Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

DmGEN shows a flap endonuclease activity, cleaving
the blocked-flap structure and model replication fork
Yoshihiro Kanai, Gen Ishikawa, Ryo Takeuchi, Tatsushi Ruike, Ryo-ichi Nakamura, Ayumi Ihara,
Tetsuyuki Ohashi, Kei-ichi Takata, Seisuke Kimura and Kengo Sakaguchi
Department of Applied Biological Science, Tokyo University of Science, Chiba, Japan
DNA replication, recombination and repair are key
processes in maintaining genome integrity. Nucleases
are necessary for their nucleolytic activities. They act on
a variety of structural frameworks, ranging from site-
specific (e.g. AP endonuclease) to structure-specific (e.g.
RAD2 ⁄ XPG nuclease family) and nonspecific (e.g.
DNase I) nucleases. In particular, members of the
RAD2 ⁄ XPG nuclease family have unique nuclease
activities and play critical roles in genome stability [1–6].
In a preliminary report, we described the presence of a
new nuclease, Drosophila melanogaster XPG-like endo-
nuclease (DmGEN) which belongs to the RAD2 ⁄ XPG
nuclease family, shows unique activity and possibly
plays a critical role in genome stability [7]. The ORF of
the DmGEN gene encoded a predicted protein of 726
amino acid residues with a molecular mass of 82.5 kDa.
The gene was located at 64C9 on the left arm of
Drosophila polytene chromosome 3 as a single site.
The RAD2 ⁄ XPG family of nucleases, which have
two conserved nuclease domains (the N domain and
the I domain), are currently separated into three clas-
ses (XPG ⁄ class I, FEN-1 ⁄ class II and EXO-1 ⁄ class III)
based on the types of nuclease activity and sequence
homology [8,9]. In Drosophila, mus201 protein (class I),
FEN-1 homologue protein (class II), and Tosca
protein (class III) have been reported as RAD2 family

proteins. The DmGEN protein showed a relatively
high degree of sequence homology with RAD2 nuc-
leases, particularly XPG, although the locations of the
N and I domains were similar to those of FEN-1 and
EXO-1, and the molecular mass of DmGEN was
found to be close to that of EXO-1. Therefore, we pro-
posed a new class (class IV) to categorize DmGEN and
SEND-1, which we also found in higher plants [8].
Recently, a new member of the class IV nucleases,
OsGEN-like, has been reported in rice; RNA-mediated
Keywords
active-site mutant; DmGEN; novel flap
endonuclease; nuclease activity; site-
directed mutagenesis
Correspondence
K. Sakaguchi, Department of Applied
Biological Science, Faculty of Science and
Technology, Tokyo University of Science,
2641 Yamazaki, Noda-shi, Chiba-ken
278-8510, Japan
Fax: +81 4 7123 9767
Tel. +81 4 7124 1501 (Ex. 3409)
E-mail:
(Received 5 April 2007, revised 24 May
2007, accepted 7 June 2007)
doi:10.1111/j.1742-4658.2007.05924.x
Drosophila melanogaster XPG-like endonuclease (DmGEN) is a new cate-
gory of nuclease belonging to the RAD2 ⁄ XPG family. The DmGEN pro-
tein has two nuclease domains (N and I domains) similar to XPG ⁄ class I
nucleases; however, unlike class I nucleases, in DmGEN these two nuclease

domains are positioned close to each other as in FEN-1 ⁄ class II and EXO-1 ⁄
class III nucleases. To confirm the properties of DmGEN, we characterized
the active-site mutant protein (E143A E145A) and found that DmGEN
had flap endonuclease activity. DmGEN possessed weak nick-dependent
5¢)3¢ exonuclease activity. Unlike XPG, DmGEN could not incise the bub-
ble structure. Interestingly, based on characterization of flap endonuclease
activity, DmGEN preferred the blocked-flap structure as a substrate. This
feature is distinctly different from FEN-1. Furthermore, DmGEN cleaved
the lagging strand of the model replication fork. Immunostaining revealed
that DmGEN was present in the nucleus of actively proliferating Dro-
sophila embryos. Thus, our studies revealed that DmGEN belongs to a
new class (class IV) of the RAD2 ⁄ XPG nuclease family. The biochemical
properties of DmGEN and its possible role are also discussed.
Abbreviations
BF, blocked flap; DmGEN, Drosophila melanogaster XPG-like endonuclease; dsDNS, double stranded DNA; RF, replication fork; ssDNA,
single-stranded DNA.
3914 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
silencing of the OsGEN-like caused male sterility due
to a defect in microspore development [9]. Although
DmGEN homologues are found widely in mammals
and higher plants [7,9], knowledge about their bio-
chemical properties is limited. In this study, we deter-
mined the biochemical properties of native and an
active-site mutant DmGEN to more deeply understand
the nature of this new class of nucleases.
As for the biochemical features, class I consists of
XPG homologues, which cleave at the 3¢ side of the
bubble structure formed during nucleotide excision
repair [10,11]. Class II comprises the FEN-1 homo-
logues, which show 5¢-flap endonuclease, 5¢)3¢ exon-

