Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

DNA-binding characteristics of the regulator SenR in
response to phosphorylation by the sensor histidine
autokinase SenS from Streptomyces reticuli
Gabriele Bogel, Hildgund Schrempf and Darı
´
o Ortiz de Orue
´
Lucana
FB Biologie ⁄ Chemie, Universita
¨
t Osnabru
¨
ck, Germany
One of the major signal transduction systems govern-
ing bacterial responses and adaptation to environmen-
tal changes is the two-component system (TCS). A
typical TCS consists of an autophosphorylating sensor
histidine kinase (SK) and a cognate response regulator
(RR) [1]. SKs detect stimuli via an extracellular input
domain or intracellular signals via cytoplasmic regions,
or use transmembrane regions and sometimes
additional short extracellular loops for sensing [2]. In
addition to the N-terminal input domain, SKs contain
a C-terminal portion representing the transmitter mod-
ule, with several blocks of amino acid residues being
conserved among these kinase types. Phosphorylation
within a typical SK usually takes place at a conserved
histidine residue; the phosphoryl group of the SK is
subsequently transferred to a conserved aspartic
acid residue within the receiver domain of the RR.
As a result, its C-terminally located output domain

has an altered DNA-binding capacity for the reg-
ulatory region of target gene(s) or operons [3,4]. The
Keywords
DNA binding; phosphorylation;
Streptomyces; two-component system
SenS–SenR
Correspondence
D. Ortiz de Orue
´
Lucana, Universita
¨
t
Osnabru
¨
ck, FB Biologie ⁄ Chemie,
Angewandte Genetik der Mikroorganismen,
Barbarastr. 13, 49069 Osnabru
¨
ck, Germany
Fax: +49 541 9692804
Tel: +49 541 9693439
E-mail:
(Received 13 March 2007, revised 7 June
2007, accepted 7 June 2007)
doi:10.1111/j.1742-4658.2007.05923.x
The two-component system SenS–SenR from Streptomyces reticuli has been
shown to influence the production of the redox regulator FurS, the mycel-
ium-associated enzyme CpeB, which displays heme-dependent catalase and
peroxidase activity as well as heme-independent manganese peroxidase
activity, and the extracellular heme-binding protein HbpS. In addition, it

was suggested to participate in the sensing of redox changes. In this work,
the tagged cytoplasmic domain of SenS (SenS
c
), as well as the full-length
differently tagged SenR, and corresponding mutant proteins carrying speci-
fic amino acid exchanges were purified after heterologous expression in
Escherichia coli. In vitro, SenS
c
is autophosphorylated to SenS
c
Pat
the histidine residue at position 199, transfers the phosphate group to the
aspartic acid residue at position 65 in SenR, and acts as a phosphatase for
SenRP. Bandshift and footprinting assays in combination with competi-
tion and mutational analyses revealed that only unphosphorylated SenR
binds to specific sites upstream of the furS–cpeB operon. Further specific
sites within the regulatory region, common to the oppositely orientated
senS and hbpS genes, were recognized by SenR. Upon its phosphorylation,
the DNA-binding affinity of this area was enhanced. These data, together
with previous in vivo studies using mutants lacking functional senS and
senR, indicate that the two-component SenS–SenR system governs the
transcription of the furS–cpeB operon, senS–senR and the hbpS gene. Com-
parative analyses reveal that only the genomes of a few actinobacteria
encode two-component systems that are closely related to SenS–SenR.
Abbreviations
EMSA, electrophoretic mobility shift assay; LC, liquid chromatography; RR, response regulator; SenRP, phosphorylated SenR; SenS
c
,
cytoplasmic domain of SenS; SenS
c

P, phosphorylated SenS
c
; SK, sensor histidine kinase; TCS, two-component system.
3900 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
well-studied receiver domain within the nitrogen regu-
latory protein C ) controlling the transcription of
genes involved in nitrogen metabolism ) has been
shown to change its topology upon activation by phos-
phorylation [5]. Generally, the signaling pathway
includes a phosphatase that returns the RR to the non-
phosphorylated state. The phosphatase can exist as an
individual protein, or reside on a module, which is
linked either to the RR or to the kinase. A combina-
tion of kinase and phosphatase activity ensures rapid
coordination of the cell response [6].
Streptomycetes are Gram-positive and G + C-rich
bacteria with a complex developmental life cycle. Ger-
mination of spores and subsequent elongation of germ
tubes lead to a network of vegetative hyphae. In
response to nutritional stress and extracellular signa-
ling, aerial hyphae develop, in which spores mature [7].
As soil-dwelling organisms, streptomycetes need to
respond to highly variable conditions. The range of
environmental stimuli to which a bacterium can
respond is expected to correlate with the number of
functional SKs and RRs. These are assumed to have
evolved by selection pressure for different ecophysio-
logic properties of the different strains [8]. The com-
plete genome sequence of Streptomyces coelicolor
A3(2) comprises 84 SK genes and 80 RR genes [9].

The physiologic roles of only a few of them have been
investigated experimentally. For instance, the AbsA1–
AbsA2 system negatively regulates the production of
several antibiotics [10,11], and the VanR–VanS system
activates the expression of vancomycin resistance
[12,13]. Phosphate control of the production of actino-
rhodin and undecylprodigiosin in S. lividans and
S. coelicolor A3(2) is mediated by the two-component
PhoR–PhoP system, which also controls the alkaline
phosphatase gene (phoA) and other phoA-related genes
[14,15]. To date, however, the phosphorylation cascade
between a Streptomyces SK and its cognate RR lead-
ing to altered DNA-binding affinity of the RR has not
been analyzed in detail.
The cellulose degrader S. reticuli has been reported
to contain the neighboring genes senS and senR,
which encode an SK and an RR, respectively. SenS
(42.2 kDa) comprises five predicted membrane-span-
ning portions. SenR (23.2 kDa) has a C-terminal region
with a predicted helix–turn–helix motif, which is char-
acteristic for different DNA-binding proteins [16]. It
was concluded that SenR is the cognate RR for the SK
SenS. Comparative transcriptional and biochemical
studies with a designed S. reticuli senS–senR chromoso-
mal disruption mutant showed that the presence of
SenS–SenR influences the transcription of the furS–
cpeB operon encoding the redox regulator FurS and
the catalase-peroxidase CpeB, and the hbpS gene for
the secreted HbpS, representing a novel type of heme-
binding protein [16]. Physiologic studies showed that

the production of HbpS is positively influenced by
hemin in S. reticuli; this correlated with increased
hemin resistance. Interestingly, the presence of HbpS
leads to enhanced synthesis of the heme-containing
CpeB [17].
In this study, we describe the in vitro phosphoryla-
tion cascade between the purified cytoplasmic domain
of SenS (SenS
c
) and SenR. Using designed mutant pro-
teins, the phosphorylation sites within SenS
c
and SenR
have been investigated. Bandshift and footprinting
analyses have allowed the characterization of the
DNA-binding properties in response to phosphoryla-
tion by the sensorkinase SenS.
Results
Cloning of wild-type and mutant senS
c
and senR
genes and purification of fusion proteins
As shown previously, overexpression of the full-length
senS gene resulted in the synthesis of an insoluble pro-
tein in Escherichia coli [16]. To obtain a truncated
SenS (comprising its predicted cytoplasmic portion; see
Experimental procedures) with an N-terminal Strep-tag
(SenS
c
), the corresponding portion of senS was cloned

into the plasmid pASK-IBA7. Furthermore, using site-
directed mutagenesis, a mutant gene was designed and
cloned into plasmid pASK-IBA7 (see Experimental
procedures), leading to the mutant SenS
c
H199A, which
carried an alanine residue in place of the histidine resi-
due in position 199. After induction with anhydrotetra-
cycline, each of the corresponding E. coli XL1-Blue
transformants produced a SenS
c
fusion type in a sol-
uble form within the cytoplasm. Using streptactin affin-
ity chromatography, the SenS
c
and the SenS
c
H199A
fusion protein, both with a predicted molecular mass of
27.1 kDa, were obtained (96 nmol per 1 L of culture)
in high purity (Fig. 1). After proteolytic treatment with
trypsin, each protein was analyzed by liquid chroma-
tography ⁄ mass spectrometry (LC-MS), and was found
to comprise the correct N-terminal and internal
peptides (data not shown).
The full-length senR gene and mutant senR genes (car-
rying designed codon exchanges) were cloned into the
plasmid pET21a. The resulting wild-type protein carry-
ing a C-terminal His-tag (SenR) with a predicted
molecular mass of 24.3 kDa was purified to homogen-

