tonated form), it must be the protonated form of the
substrate that binds to the enzyme, with subsequent
substrate deprotonation required for catalysis to pro-
ceed. Therefore, the macroscopic ionization in the ES
complex was assigned to a group on the enzyme,
rather than to the ionization of bound substrate, as
indicated by data reported in the present study. The
invariance of the K
m
values at low pH makes this a
plausible explanation, although it may be over simplis-
tic to assume that an exponential dependence of K
m
with pH is required to indicate the binding of the
deprotonated form because the pH dependence of K
m
or K
s
is affected by all macroscopic ionizations occur-
ring in the system [22]. The variations in the K
m

or K
s
values with pH for all substrates used in the present
study are shown in Table 2. Unlike the values for
kynuramine, the K
m
or K
s
values for all other
substrates tested exhibited a general decrease with
increasing pH in the range from $ 6.5–8.5. When the
pK
m
or pK
s
values are plotted as a function of pH
(results not shown), the initial slope at low pH is < 1,
which may simply reflect that the relevant macroscopic
ionizations are not sufficiently separated to be individ-
ually identified. There are too few points at high pH
to accurately calculate the change of slope that occurs
above pH 9 for all substrates, although it is clear that
the K
m
and K
s
values are increased.
Conclusions
Despite the suggestion that it is the protonated form
of the substrate that binds the enzyme, it is difficult to

envisage specific binding of the charged substrate when
the active site is organized for binding and activation
of the neutral form. In addition, the pH dependence of
the KIE and the observation of similar perturbation
effects on substrate pK
a
values with other amine oxid-
ases further support the catalytic significance of the
deprotonated form. Thus, we propose that binding of
the substrate to the active site leads to a perturbation
of the pK
a
, effectively increasing the concentration of
the neutral amine species. We do not propose that it is
only the protonated form that initially binds, but
rather that preferential binding of the deprotonated
form to the active site leads to a shift in the equilib-
rium of the substrate ionization. The present study
emphasizes the benefits of using deuteration of com-
pounds in conjunction with standard stopped-flow and
steady-state analyses to provide deeper insight into
reaction mechanism. In the case of the amine oxidases,
the perturbation of the substrate pK
a
upon binding to
the active site appears to be a general feature, allowing
efficient function of the enzyme at physiologically
relevant pH values.
The crystal structure of MAO A has recently been
solved to 2.2 A

˚
resolution [25], allowing a more
detailed knowledge of the active site geometry of
Table 2. pH dependence of K
m
and K
s
values determined for MAO A at 20 °C.
pH
K
m
(mM) K
s
(mM)
Benzylamine Kynuramine Benzylamine PEA
6.5 – 0.042 ± 0.003 0.213 ± 0.012 0.019 ± 0.017
7.0 0.31 ± 0.04 0.047 ± 0.003 0.134 ± 0.032 0.145 ± 0.007
7.2 – – 0.136 ± 0.007 –
7.5 0.20 ± 0.02 0.041 ± 0.002 0.138 ± 0.014 0.122 ± 0.015
8.0 0.10 ± 0.01 0.044 ± 0.003 0.034 ± 0.004 0.078 ± 0.003
8.5 0.077 ± 0.002 0.045 ± 0.002 0.033 ± 0.004 0.048 ± 0.002
9.0 0.087 ± 0.004 0.082 ± 0.005 0.039 ± 0.004 0.028 ± 0.002
9.2 – – 0.079 ± 0.019 0.042 ± 0.016
9.5 0.137 ± 0.003 0.261 ± 0.028 0.424 ± 0.108 0.268 ± 0.125
Isotope effects and their pH dependence in MAO A R. V. Dunn et al.
3854 FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
MAO A. Inspection of the active site suggests that
there are several candidates responsible for the unfa-
vourable deprotonation event that occurs at alkaline
pH, including multiple tyrosine residues, the covalently