uclease and gap endonuclease activities, and play
important roles in RNA primer removal, base excision
repair and apoptotic DNA fragmentation [12–14]. Clas-
s III is made up of the EXO-1 homologues, which have
5¢)3¢ exonuclease activity and are involved in DNA
recombination, mismatch repair and DNA replication
[15–18]. The function for class IV, however, remains
unclear. In relation to the studies, we must correct
some mistakes in our previous study. We reported pre-
viously that DmGEN has not only 3¢)5¢- and nick- and
gap-dependent 5¢-3¢ exonuclease activities, but also
endonuclease activity at a site 3 or 4 bp from the 5¢-end
[7]. However, such activities were not found when
DmGEN was purified more carefully, although nick-
dependent 5¢-3¢ exonuclease activity was present. Thus,
it is important to re-characterize this novel enzyme.
Here, we report that the DmGEN protein is a new
flap endonuclease, which is different in nature from
FEN-1. Based on our studies we have confirmed that
DmGEN belongs to a new class of the RAD2 ⁄ XPG
family. In addition, we have characterized the bio-
chemical properties of DmGEN.
Results
Design of substrates
All DNA substrates were designed as shown in Fig. 1,
and were assembled using the oligonucleotides des-
cribed in Table 1.
Comparison of the nuclease domain
of the RAD2/XPG family
The RAD2 ⁄ XPG family of proteins have two con-

served nuclease domains (N and I domains), and these
are essential for nuclease activity and substrate specif-
icity. DmGEN also has these conserved nuclease
domains. The N and I domains of DmGEN were
similar to those of XPG ⁄ class I (Fig. 2A,B). The
N domain of DmGEN showed 35.1, 25.0 and 10.9%
homology (% identity) with the N domains of
HsXPG, HsFEN-1 and HsEXO-1, respectively. The I
domain of DmGEN showed 44.2, 38.5 and 38.5%
homology (% identity) with the I domains of HsXPG,
HsFEN-1 and HsEXO-1, respectively. The spacer
region between the N and I domains is not required
for nuclease activity, but contributes to substrate spe-
cificity [19]. The spacer region of DmGEN is very
short, similar to that of FEN-1 ⁄ class II and EXO-1 ⁄
class III, but not XPG⁄ class I (Fig. 2A). Therefore,
DmGEN cannot be categorized into class I, II, or III.
Like other members of the RAD2 ⁄ XPG family,
DmGEN also contains several acidic residues coordi-
nating two Mg
2+
at the active center for catalysis; one
of these, which is an aspartic acid residue in other
members of the RAD2 ⁄ XPG family, is a glutamic acid
residue in DmGEN (Fig. 2B, asterisk 1). In addition
to the nuclease domains, the X-ray crystal structures
Fig. 1. The three categories of DNA substrates used in this study.
Names shown (A, B, C, A-Flap, etc.) correspond to the oligonucleo-
tides summarized in Table 1.
Y. Kanai et al. Flap endonuclease activity in DmGEN

FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3915
of the archaeal FEN-1 homologues have assisted in
the identification of critical structural elements (helical
clamp, H3TH motif and several loop regions) for sub-
strate binding [14]. Recently, Qui et al. [20] identified
18 positively charged amino acids that are important
in the FEN)1–DNA interaction. DmGEN contains a
number of positively charged residues; however, most
of the positively charged amino acid residues forming
the DNA-biding domain of HsFEN-1 are not con-
served in DmGEN (Fig. 2C, Table 2).
Expression, purification and characterization
of DmGEN
DmGEN was expressed in Escherichia coli, tagged
with six His residues at the N-terminus. DmGEN
expression in E. coli was increased dramatically over
the previously reported amount [7] by using the
pCold I expression vector carrying the cold-shock
promoter and inducing overexpression of DmGEN at
15 °C. The recombinant protein was sequentially puri-
fied by chromatography using a Ni-NTA resin col-
umn, SP Sepharose beads, and then fractionated on a
Superdex-200 gel-filtration column. In the gel-filtra-
tion column, the protein (expected molecular mass
 82.5 kDa) migrated between the expected molecular
mass markers 75 and 100 kDa (Fig. 3A). Gel-filtra-
tion chromatography was crucial to completely purify
the protein.
Next, to characterize DmGEN nuclease activity
more precisely, we constructed an active-site double