eity from an E. coli BL21(DE3)pLys transformant after
induction with isopropyl thio-b-d-galactoside by Ni
2+
–
nitrilotriacetic acid affinity chromatography (Fig. 1).
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3901
Correspondingly, the mutant SenRD60A and Sen-
RD65A fusion proteins (24.3 kDa), which carried an
alanine instead of the original aspartic acid residue at
position 60 or 65, were purified to homogeneity from
the corresponding E. coli BL21(DE3)pLys transform-
ants by Ni
2+
–nitrilotriacetic acid affinity chromatogra-
phy (Fig. 1). Surprisingly, SenRD60A seemed to be
partially degraded and aggregated. From 1 L of E. coli
culture, about 144 nmol of each SenR type was purified.
SenS
c
acts as a histidine autokinase in vitro
SenS
c
exhibited time-dependent autophosphorylation
during incubation with [
32
P]ATP[cP]. The highest sig-
nal intensity was already achieved after 5 min of incu-
bation (Fig. 2A). The subsequent addition of an excess
of unlabeled ATP resulted in a constant level of phos-

phorylated SenS
c
(SenS
c
P) over a relatively long per-
iod (at least 20 min; Fig. 2B). Sequence alignments
showed that the histidine residue at position 199 within
SenS is predicted to be the phosphorylation site [16].
To corroborate this assumption, the corresponding
H199 codon was replaced by one for alanine using
site-directed mutagenesis (see Experimental proce-
dures). The purified SenS
c
H199A (Fig. 2C, left) failed
to undergo autophosphorylation after incubation with
[
32
P]ATP[cP] (Fig. 2C, right). Chemical stability tests
were applied to characterize the nature of the phos-
pholigand. Thus, after treatment of SenS
c
P with 1 m
HCl, the labeled phosphate group was lost from the
protein, but it was retained in the presence of 1 m
NaOH (Fig. 2D). This is the characteristic feature of a
phosphoamidate, which is stable under alkaline condi-
tions but is sensitive to acidic conditions, under which
rapid aminolysis at pH < 5.5 is induced [18]. Taken
together, the presented data show clearly that SenS is
a histidine autokinase.

SenS
c
phosphorylates and dephosphorylates
SenR
As SenR was predicted to be the cognate RR of the
SK SenS, the transfer of radiolabeled phosphate from
Fig. 1. Expression and purification of SenS
c
and SenR proteins. Sol-
uble protein extracts containing SenS
c
obtained from E. coli XL1-
Blue pASK2 (lane 1) after induction with anhydrotetracycline
(lane 2) were loaded onto a streptactin column. After washing (see
Experimental procedures), SenS
c
was eluted with buffer W contain-
ing 2.5 m
M desthiobiotin (lane 3). SenS
C
H199A was purified in the
same manner (lane 4). To obtain SenR, a cytoplasmic protein
extract (lane 5) containing SenR obtained from E. coli BL21(DE3)-
pLys pETR1 after induction (lane 6) was loaded onto an Ni
2+
–nitrilo-
triacetic acid-containing agarose column. Bound SenR was eluted
with solution A containing 250 m
M imidazole (lane 7) as described
under Experimental procedures. SenRD60A (lane 8) and SenRD65A

(lane 9) were purified in the same manner. The molecular masses
of the protein markers (S) are indicated.
Fig. 2. Phosphorylation analysis of SenS
c
. (A) To test its autokinase
activity, the purified SenS
c
protein (74 pmol) was incubated in kin-
ase buffer containing 0.05 lCi of [
32
P]ATP[cP] at 30 °C for the indi-
cated period. Each sample was then separated by SDS ⁄ PAGE;
subsequently, the gel was dried and exposed on an X-ray-sensitive
film. (B) After 4 min of self-phosphorylation of SenS
c
, an excess of
unlabeled ATP was added to the samples. Each reaction was ter-
minated by adding an equal amount of 4 · sample buffer. After
electrophoresis, the gel was dried and exposed on an X-ray-sensi-
tive film. (C) SenS
c
(148 pmol) or SenS
c
H199A (148 pmol) was
incubated in the kinase buffer with 0.05 l Ci of [
32
P]ATP[cP] for
5 min at 30 °C. After the addition of 4 · sample buffer, the reaction
was stopped, and the mixture was subsequently subjected to
SDS ⁄ PAGE. The gel was stained with Coomassie Brilliant Blue

(left), or alternatively dried and exposed on an X-ray-sensitive film
(right). (D) After autophosphorylation of 74 pmol of SenS
c
with
0.05 lCi of [
32
P]ATP[cP] in kinase buffer for 5 min at 30 °C, the
reaction was terminated by adding 4 · sample buffer and subjected
to SDS ⁄ PAGE. Each gel was treated with the indicated solutions,
dried, and exposed on an X-ray-sensitive film.
Response regulator SenR G. Bogel et al.
3902 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
SenS
c
to SenR was investigated. For this purpose, the
purified SenR was added to the
32
P-autophosphorylat-
ed SenS
c
(see previous section). Very rapid (within 5–
10 s) labeling of SenR was observed, together with a
concomitant reduction of the phospholabel within
SenS
c
(Fig. 3A,B). Autophosphorylation activity of
SenR using [
32
P]ATP[cP] or the phosphodonor acetyl-
phosphate could not be detected (data not shown).

The deduced SenR comprises aspartic acid residues at
position 60 (D60) and position 65 (D65), each of
which is a candidate to participate in the phosphoryla-
tion process [16]. Site-directed mutagenesis showed
that each of the two residues was replaced by an alan-
ine. SenRD60A and SenRD65A were subsequently
purified from corresponding E. coli transformants (see
above). Further transphosphorylation analysis revealed
that the presence of SenS
c
P provoked phospholabe-
ling of wild-type SenR and SenRD60A. In contrast,
the mutant protein SenRD65A was not found to be
phosphorylated by SenS
c
P (Fig. 3C). D65 is therefore
the phosphorylation site within SenR.
As demonstrated by quantitative analysis (using a
PhosphorImager system), during the transphosphoryla-
tion reaction dephosphorylation of phosphorylated
SenR (SenRP) occurred after aproximately 3 min of
incubation (Fig. 3B); during this period, no rephospho-
rylation of SenS
c
was recorded. To investigate this pro-
cess in more detail, phospholabeled SenR (carrying a
His-tag) was separated immediately after phosphoryla-
tion from SenS
c
(carrying a Strep-tag) by Ni

2+
–nitrilo-
triacetic acid affinity chromatography. The addition of
dephosphorylated SenS
c
to a reaction mixture contain-
ing phospholabeled SenR provoked a rapid (within
60 s) loss of the phosphoryl group from SenR
(Fig. 4A,B). In the absence of SenS
c
, autodephospho-
rylation of SenR P occurred only after a longer
(> 120 s) period of incubation (data not shown).
These data show that SenS
c
also acts as a phosphatase
for SenRP.
DNA-binding properties of SenR depend on its
phosphorylated state
Comparative analysis of wild-type S. reticuli and the
senS–senR disruption mutant showed that the presence
of SenS–SenR correlates with a significant reduction of
Fig. 4. Dephosphorylation rate of SenRP. (A) SenR was first phos-
phorylated by SenS
c
P in a transphosphorylation reaction, and sub-
sequently separated from it by Ni
2+
–nitrilotriacetic acid affinity
chromatography. Purified SenRP( 82 pmol) was incubated at