linked FAD, and possibly Lys305 that is co-ordinated
to the flavin via a water molecule. To be confident
about any assignment, future work combining muta-
genesis studies with stopped-flow kinetic analysis is
required.
Experimental procedures
Materials
Bis-Tris propane buffer, reduced Triton X-100, kynur-
amine, benzylamine, and b-phenylethylamine were obtained
from Sigma (St Louis, MO, USA). Deuterated benzylamine
HCl (C
6
D
5
CD
2
NH
2
, 99.2 atom % D) was obtained from
CDN Isotopes (Quebec, Canada).
Expression and purification of MAO A
The gene encoding human liver MAO A was amplified
from a cDNA clone obtained from MRC Geneservices
(Cambridge, UK) using the primers 5¢-GTCTTCGAA
A
CCATGGAGAATCAAGAGAAGGCGAGTATCGCGG
G-3¢ and 5¢-GAGAG
CTCGAGAACAGAACTTCAAGAC
CGTGGCAGGAGC-3¢. The NcoI and Xho I sites used for
further cloning are shown underlined. The amplified DNA

was first cloned into pGem-T Easy (Promega, Madison,
WI, USA) following A-tailing using standard techniques. A
modified version of the pPICZA plasmid (Invitrogen, Carls-
bad, CA, USA) was used as the final expression vector, in
which the NcoI site upstream of the Zeocin resistance gene
was mutated using the primer 5¢-GGTGAGGAAC
TAAAACATGGCCAAGTTGACCAGTGC-3¢ and its
reverse complement. A unique NcoI site was then intro-
duced at the multiple cloning site generating a Kozak
sequence to allow efficient translation initiation of the
inserted gene, using the primer 5¢-CAACTAATTATTCG
AAACCATGGATTCACGTGGCCC-3¢ and its reverse
complement. The modified pPICZA vector was then
digested with NcoI and XhoI, and similarly digested maoA
inserted following gel purification. The sequence of the
cloned gene was confirmed by DNA sequencing. All site-
directed mutagenesis reactions were performed using the
Stratagene QuikChange site-directed mutagenesis kit (Strat-
gene, La Jolla, CA, USA) with Pfu Turbo DNA polymer-
ase; except that the DNA was transformed into Novablue
competent cells (Novagen, Madison, WI, USA). The
pPICZAmaoA plasmid was linearized with PmeI and trans-
formed into Pichia pastoris strain KM17H by electropora-
tion following standard protocols [26]. Successful
transformants were selected on agar plates containing
100 lgÆmL
)1
of Zeocin. Multiple integrants were selected
by growth on plates with increasing Zeocin concentrations,
and screened for MAO A expression. Typically, 8 L of cul-

ture were grown in baffled flasks in an orbital incubator at
30 °C. The cells were harvested for 48 h after methanol
induction by centrifugation at 2000 g for 10 min. The cells
were resuspended in Pichia breakage buffer to approxi-
mately 200 gÆL
)1
and then lysed by passing twice through a
cell disruptor at 40 000 psi (TS-series 1.1 kW model; Con-
stant Systems Ltd, Daventry, UK) followed by cooling on
ice. MAO A was then purified essentially as described pre-
viously [27]. Active fractions eluted from the DEAE-Sepha-
rose column were concentrated by ultrafiltration and stored
at )80 °C. Prior to use, the enzyme was dialysed extensively
against 20 mm potassium phosphate (pH 7.0), containing
20% glycerol, to remove the competitive inhibitor d-amp-
hetamine that is present during the later stages of purifica-
tion. Typical yields from an 8 L growth were between
80–120 mg of purified MAO A. Enzyme concentration
was determined using an extinction coefficient of
12 000 m
)1
Æcm
)1
at 456 nm [27].
Enzyme assays
Routine activity measurements were conducted using a
continuous spectrophotometric assay with kynuramine as
substrate. Assays were performed at 25 °Cin50mm
potassium phosphate (pH 7.5), containing 0.5% (w ⁄ v)
Triton X-100 and 0.2 mm kynuramine. The activity was