mutant (E143A E145A) of DmGEN as described in
Experimental procedures. As shown in Fig. 2B, these
active-site residues (asterisks 2 and 3 in Fig. 2B) are
highly conserved in the I domain of the RAD2 ⁄ XPG
family, and are important in coordinating divalent
metal ions to interact with an incoming nucleotide
[21]. We previously reported that DmGEN has both
5¢)3¢ and 3¢)5¢ exonuclease activity and endonuclease
activity at a site 3 or 4 bp from the 5¢-end in double-
stranded DNA (dsDNA) [7]. The mutants were used
to confirm these activities.
We analyzed the nuclease activities of wild-type and
E143A E145A double-mutant DmGEN. Wild-type
DmGEN did not show any detectable 3¢)5¢ exonuc-
lease and endonuclease activities towards either single-
stranded DNA (ssDNA) or dsDNA (Fig. 3D). These
results differed from our previous report [7]. The previ-
ously reported nuclease activities of DmGEN [7] may
have resulted from other contaminating nucleases.
Indeed, when we checked other fractions from the gel-
filtration column, we found these activities in a frac-
tion obtained from the shoulder area of the elution
profile. In our previous study, we were not able to use
gel-filtration for purification because of the low yield
of DmGEN.
Subsequently, on further careful characterization, we
found that purified wild-type DmGEN shows flap
endonuclease activity, and the E143A E145A double
mutant lacks such activity (Fig. 3B). Thus, DmGEN
cleaves the flap structure substrate at the junction

between the ssDNA and dsDNA, and subsequently
generates a product of 20 nucleotides. This activity of
DmGEN was confirmed using 3¢-end-labeled flap sub-
strate (Fig. 3C). As shown, the 3¢-end-labeled 30-nuc-
leotide flap substrate was cleaved by wild-type
DmGEN, but not by mutant DmGEN. Neither wild-
type nor mutant DmGEN cleaved a 30-nucleotide
ssDNA substrate or blunt-ended dsDNA substrate
(Fig. 3D).
Table 1. Oligonucleotides used to construct various DNA sub-
strates shown in Fig. 1.
Oligo
name Sequences (5¢-to3¢)
A GGCTGCAGGTCGAC
B CAGCAACGCAAGCTTG
C GTCGACCTGCAGCCCAAGCTTGCGTTGCTG
A-flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTC
GAC
B-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCT
AGCA
B-g1 CAGCAACGCAAGCTT
B-g2 CAGCAACGCAAGCT
B-g4 CAGCAACGCAAG
A-b15 AGAGATTTTCCACAT
A-b17 CTAGAGATTTTCCACAT
A-b19 TGCTAGAGATTTTCCACAT
D TGACAAGGATGGCTGGTGGGACTTAGCGTA
E TACGCTAAGTCCCACCAGCCATCCTTGTCA
F CCAGTGATCACATACGCTTTGCTAGGACATT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAG

TGCCACGTTGTATGCCCACGTTGACCG
G CGGTCAACGTGGGCATACAACGTGGCACTGT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTAT
GTCCTAGCAAAGCGTATGTGATCACTGG
X1 GACGCTGCCGAATTCTGGCTTGCTAGGACAT
CTTTGCCCACGTTGACCCG
X2 CGGGTCAACGTGGGCAAAGATGTCCTAGCAA
TGTAATCGTCTATGACGTC
X3 GACGTCATAGACGATTACATTGCTAGGACA
TGCTGTCTAGAGACTATCGC
X4 GCGATAGTCTCTAGACAGCATGTCCTAGCAA
GCCAGAATTCGGCAGCGTC
X1half GGACATCTTTGCCCACGTTGACCCG
X1half-g4 ATCTTTGCCCACGTTGACCCG
X1half-g8 TTGCCCACGTTGACCCG
X4half GCGATAGTCTCTAGACAGCATGTCC
Flap endonuclease activity in DmGEN Y. Kanai et al.
3916 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
A
BC
Fig. 2. Comparison of the amino acid sequences of the RAD2 ⁄ XPG family. (A) Schematic representation of the conserved N and I domains
of some members of the RAD2 ⁄ XPG family. The total number of amino acids in each protein and homology (% identity) between DmGEN
and other members are indicated. (B) The conserved sequences encompassing the nuclease active site are aligned. Asterisk 1 indicates the
nonconserved aspartic residue of DmGEN. Asterisks 2 and 3 indicate the active residues of DmGEN substituted by site-directed mutagen-
esis. (C) Comparison of positively charged amino acid residues essential for the FEN)1–DNA interaction with those of DmGEN. In total, 18
amino acid residues are compared in gray boxes.
Y. Kanai et al. Flap endonuclease activity in DmGEN
FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3917
Ability of DmGEN to cleave other structures
To analyze the substrate specificity of DmGEN, we

examined various test substrates, which were expected
to be cleaved by the nuclease. These are shown schemat-
ically in Fig. 1. First, we tested whether DmGEN pos-
sesses nick- or gap-dependent 5¢)3¢ exonuclease activity,
and produced gapped and nicked double-stranded sub-
strates as reported previously [7]. As shown in Fig. 4A,
DmGEN exhibited weak nick-dependent 5¢)3¢ exonuc-
lease activity, but showed little or no gap-dependent
5¢)3¢ exonuclease activity. We confirmed that DmGEN
cut only one nucleotide from the 3¢-end-labeled nicked
substrate (Fig. 4B). Because we had to use a large
amount of DmGEN to cleave the nicked substrate, the
cleaving rate of the nick-dependent 5¢)3¢ exonuclease
activity of DmGEN is obviously lower than the flap
endonuclease activity. Next, we tested whether DmGEN
would cleave the bubble-like and the Holliday junction
substrates, which are known to exist in vivo. Although
XPG (class I nuclease) incised the target strand 3¢ to
the bubble-like and damage-containing structures [10],
DmGEN was unable to cleave the bubble-like structure
substrate (Fig. 4C, left). Nor was the Holliday junction
substrate cleaved by DmGEN (Fig. 4C, right).
Biochemical properties of DmGEN
To characterize the difference between the flap endo-
nuclease activity of DmGEN and that of FEN-1
(class II), optimal reaction conditions for DmGEN
were first determined using the flap structure substrate
(Fig. 5). (Details of the reaction conditions are given
in the legend to Fig. 5.) The optimal pH for DmGEN
flap activity was 8, which was same as for FEN-1

(class II). DmGEN required divalent metal ions (such
as Mg
2+
and Mn
2+
), and the concentration of Mg
2+
or Mn
2+
ions required for optimal flap activity was
5mm. However, the cleavage product of DmGEN in
the presence of 5 mm Mn
2+
was only 43.3% that in
the presence of 5 mm Mg
2+
.Ca
2+
and Zn
2+
could
not substitute for Mg
2+
or Mn
2+
. DmGEN nuclease
activity was highest in reaction mixtures containing
25 mm KCl, and further increasing the concentration
of KCl inhibited the activity. These biochemical prop-
erties of DmGEN differed from data reported previ-

ously [7]. The requirement for divalent metal ions and
low ionic strength for DmGEN optimal activity were
like those of EXO-1 (class III). The above-described
biochemical properties of DmGEN differed from those
of other members (class I, II, and III) of the
RAD2 ⁄ XPG family.
Effect of DmGEN on the various flap structures
To determine the flap nuclease activity of DmGEN,
we tested the action of DmGEN on several derivatives
of the flap structure substrates. We prepared pseudo
Y, gapped-flap, blocked-flap, double-flap and 3¢-flap
substrates, as shown in Fig. 1. In agreement with pre-
vious studies [14,22], FEN-1 cleaved the flap, pseu-
do Y, gapped-flap, blocked-flap and double-flap
structure substrates (Fig. 6). Previously, it was repor-
ted that the blocked-flap substrate was hardly cleaved
by the flap endonuclease activity of FEN-1 [23]. How-
ever, according to a recent report, the blocked-flap was
cleaved by the gap endonuclease activity of FEN-1
[14]. Unlike FEN-1, DmGEN did not cleave the pseu-
do Y, gapped-flap and 3¢-flap, but did cleave the
blocked-flap and double-flap structures. In contrast to
FEN-1, DmGEN preferred the blocked-flap structure
substrate (Fig. 6).
DmGEN cleaves blocked-flap structures
and model replication fork substrates
To characterize DmGEN nuclease activity on the
blocked-flap structure, we prepared blocked-flap struc-
ture substrates with various sizes of oligonucleotides
Table 2. Conservation of essential positively charged amino acid