30 °C alone (top) or with (bottom) 148 pmol of dephosphorylated
SenS for the indicated times. Each reaction was stopped by adding
an equal amount of 4 · sample buffer, and the products were
analyzed by SDS ⁄ PAGE. Gels were dried and exposed on an X-ray-
sensitive film. (B) Dried gels were further analyzed using a Phos-
phorImager. The diagram shows the quantified results representing
the measured radioactivity at the indicated times (j) with SenRP
alone or for the mixture (r) of SenRP and SenS
c
.
Fig. 3. Phosphotransfer from SenS
c
to SenR, SenRD60A or Sen-
RD65A. (A, B) Purified SenS
c
(184 pmol) was incubated with
0.05 lCi of [
32
P]ATP[cP] for self-phosphorylation. After 4 min, equal
amounts of purified SenR were added and incubated for the indica-
ted period at 30 °C. The reactions were terminated by adding
4 · sample buffer. After SDS ⁄ PAGE, the gel was dried and
exposed on an X-ray-sensitive film (A) or quantified by detection of
the radioactivity emitted by SenRP(j) or SenS
c
P(r) using a
PhosphorImager (B). (C) The wild-type SenR or SenR mutant pro-
teins (SenRD60A or SenRD65A), in each case 330 pmol of protein,
were mixed with 260 pmol of SenS
c

P in transphosphorylation
buffer for 1 min at 30 °C. Reactions were terminated with 4 · sam-
ple buffer, subjected to SDS ⁄ PAGE, and stained with Coomassie
Brilliant Blue (left), or alternatively the gel was dried and exposed
on an X-ray-sensitive film (right).
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3903
transcripts (furS–cpeB and hbpS) and the correspond-
ing proteins [16]. For further analyses, different DNA
fragments (Fig. 5A) corresponding to the upstream
region (310 bp, named up-furS1) of the furS–cpeB
operon or the upstream region (548 bp, named
up-hbpS1) located between hbpS and senS were ampli-
fied by PCR. Electrophoretic mobility shift assays
(EMSAs) were performed with labeled DNA
(5200 pmol of up-furS1 or 2900 pmol of up-hbpS1) and
increasing quantities (0–16 pmol) of the purified SenR
or SenRP. Interestingly, in contrast to SenRP,
SenR interacted with up-furS1 (Fig. 5B). The addition
of 12 pmol of SenR to the reaction mixture led to an
 84% decrease of free up-furS1, whereas the same
amount of SenR P provoked only a  10% reduction
(Fig. 5D). The presence of small quantities (4 and
8 pmol) of SenR led to one type of retarded DNA spe-
cies (Fig. 5B, arrow b); an additional one was formed
if the protein concentration (12 and 16 pmol) was
increased (Fig. 5B, arrow a). These data suggested the
presence of multiple SenR-binding sites. The specificity
of this interaction was verified by competition using
constant amounts of SenR and additional increasing

amounts of unlabeled up-furS1 (Fig. 5B, third box
Fig. 5. Gene organization and EMSAs with isolated SenR proteins. (A) The gene organization of furS–cpeB, hbpS, senS and senR is indica-
ted. The labeled DNA regions are marked in gray. (B, C) The upstream region of the furS–cpeB operon (5200 pmol of up-furS1) (B) or the
intergenic region between hbpS and senS (2900 pmol of up-hbpS1) (C) was incubated without or with increasing amounts (0, 4, 8, 12 or
16 pmol; black triangle) of SenR or SenRP in incubation buffer (see Experimental procedures). For competition experiments, labeled up-
furS1 (5200 pmol) was incubated with constant amounts (16 pmol) of SenR and increasing amounts of unlabeled up-furS1 (0, 5200, 7800,
10 400 or 13 000 pmol; open triangle) (B, third box from left). In the same manner, unlabeled up-hbpS1 (0, 2900, 4350, 5800 or 7250 pmol;
open triangle) was added to the mixture comprising labeled up-hbpS1 (2900 pmol) and constant amounts (16 pmol) of SenR (C, third box
from left). For further corroboration of the binding specificity, SenR (0–16 pmol; black triangle) was incubated with the upstream region of
cpeB (up-cpeB, 5500 pmol) (B, fourth box from left). After incubation at 30 °C for 15 min, the mixtures were separated on 5% polyacryla-
mide gels, and then subjected to autoradiography. The retarded DNA fragments are indicated (a, b, c and d). The control DNA in mixtures
without SenR is everywhere marked as lane 0. (D) In addition, gels were dried and analyzed by a PhosphorImager System. The radioactivity
level of the DNA probe alone was set at 100%. The reaction products up-furS1 + SenR (j), up-furS1 + SenRP(h), up-hbpS1 + SenR (r),
and up-hbpS1 + SenRP(e) as well as the quantities of SenR used are indicated.
Response regulator SenR G. Bogel et al.
3904 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
from left). Furthermore, SenR was not found to inter-
act with the upstream region (up-cpeB) of the cpeB
gene (Fig. 5B, fourth box from left).
EMSAs (also known as bandshift assays) with up-
hbpS1 and varying amounts (0–16 pmol) of SenR or
SenRP showed that the DNA-binding affinity was
enhanced after phosphorylation (Fig. 5C). This was
indicated by the observation that SenR (4 pmol) led to
a  63% decrease in free up-hbpS1, whereas the same
amount of SenRP (4 pmol) enhanced it to  94%
(Fig. 5D). Interestingly, SenR induced the formation of
two shifted species (Fig. 5C, arrows c and d), suggesting
the existence of at least two binding sites within up-
hbpS1. One of them (marked as d) was only observed

in the presence of small quantities (4 pmol) of SenR
but not with SenRP. Further EMSAs using different
quantities of proteins showed that, to obtain a 50%
decrease in free up-hbpS1, at least three times as much
SenR as SenRP was required (Table 1). Competition
studies using constant amounts of SenR and increasing
amounts of unlabeled up-hbpS verified the specificity of
the SenR–up-hbpS1 interaction (Fig. 5C, third box
from left). Taken together, these data revealed that
SenR binds specifically to up-furS1 and up-hbpS1, and
the phosphorylation of SenR by SenSP substantially
alters its DNA-binding characteristics.
Further bandshift assays using different amounts of
purified SenR proteins demonstrated that each of the
SenR mutant proteins (SenRD60A and SenRD65A)
has reduced binding affinity for up-furS1 and up-hbpS1
(Table 1).
Identification of the SenR-binding sites
To identify the exact DNA-binding site(s) within
up-furS1 and up-hbpS1, DNaseI footprinting experi-
ments with the purified RRs SenR and SenRP, after
their phosphorylation in the presence of ATP by
SenS
c
, were performed. Footprinting experiments with
radioactively labeled up-furS1 showed that SenR pro-
tected a region spanning 9 bp (I, AACTTGGGG)
against DNaseI cleavage (Fig. 6A, left). In addition, a
short region (marked by a white block) upstream of
region I was protected, implicating probable binding

sites (as observed by bandshift experiments), or a
change in DNA topology being induced after interac-
tion with SenR. Increasing amounts of SenR neither
extended nor altered the extent of the protection.
SenRP had no affinity for this DNA region, even at
high concentrations (up to 60 pmol) (Fig. 6A, right).
A truncated up-furS1 fragment ( 100 bp, named up-
furS2) comprising site I (I, Fig. 7A) still interacted
with SenR, as shown by bandshift assays (Fig. 7B).
Studies with this fragment having a deleted site I (DI)
(Fig. 7A) showed that it was targeted neither by SenR
nor by SenRP (Fig. 7B). The specificity of the SenR–
up-furS2 interaction was further corroborated by com-
petition using constant amounts of SenR and increas-
ing amounts of unlabeled up-furS2 DI (Fig. 7D).
Table 1. Relative binding affinity of wild-type and mutated SenR
proteins for
32
P-labeled DNA-fragments. EMSAs were done (as
described in Experimental procedures) using increasing (0–
100 pmol) amounts of the mentioned proteins and analysis was
done with a PhosphorImager. The indicated amount (in pmol) of
each protein is required to obtain a 50% decrease of the intensity
of free DNA (up-furS1 or up-hbpS1). For this purpose, the radio-
activity level of the sample without protein was set at 100%. The
experiments were repeated four times; the obtained data were
reproducible.
Dephosphorylated protein
Phosphorylated
protein