calculated by following the initial increase of A
316
due to
production of 4-hydroxyquinone and using an extinction
coefficient of 12 000 m
)1
Æcm
)1
[28]. One unit of enzyme
activity is defined as the amount of enzyme required to
oxidize 1 l mol of kynuramine in 1 min.
Steady-state kinetic measurements
Steady-state kinetic measurements were performed at 20 °C
in 20 mm Bis-Tris propane buffer containing 0.5% (w ⁄ v)
reduced Triton X-100, 50 mm NaCl and 20% glycerol. The
pH of the buffer was set by the addition of small amounts
of concentrated HCl or NaOH, and was in the range 6.5–
9.5. The rate of enzymatic activity was determined by moni-
toring the initial linear increase in absorbance at 250 nm
due to the production of benzaldehyde, employing an
extinction coefficient 12 800 m
)1
Æcm
)1
[29], and using a
Varian Cary 50 Bio spectrophotometer (Varian Inc., Palo
Alto, CA, USA). The concentration of benzylamine was
typically in the range 0.02–2 m m, and the assay was started
by the addition of MAO A to a final concentration of
0.6 lm. Michaelis–Menten kinetic behaviour was observed

at each pH studied; the only exception was at pH 6.5,
where the rate of enzymatic activity was only assayed at
saturating substrate concentrations due to the slow rate
R. V. Dunn et al. Isotope effects and their pH dependence in MAO A
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS 3855
observed. Identical experiments were performed with kynur-
amine as substrate, but the reaction was monitored at A
316
,
as described above, and the final concentration of MAO A
in the assay was 0.1 lm.
Single wavelength anaerobic stopped-flow
kinetic experiments
The reductive half-reaction of MAO A was studied using
an Applied Photophysics SX.18MV stopped-flow spectro-
photometer (Applied Photophysics Ltd, Leatherhead, UK)
housed in a Belle Technology glove box (< 5 p.p.m.
oxygen) (Belle Technology, Portesham, UK). Studies were
performed in 20 mm Bis-Tris propane buffer containing
0.5% (w ⁄ v) Triton X-100, 50 mm NaCl and 20% glycerol.
Buffer solutions were purged with nitrogen for 1 h and
then left to equilibrate overnight in the glove box. Dialy-
sed MAO A was exchanged into the appropriate anaerobic
buffer by gel exclusion chromatography, and stock
solutions of the substrates were also diluted into the
appropriate buffer. To remove any final traces of oxygen,
10 units of glucose oxidase (Sigma) and 10 mm glucose
were added per mL of solution and left to incubate for
30 min once loaded into the stopped-flow syringes. The
reactions were started by rapid mixing of 10 lm oxidized

MAO A with various concentrations of either benzylamine
or phenylethylamine. A minimum of six substrate concen-
trations were used at each pH that spanned almost two
orders of magnitude. The rate of flavin reduction was
monitored under pseudo first-order conditions by follow-
ing the decrease in A
456
.
Data analysis
Steady-state kinetic data were fitted with the Michaelis–
Menten equation using nonlinear least-squares analysis
incorporated into the origin software package (OriginLab
Corp., Northampton, MA, USA), and the maximal cata-
lytic centre activity (k
cat
) and the Michaelis constant (K
m
)
determined. The observed rates from stopped-flow data
were obtained by fitting the reaction traces to an equation
for either single- or double-exponential decay with offset,
as appropriate. Analysis was performed by nonlinear least-
squares regression on an Acorn RISC PC (Acorn Com-
puters, Cambridge, UK) using spectrakinetics software
(Applied Photophysics). The observed rate of enzyme
reduction was found to have a hyperbolic dependence with
respect to substrate concentration at each pH. The limiting
rate of flavin reduction (k
red
) and the substrate binding con-

stant (K
s
) were determined as described by Strickland et al.
[30] using the origin software package. The pH dependence
of the kinetic parameters were fitted to an equation descri-
bing either a single (Eqn 1) or double (Eqn 2) ionization, as
appropriate, to obtain the corresponding macroscopic pK
a
values.
y ¼ EH Â 10
ðÀpHÞ
þ E Â 10
ðÀpK
a
Þ
10
ðÀpHÞ
þ 10
ðÀpK
a
Þ
ð1Þ
y ¼
T
max
1 þ 10
ðpK
a1
ÀpHÞ
þ 10