residue.
HsFEN-1 DmGEN Conserved Functional motif Binding site
R47 D43 N Substrate-binding
loops
Upstream
R70 R58 Y Substrate-binding
loops
Upstream
K93 K81 Y Helical clamp 5¢ flap
R104 Q92 N Helical clamp 5¢ flap
K125 K114 Y Helical clamp 5¢ flap
K128 S117 N Helical clamp 5¢ flap
K129 R118 N Helical clamp 5¢ flap
K132 H121 N Helical clamp 5¢ flap
R192 R177 Y Substrate-binding
loops
Upstream
K200 A190 N Substrate-binding
loops
Upstream
K201 G191 N Substrate-binding
loops
Upstream
K244 D235 N H3TH motif Downstream
R245 G236 N H3TH motif Downstream
K252 K243 Y H3TH motif Downstream
K254 K245 Y H3TH motif Downstream
K267 G258 N Substrate-binding
loops
Downstream

R327 E317 N Substrate-binding
loops
Upstream
K326 L318 N Substrate-binding
loops
Upstream
Flap endonuclease activity in DmGEN Y. Kanai et al.
3918 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
bound to the 5¢-tail of the single-stranded flap. The
sizes of the blocking oligonucleotides in the blocked-
flap (BF) substrates – BF1, BF2 and BF3 – were 15,
17 and 19 bp, respectively (Fig. 7A). The single-stran-
ded region of the BF structure was 19 bp, and the gap
sizes of the blocked strand of BF1, BF2 and BF3 were
4, 2 and 0 nucleotides, respectively. In agreement
with a previous study [24], the cleavage efficiency of
HsFEN-1 decreased with the narrower gapped
substrate (Fig. 7A). FEN-1 cleaved the blocked-flap
substrate at much slower rate than the free flap struc-
ture substrate. However, DmGEN cleaved both BF1
AB
CD
Fig. 3. Flap endnuclease activity of purified
wild-type and mutant recombinant DmGEN
(labeled as GEN). (A) Silver-stained gel
showing the molecular mass markers and
290 ng of purified DmGEN and DmGEN
(E143A E145A). Proteins were separated by
electrophoresis on a 10% SDS-polyacryla-
mide gel. (B) Flap endonuclease activity at

different concentrations of DmGEN. 5¢-End-
labeled flap structure substrate (25 n
M) was
incubated with different amounts of
DmGEN (24, 48, 96 and 192 n
M) or DmGEN
E143A E145A double mutant (24, 48, 96
and 192 n
M)at37°C for 90 min in a 20 lL
reaction volume. (C) 3¢-End-labeled flap
structure substrate (25 n
M) was incubated
with DmGEN (24 and 48 n
M) or DmGEN
E143A E145A double mutant (96 n
M)at
37 °C for 90 min in a 20 lL reaction volume.
(D) ssDNA and dsDNA substrate (25 n
M)
was incubated with DmGEN (192 n
M)or
DmGEN E143A E145A double mutant
(192 n
M)at37°C for 60 min in a 20 lL
reaction volume. Asterisk indicates the posi-
tion of the radiolabel. Substrate and clea-
vage product sizes were as indicated.
Electrophoresis was carried out on 10%
polyacrylamide ⁄ 7
M urea gels. The amounts