SenR SenRD60A SenRD65A SenR SenRD60A
up-furS1 6.2 > 41 11.1 34.6 > 41
up-hbpS1 3.7 10.7 7.0 1.2 2.5
AB
Fig. 6. Footprinting studies. (A) up-furS1 (6900 pmol) and (B)
up-hbpS1 (5800 pmol) were incubated without SenR or SenRP, or
with increasing amounts (20.5, 41 and 61.5 pmol) of SenR or
SenRPin10m
M Tris ⁄ HCl (pH 7.9), 5 lgÆmL
)1
sonicated salmon
sperm DNA, 5% glycerol, 40 m
M KCl, 2 mM MgCl
2
and 2 mM
dithiothreitol. After treatment with DNaseI, analyses were per-
formed with 6% polyacrylamide-urea gels, and autoradiography.
The protected DNA regions (I, II and III) are indicated by black
blocks. The additional protected region within up-furS1 is indicated
by a small, open rectangle.
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3905
DNaseI protection assays using the amplified inter-
genic region between hbpS and senS (up-hbpS1)
revealed two SenR-binding sites (II and III) spanning
21 bp (II: ACCTCCAGTAGAGCCTGGGCT) and
19 bp (III: GGACCGGGCCGCGTCCCGT) (Fig. 6B).
Site II is located near to the start codon of hbpS, and
site III is relatively distant from it. After incubation
with SenRP, the ends of both sites became hyper-

sensitive to DNaseI treatment. This was accompanied
by an apparent extension of region II as well as of
A
B
C
D
Fig. 7. EMSAs with mutated DNA regions up-furS and up-hbpS. (A) Portions of the DNA fragments (up-furS2 or up-hbpS2, see below) con-
taining the complete (I, II, III and II + III; underlined) or deleted (DI, DII, DIII and DII + DIII; dotted lines) binding motifs, or the complete (PIII,
marked by >>> <<<) or deleted (DPIII, dotted lines) perfect inverted repeat overlapping the binding site III are shown. (B) The  100 bp
upstream region of the furS–cpeB operon (up-furS2) (14 200 pmol) and the corresponding mutated region (up-furS2 DI) (14 200 pmol) were
incubated without or with increasing amounts (8, 16 and 24 pmol; black triangle) of SenR (left) or SenRP (right) in incubation buffer at
30 °C for 15 min. (C) The intergenic region ( 100 bp) between hbpS and senS (up-hbpS2) (9400 pmol) and the mutated counterparts (up-
hbpS2 DII; DIII; DPIII; DII + DIII) (9400 pmol) were incubated without or with increasing amounts (8, 16 and 24 pmol; black triangle) of SenR
(top) or SenRP (bottom), in incubation buffer. (D) For competition experiments, labeled up-furS2 (14 200 pmol) was incubated with con-
stant amounts (24 pmol) of SenR and increasing amounts of unlabeled up-furS2 D I (0, 14200, 21300 or 28400 pmol; open triangle) (left). In
the same manner, unlabeled up-hbpS2 D II + DIII (0, 9400, 14 100 or 18 800 pmol; open triangle) was added to the mixture comprising labe-
led up-hbpS2 (9400 pmol) and constant amounts (24 pmol) of SenR (right). The control DNA in the mixture without SenR is (B, C, D) marked
as lane 0. The analyses were performed with 5% polyacrylamide gels, and autoradiography.
Response regulator SenR G. Bogel et al.
3906 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
region III (Fig. 6B). Further bandshift assays showed
that the shortened up-hbpS1 fragment ( 100 bp,
named up-hbpS2) containing both motifs (II + III,
Fig. 7A) was still targeted by SenR and SenRP
(Fig. 7C). The up-hbpS2 fragment lacking the perfect
inverted repeat (DPIII; Fig. 7A) interacts only slightly
with SenRP (Fig. 7C). Analyses with fragments with
either site II (DIII or site III (DIII) or both (DII +
DIII) deleted revealed that both binding sites are
required for interaction with SenR, independent of its

phosphorylation status (Fig. 7C). The specificity of the
SenR–up-hbpS2 interaction was further corroborated
by competition using constant amounts of SenR and
increasing amounts of unlabeled up-hbpS2 DII + DIII
(Fig. 7D).
Taken together, these data confirm the specificity of
the SenR-binding sites and corroborate the assumption
that phosphorylation of SenR by SenSP alters its
DNA-binding characteristics.
Discussion
The designed cloning procedures allowed us to obtain
the cytoplasmic domain of SenS carrying a Strep-tag
(SenS
c
) and the full-length SenR protein with a His-
tag (SenR) at high purity as a basis for in vitro studies.
SenS
c
was found to function as an efficient autokinase.
Chemical stability assays revealed that the ligand
within the phosphorylated SenS
c
(SenS
c
P) must be a
phosphoamidate, which is extremely acid-labile but rel-
atively base-stable. This feature discriminates all phos-
phorylated amino acid residues (except arginine) from
phosphoamidates [18]. Additional mutational investi-
gations demonstrated that SenS

c
requires the histidine
residue at position 199 for autokinase activity. The
in vitro transfer of the phosphate group from SenS
c
to
SenR (dephosphorylated SenR) occurred very rapidly,
but did not occur in a designed mutant SenR protein
carrying a substitution of the aspartic acid residue at
position 65 (D65). The kinase SenS
c
was found to act
additionally as a phosphatase for SenRP (phosphor-
ylated SenR).
Bandshifts revealed that SenR, but not SenRP,
binds specifically to a region (site I) upstream of the
furS–cpeB operon encoding the redox regulator FurS
and the catalase-peroxidase CpeB. The deletion of
site I abolishes the interaction with SenR. Interestingly,
this site is located within the previously determined
FurS operator [19] and overlaps with its central region.
The data imply that, in addition to FurS, SenR partici-
pates in regulating the transcription of the furS–cpeB
operon. This conclusion is supported by the earlier
finding that the absence of a functional furS or senR
gene provokes enhanced transcription of the furS–cpeB
operon [16,20]. Overlapping DNA-binding sites have
also been described for other known regulators.
Depending on the physiologic condition, either the
activator NhaR or the RR RcsB from E. coli interacts

with overlapping motifs within the upstream region of
osmC. This gene encodes a predicted envelope protein
that is required for resistance to organic peroxides and
also for long-term survival in the stationary phase
[21,22]. The regulator PutR and the activator CRP
from Vibrio vulnificus bind simultaneously to overlap-
ping sites but probably to opposite faces. This process
leads to activation of the transcription of the operon
encoding a proline dehydrogenase and a proline perm-
ease [23]. PutR has been suggested to facilitate the
DNA binding of CRP by direct protein–protein inter-
action or to induce a change in DNA topology that
allows more efficient recruitment of CRP.
Comparative transcriptional and biochemical studies
have revealed that SenS–SenR modulates the transcrip-
tion of the furS–cpeB operon as well as the hbpS gene
encoding a novel heme-binding protein. Interestingly,
SenR has a high affinity for the intergenic region
between hbpS and senS, spanning 21 bp (site II) and
19 bp (site III). Both became hypersensitive to DNaseI
treatment at their ends after incubation with SenRP,
indicating altered DNA topology. The phosphorylated
form of RRs has been shown to provoke
oligomerization and to bind cooperatively to target
DNA sequences [24,25]. Altered DNA binding upon
phosphorylation was observed, for example, for the
RR RegR of the RegS–RegR system from Bradyrhizo-
bium japonicum, controlling the expression of numerous
genes, the products of which are either directly involved
in nitrogen fixation or in functions associated with the

microaerobic lifestyle of this symbiont [26]. A corres-
ponding observation was also made for MisR of the
TCS MisR–MisS from Neisseria meningitides, which is
required for its pathogenicity [24], and for NtrC of the
NtrB–NtrC system, which controls the expression of
genes involved in nitrogen metabolism in Rhodobacter
capsulatus [27].
The two SenR-binding sites II and III share a com-
mon motif CNTCCNGT in the same orientation.
Additionally, binding site III is localized within a
region (CGGCCCGGACCGGGCCG) representing a
perfect inverted repeat (Fig. 7). The use of DNA frag-
ments lacking either binding site II, binding site III or
both showed that each of them is necessary for speci-
fic targeting by SenR. Further single replacements
within each binding site (I, II or III) may reveal the
essential role of single nucleotides in the specific inter-
action with SenR. The position of the SenR operator
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3907
(sites II and III) indicates that the transcription of
senS–senR is autoregulated. As reported previously
[16], SenS–SenR shows similarity to the ChrS–ChrA
system from Corynebacterium diphtheriae. ChrA has
so far not been purified, but it has been predicted to
modulate the transcription of the heme oxygenase
gene (hmuO) [28,29]. On the basis of our data, we
identified a DNA region upstream of hmuO with high
similarity to SenR-binding site II and an additional
shared sequence (GGGCGTCGG) near to its 3¢-end