ðpHÀpK
a2
Þ
ð2Þ
Where EH and E are the limiting catalytic activities of the
protonated and deprotonated forms of the ionization
group, respectively; and T
max
is the theoretical maximal
value. For the pH profile in which a double ionization is
observed, it is assumed that the observed parameter is
dependent upon the singly protonated species, therefore
producing a bell-shaped profile tending towards zero at the
extremes of pH. Examples of the reaction transients and
further details regarding treatment of the data are given in
supplementary Figs S3–S5.
Acknowledgements
This work was funded by the UK Biotechnology and
Biological Sciences Research Council. N.S.S. is a
BBSRC Professorial Research Fellow.
References
1 Binda C, Newton-Vinson P, Hubalek F, Edmondson
DE & Mattevi A (2002) Structure of human mono-
amine oxidase B, a drug target for the treatment of
neurological disorders. Nat Struct Biol 9, 22–26.
2 Cesura AM & Pletscher A (1992) The new generation
of monoamine oxidase inhibitors. Prog Drug Res 38,
171–297.
3 Scrutton NS (2004) Chemical aspects of amine
oxidation by flavoprotein enzymes. Nat Prod Rep 21,

722–730.
4 Silverman RB (1995) Radical ideas about monoamine-
oxidase. Acc Chem Res 28, 335–342.
5 Edmondson DE, Binda C & Mattevi A (2007)
Structural insights into the mechanism of amine
oxidation by monoamine oxidases A and B. Arch
Biochem Biophys 464, 269–276.
6 Li M, Binda C, Mattevi A & Edmondson DE (2006)
Functional role of the ‘aromatic cage’ in human
monoamine oxidase B: structures and catalytic
properties of Tyr435 mutant proteins. Biochemistry 45,
4775–4784.
7 Erdem SS, Karahan O, Yildiz I & Yelekci K (2006) A
computational study on the amine-oxidation mechanism
of monoamine oxidase: insight into the polar nucleo-
philic mechanism. Org Biomol Chem 4, 646–658.
8 Akyuz MA, Erdem SS & Edmondson DE (2007) The
aromatic cage in the active site of monoamine oxidase
B: effect on the structural and electronic properties of
Isotope effects and their pH dependence in MAO A R. V. Dunn et al.
3856 FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS
bound benzylamine and p-nitrobenzylamine. J Neural
Transm 114, 693–698.
9 Ralph EC, Hirschi JS, Anderson MA, Cleland WW,
Singleton DA & Fitzpatrick PF (2007) Insights into the
mechanism of flavoprotein-catalyzed amine oxidation
from nitrogen isotope effects on the reaction of N-meth-
yltryptophan oxidase. Biochemistry 46, 7655–7664.
10 Rigby SEJ, Hynson RMG, Ramsay RR, Munro AW &
Scrutton NS (2005) A stable tyrosyl radical in mono-

amine oxidase A. J Biol Chem 280, 4627–4631.
11 Kay CW, El Mkami H, Molla G, Pollegioni L & Ram-
say RR (2007) Characterization of the covalently bound
anionic flavin radical in monoamine oxidase a by elec-
tron paramagnetic resonance. J Am Chem Soc 129,
16091–16097.
12 Miller JR & Edmondson DE (1999) Structure-activity
relationships in the oxidation of para-substituted
benzylamine analogues by recombinant human liver
monoamine oxidase A. Biochemistry 38, 13670–13683.
13 McEwen CM, Sasaki G & Lenz WR (1968) Human
liver mitochondrial monoamine oxidase. I. Kinetic stud-
ies of model interactions. J Biol Chem 243, 5217–5225.
14 Edmondson DE, Bhattacharrya AK & Xu J (2000) Evi-
dence for alternative binding modes in the interaction
of benzylamine analogues with bovine liver monoamine
oxidase B. Biochim Biophys Acta 1479, 52–58.
15 Jones TZE, Balsa D, Unzeta M & Ramsay RR (2007)
Variations in activity and inhibition with pH: the pro-
tonated amine is the substrate for monoamine oxidase,
but uncharged inhibitors bind better. J Neural Transm
114, 707–712.
16 Ramsay RR (1991) Kinetic mechanism of monoamine
oxidase A. Biochemistry 30, 4624–4629.
17 Nandigama RK & Edmondson DE (2000) Structure-
activity relations in the oxidation of phenethylamine
analogues by recombinant human liver monoamine
oxidase A. Biochemistry 39, 15258–15265.
18 Basran J, Sutcliffe MJ & Scrutton NS (2001) Optimiz-
ing the Michaelis complex of trimethylamine dehydroge-