of nuclease products were calculated with
the aid of an image analyzer (
IMAGE J 1.36b,
National Institutes of Health).
Y. Kanai et al. Flap endonuclease activity in DmGEN
FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3919
and BF2 to a similar extent as the nonblocked flap
substrate (Fig. 7B). There was also some cleavage of
BF3, the blocked-flap substrate without gap (Fig. 7B).
Because the free 5¢ ssDNA end of the flap is important
for FEN-1 cleavage efficiency [14,23,24], we also exam-
ined flap endonuclease activity on the hairpinned-flap
structure with no free 5¢-end. We prepared the hair-
pinned-flap structure substrates with the same sequence
as the blocked-flap substrate (Table S1). In agreement
with a previous study [24], the cleavage efficiency of
HsFEN-1 on the hairpinned-flap substrates decreased
considerably with the narrower gapped substrate
(Fig. S1A). However, DmGEN cleaved hairpinned-
flap, although the activity was weaker than on the free
flap substrate (Fig. S1B).
Because DmGEN cleaved the blocked-flap structure,
we examined whether DmGEN cleaves model repli-
cation fork (RF) substrates. Model replication fork
substrates, in which the junction branch migrates,
were made as shown in Fig. 7C. We prepared four
derivatives (RF1–RF4) of the model replication fork.
RF1 resembles the replication fork that lacks the pro-
gressing lagging strand. RF2, RF3 and RF4 are the
forms of the normal replication fork differing in the

gap sizes of the lagging strand. The gaps in the RF2,
RF3 and RF4 are 8, 4 and 0 bp, respectively. As
shown in Fig. 7C, DmGEN cleaved the lagging strand
of the model normal replication forks with gaps (RF2
and RF3) to the similar extent as the RF1. However,
DmGEN poorly cleaved RF4, the substrate without
any gap both at the lagging strand and the leading
strand (Fig. 7C).
Localization of DmGEN in Drosophila embryos
To confirm the relationship between DmGEN and
DNA replication in vivo, immunostaining of
Drosophila embryos was performed. In Drosophila,
the embryonic stages were separated into 17 steps [25].
The first 13 nuclear divisions occurred in stage 1–4
embryos (0:00–2:10 h embryos). The first seven rounds
take place within the interior of the embryo, the
majority of nuclei then migrate to the cortex during
cycles 8 and 9, leaving behind a small number of yolk
nuclei [26]. Polyclonal anti-DmGEN serum used for
the immunocytochemical study reacted specifically with
the DmGEN protein (expected molecular mass
82.5 kDa) in a crude extract of 0–3 h Drosophila
embryos (Fig. 8, left). As a result of immunostaining,
DmGEN was localized in the nucleus throughout the
13 nuclear division cycles. The nuclear localization of
DmGEN was seen in the interior of the embryo at the
A
B
C
Fig. 4. (A) Nuclease activity of DmGEN pro-

tein (192 n
M) on the 5¢-end-labeled nicked
and gapped substrates (25 n
M). The reaction
condition is described in Experimental pro-
cedures. Time-course experiments were
performed. Substrates are depicted sche-
matically in each panel. The asterisk
indicates the position of the radiolabel.
Substrate and cleavage product sizes were
as indicated. (B) Nuclease activity of
DmGEN protein (192 n
M) on the 3¢-end-labe-
led nicked substrates (25 n
M). Time-course
experiments were performed. (C) Nuclease
activity of DmGEN (192 n
M) on bubble and
Holliday junction structure substrates (5 and
25 n
M, respectively). Incubation was carried
out at 37 °C for 60 min in a 20 lL reaction
volume. Substrates are depicted schemati-
cally in each panel. Asterisk indicates the
position of the radiolabel. Substrate sizes
were as indicated. (A,B) Electrophoresis car-
ried out on 20% polyacrylamide ⁄ 8
M urea
gels. (C) Electrophoresis carried out on 10%
polyacrylamide ⁄ 7

M urea gels. wt: DmGEN
wild-type; mut: DmGEN E143A E145A
double mutant.
Flap endonuclease activity in DmGEN Y. Kanai et al.
3920 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
stage 2 (Fig. 8A–C, right). However, nuclear localiza-
tion of DmGEN was observed in a wide range of
embryo at the stage 3 (Fig. 8D–F, right).
Discussion
The purpose of this study was to precisely characterize
a newly found member (class IV) of the RAD2 ⁄ XPG
family of nucleases, DmGEN, from Drosophila melano-
gaster. The biochemical properties of class IV nucleas-
es are largely unknown in various animals and plants.
For this purpose, we created an active-site mutant,
and used this mutant to confirm the biochemical prop-
erties of DmGEN. We purified wild-type and mutant
DmGEN protein using an improved purification pro-
tocol, and analyzed the nuclease activities of the puri-
fied proteins. Thus, we showed that DmGEN was a
new type of flap endonuclease.
Fig. 5. Biochemical properties of the DmGEN protein. Purified DmGEN (39 nM) was incubated with 5¢-end-labeled flap structure substrate
(25 n
M)at37°C for 90 min in a 20 lL reaction volume. To test the effect of divalent metal ions, the reaction was carried out in 1 mM dithio-
threitol, 10% glycerol, 50 m
M Tris (pH 8) supplemented with 50 mM KCl and various concentrations of a given divalent metal ion, as indica-
ted in the figure. To test the effect of salt, the reaction was carried out in 5 m
M MgCl
2
,1mM dithiothreitol, 10% glycerol and 50 mM Tris