(data not shown). This is in accordance with the fact
that the helix–turn–helix DNA-binding domains of
SenR and ChrA share 61% amino acid identity (data
not shown).
The designed SenRD60 and SenRD65A proteins
showed reduced DNA-binding affinity for up-furS as
well as for up-hbpS. D60 and D65, together with other
aspartic acid residues (in positions 19 and 20), in SenR
correspond to those that have been predicted to form
an acidic pocket within RRs containing a CheY-like
receiver domain [30]. Mutations at any of the acidic
pocket aspartates result in loss of functionality [31].
SDS ⁄ PAGE analysis of purified SenR proteins
revealed that SenRD60A appeared to be partially
degraded and aggregated (Fig. 1). Both SenRD60A
and SenRD65A seem to be perturbed in their confor-
mation and hence show altered DNA-binding abilities.
Our previous data revealed that the presence of
SenS–SenR considerably enhances the resistance of
S. reticuli to hemin or the redox cycling compound
plumbagin, suggesting its relevance in sensing of redox
changes [16]. Further preliminary comparative analysis
(data not shown) revealed that under different redox-
stress conditions, the presence of SenS–SenR is
required for the production of additional extracellular
proteins, whose characteristics remain to be clarified.
One key part of the sensing processes is expected to be
orchestrated by the heme-binding protein HbpS [17].
How it participates in delivering signals to SenS will
be explored.

Sequence comparisons showed that the relative
organization of senS and senR is identical to those of
homologous genes within the S. coelicolor A3(2) gen-
ome [32]; these genes are also preceded by an
uncharacterized gene that is closely related to hbpS
[16]. Further sequence alignments revealed the presence
of other predicted TCSs showing high amino acid
identity with SenS–SenR within Rhodococcus sp.
RHA1 [33] and Arthrobacter aurescens TC1 [34]. Inter-
estingly, each of the corresponding homologous genes
is also preceded by a close homolog of hbpS, the
organization of which is identical to that within the
S. reticuli genome. The fact that each corresponding
intergenic region comprises motifs that are related to
the SenR-binding sites (II and III) (data not shown)
indicates that these homologous systems are also auto-
regulated. According to these findings, it could be
assumed that HbpS and SenS–SenR, and probably
also the corresponding homologs from the other men-
tioned actinobacteria, interact together to mediate an
appropriate response to environmental changes. Such a
mode of interaction has been recently postulated for
the lipoprotein LpqB and the TCS MtrA–MtrB, which
together might form an actinobacterial three-compo-
nent system [35]. The elucidation of the exact role of
accessory proteins for the modulation of bacterial
TCSs might give new insights into the complex net-
work of signaling processes.
Taking the presented and previous data into
account, the TCS SenS–SenR from S. reticuli is a

model that is well suited to elucidate the role of other
related TCSs from different actinobacteria.
Experimental procedures
Bacterial strains, plasmids, media and culture
conditions
The plasmid pUC18 [36] was a gift from J Messing (State
University of New Jersey, Piscataway, NJ, USA). The
E. coli strains DH5a [37], BL21(DE3)pLys (Novagen,
Darmstadt, Germany) and XL1-Blue [38], and the plasmids
pET21a (Novagen) and pASK-IBA7 (IBA, Go
¨
ttingen,
Germany), were used for routine cloning purposes. The
constructs pUKS10 (pUC18 derivative) and pWKB1
(pWHM3 derivative), which contain the furS–cpeB operon,
have been described previously [16,20]. E. coli strains were
grown in LB medium at 37 °C [36].
Chemicals and enzymes
Chemicals for SDS ⁄ PAGE were obtained from Serva (Hei-
delberg, Germany). Molecular weight markers were sup-
plied by Sigma (Steinheim, Germany). Restriction enzymes,
T4 ligase, T4 polynucleotide kinase, DNaseI and Pfu DNA
polymerase for PCR were obtained from New England Bio-
labs (Frankfurt am Main, Germany), Roche (Mannheim,
Germany), or Promega (Mannheim, Germany).
Isolation of DNA and transformations
Plasmids were isolated from E. coli with the aid of a mini
plasmid kit (Qiagen, Hilden, Germany). E. coli DH5a and
XL1-Blue were transformed with plasmid DNA by electro-
poration [39], whereas BL21(DE3)pLys was transformed

with the CaCl
2
method as previously described [36].
Response regulator SenR G. Bogel et al.
3908 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
PCR, DNA sequencing and computer analysis
PCR was performed with Pfu DNA polymerase. To test
the correctness of cloned genes, sequencing was done using
the Ready Reaction mix and ABI PRISM equipment (PE
Biosystems, Foster City, CA, USA) by the departmental
sequence service (U Coja, FB Biologie, University of
Osnabrueck). For DNaseI footprinting studies, sequencing
was done using the AutoRead Sequencing Kit (Amersham
Biosciences, Freiburg, Germany); however, radioactively
labeled primers corresponded to those utilized for the
EMSAs (see below). Sequence entry, primary analysis and
ORF searches were performed using clone manager 5.0.
Database searches using the PAM120 scoring matrix were
carried out with blast algorithms (blastx, blastp and
tblastn) on the NCBI file server [40]. Multiple sequence
alignments were generated by means of the clustalw
(1.74) program [41].
Site-directed mutagenesis within senS and senR
A point mutation in the senS gene on plasmid pQS1 [16]
was introduced using the QuikChange Site-Directed Muta-
genesis kit (Stratagene, Amsterdam, The Netherlands) with
the following specific primers: H199A1, 5¢-CCCGGGAGA
TC
GCCGACACCCTCGC-3¢; and H199A2, 5¢-GCGAGG
GTGTC

GGCGATCTCCCGGG-3¢. These oligonucleotides
were designed to replace the selected histidine codon at posi-
tion 199 (H199) with an alanine codon (underlined). The
constructs were transformed into E. coli XL1-Blue. Subse-
quently, each of the cloned inserts in the plasmid DNA, iso-
lated from several individual transformants, was analyzed
with restriction enzymes and by sequencing. The resulting
correct plasmid was named pQS1H199A.
For introducing specific mutations in the senR gene, a dif-
ferent strategy was used. First, the subconstruct pUR1 was
created by ligation of the longer SphI–BamHI fragment of
pUC18 with the 1.8 kb SphI–BamHI fragment (containing
senR) of pWKB1. The plasmid pUR1 was then used for
PCRs and further ligation. The desired PCR products were
obtained using the forward primer R1NSph (5¢-CAGCGC
ATGCTGCTCCAGGCAGCCGAC-3¢), and one of the
reverse primers R1D65Pst (5¢-CGAGCTGCAG
GGCCAT
CAGGACGACGTC-3¢) or R1D60Pst (5¢-CGAGCTGCAG
GTCCATCAGGACGAC
GGCCGGGGCGGTCTTGC-3¢).
The PstI restriction site is in bold type within R1D60Pst
and R1D65Pst, and the codon for alanine replacing the ori-
ginal codon (GTC) for aspartic acid is underlined; the SphI
restriction site within R1NSph is in bold type. The cleaved
PCR product resulted in a 0.76 kb DNA fragment contain-
ing a part of the mutagenized senR gene (D60A or D65A).
Each of these was then ligated with the large Sph I–Pst I frag-
ment (3.75 kb) of plasmid pUR1. The resulting constructs
(isolated from E. coli DH5a transformants) were named

pUR1D60A or pUR1D65A, respectively. The correctness of
the in-frame replacement was controlled by restriction and
sequencing.
Cloning of genes in E. coli
The DNA region (from the nucleotide at position 505 to that
at position 1197 of senS) encoding the cytoplasmic part
(comprising the segment from the aspartic acid at
position 169 to the arginine at position 398) of SenS was
amplified by PCR with the following primers: SenS3, 5¢-
CTAGAATTCGACGACCTGGTC-3¢, harboring an EcoRI
restriction site (in bold type), and SenS4, 5¢-GATCTGCAG
TCATCTCGGCTC-3¢, containing the PstI restriction site
(in bold type). The plasmids pWKB1 [16] and pQS1H199A
were used as DNA templates. Each PCR product was diges-
ted with EcoRI and PstI and ligated with EcoRI–Pst I-
digested pASK-IBA7. The resulting construct pASKS2 or
pASKS2H199A was transformed into E. coli XL1-Blue,
recovered, and sequenced. Transformants containing the cor-
rect constructs and producing the designed fusion protein
with Strep-tag codons (SenS
c
or SenS
c
H199A) were selected.
The senR-coding region of plasmid pWKB1, pUR1D60A
or pUR1D65A was amplified by PCR with following prim-
ers: SenR1, 5¢-CCCATATGACCCCCACCCCGCAGCCG
CC-3¢, consisting of an NdeI restriction site (in bold type),
followed by the sequence encoding the N-terminal amino
acids of SenR, and SenR2, 5¢-CGCGCTCGAGAGACAGG