nase – identification of interactions that perturb the
ionization of substrate and facilitate catalysis with
trimethylamine base. J Biol Chem 276, 42887–42892.
19 Perrin CL, Ohta BK, Kuperman J, Liberman J &
Erdelyi M (2005) Stereochemistry of beta-deuterium
isotope effects on amine basicity. J Am Chem Soc 127,
9641–9647.
20 Bary Y, Gilboa H & Halevi EA (1979) Secondary
hydrogen isotope effects .5. Acid and base strengths –
corrigendum and addendum. J Chem Soc Perkin Trans
2, 938–942.
21 Basran J, Sutcliffe MJ & Scrutton NS (2001) Deuterium
isotope effects during carbon-hydrogen bond cleavage
by trimethylamine dehydrogenase – implications for
mechanism and vibrationally assisted hydrogen tunnel-
ing in wild-type and mutant enzymes. J Biol Chem 276,
24581–24587.
22 Tipton KF & Dixon HB (1979) Effects of pH on
enzymes. Methods Enzymol 63, 183–234.
23 Royo M & Fitzpatrick PF (2005) Mechanistic studies of
mouse polyamine oxidase with N1,N12-bisethylsper-
mine as a substrate. Biochemistry 44, 7079–7084.
24 Zhao G & Jorns MS (2005) Ionization of zwitterionic
amine substrates bound to monomeric sarcosine
oxidase. Biochemistry 44, 16866–16874.
25 Son S-Y, Ma J, Kondou Y, Yoshimura M, Yamashita
E & Tsukihara T (2008) Structure of human mono-
amine oxidase A at 2.2-A
˚
resolution: the control of

opening the entry for substrates ⁄ inhibitors. Proc Natl
Acad Sci USA 105, 5739–5744.
26 Invitrogen Corporation (1998) EasySelect Pichia
Expression Kit: A Manual of Methods For Expression
of Recombinant Proteins Using pPICZ and pPICZa in
Pichia pastoris. Invitrogen Corporation, San Diego,
CA.
27 Li M, Hubalek F, Newton-Vinson P & Edmondson DE
(2002) High-level expression of human liver monoamine
oxidase a in Pichia pastoris: comparison with the
enzyme expressed in Saccharomyces cerevisiae. Protein
Expr Purif 24, 152–162.
28 Weyler W & Salach JI (1985) Purification and proper-
ties of mitochondrial monoamine-oxidase type-A from
human-placenta. J Biol Chem 260, 13199–13207.
29 Walker MC & Edmondson DE (1994) Structure-activ-
ity-relationships in the oxidation of benzylamine
analogs by bovine liver mitochondrial monoamine-
oxidase-B. Biochemistry 33, 7088–7098.
30 Strickland S, Palmer G & Massey V (1975) Determina-
tion of dissociation-constants and specific rate of
constants of enzyme-substrate (or protein-ligand) inter-
actions from rapid reaction kinetic data. J Biol Chem
250, 4048–4052.
Supplementary material
The following supplementary material is available
online:
Fig. S1. pH dependence of the steady-state kinetic
parameters of MAO A-catalysed oxidation of benzyl-
amine at 20 °C.

Fig. S2. pH dependence of the reductive half-reaction
of MAO A-catalysed oxidation of benzylamine at
20 °C.
Fig. S3. Reaction transient for MAO A-catalysed
oxidation of 0.5 mm PEA at pH 9.0 and 20 °C.
Fig. S4. Reaction transient for MAO A-catalysed
oxidation of 0.4 mm benzylamine at pH 8.5 and
20 °C.
R. V. Dunn et al. Isotope effects and their pH dependence in MAO A
FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS 3857
Fig. S5. Substrate dependence of the reductive half-
reaction of MAO A-catalysed oxidation of PEA at
pH 8.5 and 20 °C.
This material is available as part of the online article
from
Please note: Wiley-Blackwell is not responsible for
the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
Isotope effects and their pH dependence in MAO A R. V. Dunn et al.
3858 FEBS Journal 275 (2008) 3850–3858 ª 2008 The Authors Journal compilation ª 2008 FEBS