AGGCGTTGTTC-3¢, determining the C-terminal amino
acids of SenR, followed by the XhoI restriction site (in bold
type). The PCR products were digested with NdeI and XhoI,
ligated with the NdeI–XhoI-cleaved pET21a, and sub-
sequently transformed into E. coli XL1-Blue. Having
sequenced several of the resulting plasmids pETR1, pET-
R1D60A or pETR1D65A, we verified the correctness of the
senR gene and the in-frame fusion with the His-tag codons.
Purification of the fusion proteins
An E. coli XL1-Blue transformant containing the pASKS2
or pASKS2H199A plasmid was inoculated in LB medium
with ampicillin (100 lgÆmL
)1
) and cultivated at 37 °C. The
synthesis of the SenS
c
or the SenS
c
H199A fusion protein
was induced (at a D
600
of 0.6) by adding anhydrotetracycline
(200 ngÆmL
)1
). The cells were grown for 4 h, harvested,
washed with buffer W (100 mm Tris ⁄ HCl, pH 8.0, 150 mm
NaCl, 1 mm EDTA), and disrupted in the same buffer W by
ultrasonication (10 · 10 s, with 10 s intervals) using a Bran-
son sonifier (Danbury, CT, USA). The fusion protein was
purified directly from a cleared cell lysate using streptactin

affinity chromatography according to the instructions of the
manufacturer (IBA).
Plasmid pETR1, pETR1D60A or pETR1D65A was
transformed into E. coli BL21(DE3)pLys. A selected trans-
formant containing the desired plasmid was inoculated
in LB medium containing ampicillin (100 lgÆmL
)1
) and
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3909
chloramphenicol (34 lgÆmL
)1
)at37°C. The synthesis of
the protein was induced (at a D
600
of 0.6) by adding 1 mm
isopropyl thio-b-d-galactoside for 4 h. The collected cells
were washed and resuspended in chilled buffer A (10 mm
Hepes, 60 mm KCl, pH 8.0). The extracts were subse-
quently sonicated and clarified by centrifugation at
16 000 g for 30 min (Avanti J-25 centrifuge; Beckman
Coulter, Palo Alto, CA, USA). The supernatant containing
soluble proteins and additional 25 mm imidazole was mixed
with Ni
2+
–nitrilotriacetic acid agarose (Qiagen) on a wheel
at 4 °C for up to 3 h. The agarose column containing
bound proteins was washed with solution A supplemented
with 25 mm imidazole. His-tagged proteins were released
with the same solution in the presence of 250 mm imidaz-

ole. The protein concentration of the samples was deter-
mined by a previously established method [42]. The quality
of the proteins was analyzed by electrophoresis in 12.5%
SDS ⁄ PAGE gels according to the method of Laemmli [43].
MS
The N-terminal amino acids and internal peptides within
SenS
c
were determined by LC-MS (Bruker Daltonics,
Karlsruhe, Germany) analysis. For this purpose, the puri-
fied protein was first separated by SDS ⁄ PAGE. After stain-
ing (with Coomassie Brilliant Blue), the SenS
c
-containing
band was excised. The gel piece was subsequently cleaned,
dehydrated, dried, and digested with trypsin (modified,
sequencing grade from Roche) following standard proce-
dures [44,45].
In vitro phosphorylation assays
For the autokinase reaction, the SenS
c
protein was incubated
in phosphorylation buffer (P-buffer), which contained
50 mm Tris ⁄ HCl (pH 7.5), 10% glycerol, 20 mm MgCl
2
,1m
NaCl, 2 mm dithiothreitol, 1 mm ATP, and 0.05 lCi of
[
32
P]ATP[cP] (Amersham Biosciences). The reaction mixture

was incubated at 30 °C for different time intervals, and the
reaction was terminated by the addition of 4 · SDS ⁄ PAGE
loading buffer. To test the transphosphorylation reaction,
autophosphorylated SenS
c
(SenS
c
P) was incubated with
equimolar amounts of SenR-His-tag (SenR) without labeled
ATP in P-buffer. The reaction mixture was incubated at
30 °C for different time intervals. Samples were resolved by
12.5% SDS ⁄ PAGE. After drying of the gels, products were
visualized by autoradiography and quantified by a Phos-
phorImager with imagequant 5.0 software. Alternatively,
the phosphorylation of SenR by acetylphosphate was tested.
Therefore,
32
P-labeled acetylphosphate was generated by
incubation of acetate kinase with acetate (60 mm KOAc) and
[
32
P]ATP[cP] in 25 mm Tris ⁄ HCl (pH 7.5) and 10 mm MgCl
2
for 30 min at 25 °C or as a control without acetate kinase.
SenR and P-buffer were added, and the mixture was incuba-
ted at 30 °C for different time intervals. Samples were
resolved by SDS ⁄ PAGE, and after drying, the gels were
analyzed by autoradiography.
In vitro dephosphorylation assays
Purified SenR was first transphosphorylated by SenS

c
to
SenRP as described above. Then, the complete kinase
reaction mixture was loaded onto an Ni
2+
–nitrilotriacetic
acid agarose column and subjected to affinity chromatogra-
phy. Thus, His-tagged SenRP was separated from SenS
c
with a Strep-tag. The freshly purified SenRP was incubated
alone or with equal amounts of SenS
c
in the dephosphoryla-
tion buffer (50 mm Tris ⁄ HCl, pH 7.5, 10% glycerol, 100 mm
MgCl
2
,2mm dithiothreitol and 50 mm KCl) at 30 °C
for different time intervals. Proteins within each sample were
separated by 12.5% SDS ⁄ PAGE. After drying of the gels,
labeled proteins were visualized by autoradiography, and
quantified by a PhosphorImager with imagequant 5.0 soft-
ware.
Chemical stability assays
To detect a phosphohistidine [46],
32
P-labeled SenS
c
(three
individual samples) was fractionated by 12.5% SDS ⁄
PAGE. One sample was then treated for 30 min at room

temperature with 1 m NaOH, the second with 1 m
Tris ⁄ HCl (pH 7.5), and the third with 1 m HCl. Subse-
quently, the gels were dried and exposed to an X-ray film.
DNA and oligonucleotide labeling
PCR fragments and oligonucleotides were labeled at the
5¢-end, using T4 polynucleotide kinase and [
32
P]ATP[cP].
EMSAs
The upstream region of the furS–cpeB operon was ampli-
fied from plasmid pWKB1 using primers F1 (5¢-GTCCGG
GGCCACATGATGCG-3¢) and F2c (5¢-GCGACGCGAG
CTGCCGTCACG-3¢). The intergenic region between hbpS
and senS (cloned within the plasmid pWKB1) was obtained
by PCR with primers S1 (5¢-CGACGACACCGGCACC
GA-3¢) and S2c (5¢-CGGGGCCAGGACGACGAGCA-3¢).
Each of the fragments was end-labeled with [
32
P]ATP[cP]
using T4 polynucleotide kinase. An aliquot of the labeled
fragment was incubated in DNA-binding buffer (10 mm
Tris ⁄ HCl, pH 7.9, 5 lgÆmL
)1
sonicated salmon sperm
DNA, 5% glycerol, 40 mm KCl, 1 mm MgCl
2
and 2 mm
dithiothreitol) with varying quantities of SenR or SenRP
at 30 °C for 15 min. Bandshifts were analyzed by subse-
quent electrophoresis on a 5% polyacrylamide gel. Gels

were run at 100 V for 3 h, and dried, and products were
visualized by autoradiography and quantified by a Phos-
phorImager with imagequant 5.0 software.
Response regulator SenR G. Bogel et al.
3910 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
To determine whether SenR had already been in a phos-
phorylated form within E. coli, the obtained protein was
incubated with SenS
c
in dephosphorylation buffer and separ-
ated by Ni
2+
–nitrilotriacetic acid affinity chromatography.
Subsequently, EMSAs were performed; these revealed that
both (treated and untreated with SenS
c
) SenR types possess
identical binding activities (data not shown).
DNaseI footprinting studies
Using the labeled primers F1 and F2c, or S1 and S2c, and
the plasmid pUKS10, labeled fragments corresponding to
the upstream region of furS–cpeB or the intergenic region
between hbpS and senS were generated by PCR. Each
DNA sample was incubated for 15 min at 30 °C in buffer
(as used for bandshift assays, but containing 2 mm MgCl
2
)
with varying quantities of SenR or SenRP. Each sample
was then treated with 20 mU of DNaseI at room tempera-
ture for 40–120 s, and the reaction was terminated by add-

ing EDTA (final concentration 5 mm). The product was
precipitated with 2.5 volumes of ethanol in the presence of
sodium acetate (final concentration 300 mm), and subse-
quently washed with 75% ethanol. The pellet was suspen-
ded in 1 lLofH
2
O and 4 lL of formamide-containing
sequencing buffer, and applied to a 6% polyacryl-
amide ⁄ urea gel.
Mutagenesis of SenR-binding sites
The identified (by footprinting) SenR-binding sites (I, II
and III) or the region representing a perfect inverted repeat
overlapping binding site III (PIII) (Fig. 7A) were deleted by
insertion of a restriction site (EcoRI) using overlapping
primers (Table 2) and the pUKS10 plasmid [19] as template
for PCR. For this purpose, the different generated PCR
fragments (A–I) were first amplified and then cleaved with
EcoRI. Restricted fragments A and B (to delete site I), C
and D (to delete site II), E and F (to delete site III), G and
H (to delete the perfect inverted repeat) and I and F (to
delete simultaneously sites II and III) were ligated to each
other. The resulting DNA fragments ( 450 bp) were
cleaved with HindIII and PstI, and ligated with the longer
HindIII–PstI fragment of the plasmid pUC18. Each of the
resulting constructs was transformed in E. coli DH5a by
electroporation. The correctness of the expected mutations
(Fig. 7A) was confirmed by restriction analysis and sequen-
cing.
To test the consequences of the deleted sites for SenR
binding, EMSAs were done. For this purpose, a  100 bp

fragment (containing or lacking binding site I) upstream of
furS (up-furS2) was amplified from each of the correspond-
ing plasmids, using primers P1 (5¢-GAGGTGTACGGCG
GGTGACGACAG-3¢) and P1rev (5¢-GTGGTCGGTGT
CGGGGAGGCGG-3¢). A second  100 bp fragment (con-
taining or lacking binding sites II or III or the inverted
repeat PIII) upstream of hbpS (up-hbpS2) was amplified
from the corresponding plasmids with primers P2 (5¢-GAG
GACGCGGGTACGGCGGGACGG-3¢) and P2rev (5¢-CG
GGGTCATCCGATCGGATGACCC-3¢). Fragments were
end-labeled with [
32
P]ATP[cP] using T4 polynucleotide kin-
ase as a prerequisite for binding studies with SenR or
SenRP.
Table 2. List of primers used to obtain mutated SenR-binding sites.
Fragment
Primer
name Primer sequence (5¢-to3¢; restriction sites in bold type)
A IHinfor CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS)
IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I)
B IEcofor GTTGAATTCTCGTGTTTATGAGGG (located upstream of furS and beginning at the 3¢-end of binding site I)
IPstrev GGAGCTGCAGCCCACGCGATCGCG (located downstream of the start codon of furS)
C IIHinfor GGTAAGCTTCTCCAGGGTCAGATG (located upstream of hbpS)
IIEcorev GCCGAATTCTCCTCAGCATGTCCAG (located upstream of hbpS and ending at the 5¢-end of binding site II)
D IIEcofor CGAGAATTCGGGGGCGTCGGTCGC (located upstream of hbpS and beginning at the 3¢-end of binding site II)
IIPstrev CACCTGCAGGGCGCGCGGGTGTCGTC (located downstream of the start codon of hbpS)
E IIHinfo For sequence and characteristics, see above
IIIEcorev GCGGAATTCGGGCCGAGGATCGG (located upstream of hbpS and ending at the 5¢-end of binding site III)
F IIIEcofor GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding site III)

IIPstrev For sequence and characteristics, see above
G IIHinfor For sequence and characteristics, see above
REcorev GACGGAATTCAGGATCGGTTCCGG (located upstream of hbpS and ending at the 5
¢-end of the inverted repeat)
H REcofor GCTCGAATTCCGTCCCGTCGCCGG (located upstream of hbpS and beginning at the 3¢-end of the inverted repeat)
IIPstrev For sequence and characteristics, see above
I IIHinfor For sequence and characteristics, see above
II ⁄ IIIEcorev GGGAATTCGGGCCGAGGATCGGTTCCGGGAGCGACCGACGCCCCCTCCTCAGCATGTCC
(located upstream of hbpS and ending at the 5¢ -end of binding site III, and containing a deleted binding site II)
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3911
Acknowledgements
We are very grateful to Dr Stefan Walter (in our
group) for analyzing the correctness of SenS
c
peptides
by LC-MS. G. Bogel and the running costs were
financed in part by funds to H. Schrempf and in part
from a grant from the Deutsche Forschungsgemeinsc-
haft to D. Ortiz de Orue
´
Lucana.
References
1 Hoch JA & Varughese KI (2001) Keeping signals
straight in phosphorelay signal transduction. J Bacteriol
183, 4941–4949.
2 Mascher T, Helmann JD & Unden G (2006) Stimulus
perception in bacterial signal-transducing histidine kin-
ases. Microbiol Mol Biol Rev 70, 910–938.
3 Pao GM, Saier MH Jr (1995) Response regulators of

bacterial signal transduction systems: selective domain
shuffling during evolution. J Mol Evol 40, 136–156.
4 Zapf J, Sen U, Madhusudan Hoch JA & Varughese KI
(2000) A transient interaction between two phosphore-
lay proteins trapped in a crystal lattice reveals the mech-
anism of molecular recognition and phosphotransfer in
signal transduction. Structure 15, 851–862.
5 Hastings CA, Lee SY, Cho HS, Yan D, Kustu S &
Wemmer DE (2003) High-resolution structure of the
beryllofluoride-activated NtrC receiver domain. Bio-
chemistry 42, 9081–9090.
6 Yoshida T, Cai S & Inouye M (2002) Interaction of
EnvZ, a sensory histidine kinase, with phosphorylated
OmpR, the cognate response regulator. Mol Microbiol
46, 1283–1294.
7 Flardh K (2003) Growth polarity and cell division in
Streptomyces. Curr Opin Microbiol 6, 564–571.
8 Alm E, Huang K & Arkin A (2006) The evolution of
two-component systems in bacteria reveals different
strategies for niche adaptation. PLoS Comput Biol 2,
e143, doi: 10.1371/journal.pcbi.0020143.
9 Hutchings MI, Hoskisson PA, Chandra G & Buttner
MJ (2004) Sensing and responding to diverse extracellu-
lar signals? Analysis of the sensor kinases and response
regulators of Streptomyces coelicolor A3(2). Microbio-
logy 150, 2795–2806.
10 Brian P, Riggle PJ, Santos RA & Champness WC
(1996) Global negative regulation of Streptomyces coeli-
color antibiotic synthesis mediated by an absA-encoded
putative signal transduction system. J Bacteriol 178,

3221–3231.
11 Sheeler NL, MacMillan SV & Nodwell JR (2005)
Bio\chemical activities of the absA two component sys-
tem of Streptomyces coelicolor. J Bacteriol 187, 687–696.
12 Hong HJ, Hutchings MI, Neu JM, Wright GD, Paget
MS & Buttner MJ (2004) Characterization of an indu-
cible vancomycin resistance system in Streptomyces
coelicolor reveals a novel gene (vanK) required for drug
resistance. Mol Microbiol 52, 1107–1121.
13 Hutchings MI, Hong HJ & Buttner MJ (2006) The
vancomycin resistance VanRS two-component signal
transduction system of Streptomyces coelicolor. Mol
Microbiol 59, 923–935.
14 Sola-Landa A, Moura RS & Martı
´
n JF (2003) The two-
component PhoR–PhoP system controls both primary
metabolism and secondary metabolite biosynthesis in
Streptomyces lividans. Proc Natl Acad Sci USA 100,
6133–6138.
15 Sola-Landa A, Rodrı
´
guez-Garcı
´
a A, Franco-Domı
´
nguez
E & Martı
´
n JF (2005) Binding of PhoP to promoters of

phosphate-regulated genes in Streptomyces coelicolor:
identification of PHO boxes. Mol Microbiol 56, 1373–
1385.
16 Ortiz de Orue
´
Lucana D, Zou P, Nierhaus M & Schr-
empf H (2005) Identification of a novel two-component
system SenS ⁄ SenR modulating the production of the
catalase-peroxidase CpeB and the haem-binding protein
HbpS in Streptomyces reticuli. Microbiology 151, 3603–
3614.
17 Ortiz de Orue
´
Lucana D, Schaa T & Schrempf H (2004)
The novel extracellular Streptomyces reticuli haem-
binding protein HbpS influences the production of
the catalase-peroxidase CpeB. Microbiology 150, 2575–
2585.
18 Klumpp S & Krieglstein J (2002) Phosphorylation and
dephosphorylation of histidine residues in proteins. Eur
J Biochem 269, 1067–1071.
19 Ortiz de Orue
´
Lucana D & Schrempf H (2000) The
DNA-binding characteristics of the Streptomyces reticuli
regulator FurS depend on the redox state of its cysteine
residues. Mol Gen Genet 264, 341–353.
20 Zou P, Borovok I, Ortiz de Orue
´
Lucana D, Mu

¨
ller D
& Schrempf H (1999) The mycelium-associated Strep-
tomyces reticuli catalase-peroxidase, its gene and regula-
tion by FurS. Microbiology 145, 549–559.
21 Sturny R, Cam K, Gutierrez C & Conter A (2003)
NhaR and RcsB independently regulate the osmCp1
promoter of Escherichia coli at overlapping regulatory
sites. J Bacteriol 185, 4298–4304.
22 Conter A, Gangneux C, Suzanne M & Gutierrez C
(2001) Survival of Escherichia coli during long-
term starvation: effects of aeration, NaCl, and the
rpoS and osmC gene products. Res Microbiol 152,
17–26.
23 Lee JH & Choi SH (2006) Coactivation of Vibrio vulnifi-
cus putAP operon by cAMP receptor protein and PutR
through cooperative binding to overlapping sites. Mol
Microbiol 60, 512–524.
24 Tzeng YL, Zhou X, Bao S, Zhao S, Noble C &
Stephens DS (2006) Autoregulation of the MisR ⁄ MisS
two-component signal transduction system in Neisseria
meningitidis. J Bacteriol 188, 5055–5065.
Response regulator SenR G. Bogel et al.
3912 FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS
25 Gusa AA, Gao J, Stringer V, Churchward G & Scott
JR (2006) Phosphorylation of the group A Streptococcal
CovR response regulator causes dimerization and
promoter-specific recruitment by RNA polymerase.
J Bacteriol 188, 4620–4626.
26 Emmerich R, Panglungtshan K, Strehler P, Hennecke H

& Fischer HM (1999) Phosphorylation, dephosphoryla-
tion and DNA-binding of the Bradyrhizobium japonicum
RegSR two-component regulatory proteins. Eur J Bio-
chem 263, 455–463.
27 Masepohl B, Kaiser B, Isakovic N, Richard CL, Kranz
RG & Klipp W (2001) Urea utilization in the phototroph-
ic bacterium Rhodobacter capsulatus is regulated by the
transcriptional activator NtrC. J Bacteriol 183, 637–643.
28 Schmitt MP (1999) Identification of a two-component
signal transduction system from Corynebacterium diph-
theriae that activates gene expression in response to the
presence of heme and hemoglobin. J Bacteriol 181,
5330–5340.
29 Bibb LA, King ND, Kunkle CA & Schmitt MP (2005)
Analysis of a heme-dependent signal transduction sys-
tem in Corynebacterium diphtheriae: deletion of the
chrAS genes results in heme sensitivity and diminished
heme-dependent activation of the hmuO promoter.
Infect Immun 73, 7406–7412.
30 Baikalov I, Schroder I, Kaczor-Grzeskowiak M, Grzes-
kowiak K, Gunsalus RP & Dickerson RE (1996) Struc-
ture of the Escherichia coli response regulator NarL.
Biochemistry 35, 11053–11061.
31 Bourret RB, Hess JF & Simon MI (1990) Conserved
aspartate residues and phosphorylation in signal trans-
duction by the chemotaxis protein CheY. Proc Natl
Acad Sci USA 87, 41–45.
32 Bentley SD, Chater KF, Cerdeno-Tarraga AM, Challis
GL, Thomson NR, James KD, Harris DE, Quail MA,
Kieser H, Harper D et al. (2002) Complete genome

sequence of the model actinomycete Streptomyces coeli-
color A3(2). Nature 417, 141–147.
33 McLeod MP, Warren RL, Hsiao WW, Araki N, Myhre
M, Fernandes C, Miyazawa D, Wong W, Lillquist AL,
Wnag D et al. (2006) The complete genome of Rhodococ-
cus sp. RHA1 provides insights into a catabolic power-
house. Proc Natl Acad Sci USA 103, 15582–15587.
34 Mongodin EF, Shapir N, Daugherty SC, Deboy RT,
Emerson JB, Shvartzbeyn A, Radune D, Vamathevan J,
Riggs F, Grinberg V et al. (2006) Secrets of soil survival
revealed by the genome sequence of Arthrobacter
aurescens TC1. PLoS Comput Biol 2, e214, doi: 10.1371/
journal.pgen.0020214.
35 Hoskisson PA & Hutchings MI (2006) MtrAB-LpqB: a
conserved three-component system in actinobacteria?
Trends Microbiol 14, 444–449.
36 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring.
Harbor Laboratory Press, Cold Spring Harbor, NY.
37 Villarejo M, Zamenhof PJ & Zabin I (1972) Beta-galac-
tosidase. In vivo-complementation.
J Biol Chem 247,
2212–2216.
38 Loenen WA & Blattner FR (1983) Lambda Charon vec-
tors (Ch32, 33, 34 and 35) adapted for DNA cloning in
recombination-deficient hosts. Gene 26, 171–179.
39 Dower WJ, Miller JF & Rgasdale CW (1988) High effi-
ciency transformation of Escherichia coli by high voltage
electroporation. Nucleic Acids Res 16, 6127–6145.
40 Altschul SF, Madden TL, Scha

¨
ffer AA, Zhang J, Zhang
Z, Miller W & Lipmann DJ (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25, 3389–3402.
41 Thompson JD, Higgins DG & Gibson TJ (1994) CLU-
STAL W: improving the sensitivity of progressive mul-
tiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice.
Nucleic Acids Res 22, 4673–4680.
42 Bradford MM (1976) A rapid and sensitive method for
the quantification of microgram quantities of protein
utilizing the principle of protein-dye binding. Anal
Biochem 72, 248–254.
43 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
44 Liu Y, Graham C, Li A, Fisher J & Shaw S (2002)
Phosphorylation of the protein kinase C-theta activation
loop and hydrophobic motif regulates its kinase activity,
but only activation loop phophorylation is critical to
in vivo nuclear-factor-jB induction. Biochem J 361,
255–265.
45 Wilm M, Shevchenko A, Houthaeve T, Breit S,
Schweigerer L, Fotsis T & Mann M (1996) Femtomole
sequencing of proteins from polyacrylamide gels by
nano-electrospray mass spectrometry. Nature 379,
466–469.
46 Kamps MP (1991) Determination of phosphoamino
acid composition by acid hydrolysis of protein blotted

to Immobilon. Methods Enzymol 201, 21–27.
G. Bogel et al. Response regulator SenR
FEBS Journal 274 (2007) 3900–3913 ª 2007 The Authors Journal compilation ª 2007 FEBS 3913