(pH 8) and a given concentration of KCl, as indicated in the figure. To test the effect of pH, the reaction was carried out in 5 m
M MgCl
2
,
1m
M dithiothreitol, 50 mM KCl, 10% glycerol and 50 mM Tris (pH 6.5–9.5). Following the reaction, products were resolved on 20% polyacryl-
amide ⁄ 8
M urea gels and quantified using the IMAGE J 1.36b image analyzer.
Y. Kanai et al. Flap endonuclease activity in DmGEN
FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3921
The amino acid sequence of DmGEN protein has
three principal features (Fig. 2). First, one of the acidic
residues at the active center for catalysis was not con-
served in DmGEN (Fig. 2B, asterisk 1). Regarding this
nonconserved aspartic acid residue, Constantinou et al .
[27] reported that the D77E active-site mutant of XPG
protein showed considerably lower nuclease activity
than wild-type XPG protein. Second, most of the posi-
tively charged amino acids residues, which are essential
for binding FEN-1 to DNA [14,20], were not con-
served in DmGEN protein (Fig. 2C, Table 2). These
two features contribute to the low nuclease activity of
DmGEN. Lastly, DmGEN shows high homology
between the N and I regions and XPG (class I), but
the spacing of these regions is similar to in FEN-1 and
EXO-1 (class I and III, respectively). We confirmed
how this feature contributes the nuclease activity of
DmGEN (class IV). DmGEN had a flap endonuclease
activity, like FEN-1, but was not able to cleave the
bubble structure, unlike XPG (Figs 3, 4). Because

DmGEN had no 5¢)3¢ exonuclease activity on the
dsDNA substrate (Fig. 3D), DmGEN is distinctly dif-
ferent from EXO-1 (class III). Recently, it was sugges-
ted that the activity of the RAD2 ⁄ XPG nuclease
family is determined by the properties and positions of
the two nuclease domains [19,28]. The adjacent posi-
tion of the two domains may be responsible for not
cleaving the bubble structure (Fig. 4C), because a
XPG mutant with a deletion in the spacer region was
shown to prefer the pseudo Y structure to the bubble
structure [19].
The flap endonuclease activity of DmGEN is more
accurate and weaker than that of FEN-1 (class II nuc-
lease). For example, FEN-1 cleaves many DNA struc-
tures such as 5¢-single-strand overhang including flap,
pseudo Y, gapped-flap and 5¢-overhang double-strand
[14]. In contrast, as shown Fig. 6, DmGEN cleaves the
normal flap substrate and a special flap structure: the
blocked-flap substrate in which the 5¢-single-strand
overhang of the flap is double-stranded; DmGEN
cleaves just at the ssDNA ⁄ dsDNA junction point. We
found very little cleavage of gapped-flap and pseudo Y
substrates by DmGEN. Therefore, the DNA structure
at the junction seems to be important for DmGEN-
mediated cleavage. Unlike pseudo Y and gapped-flap,
DmGEN preferred a substrate in which the
5¢-upstream of the flap is completely double-stranded.
This idea is supported by the fact that DmGEN
cleaved the double-flap substrate (Fig. 6). The interest-
ing feature of DmGEN is that this nuclease cleaves the

blocked-flap structure, and this activity is slightly
stronger than the normal flap structure cleaving activ-
ity, a feature that is distinctly different from that of
FEN-1. In agreement with the previous report [24], we
also found that the activity of FEN-1 decreases consid-
erably when the flap substrate is double-stranded
(Fig. 7A). On the hairpinned-flap substrates having no
free 5¢-end, the nuclease activity of both FEN-1
and DmGEN are weaker than that on the normal flap
substrate (Fig. S1). Because FEN-1 prefers a free
5¢ ssDNA end of flap [14,23,24], the nuclease activity
on the hairpinned-flap substrate is weak, like for the
blocked-flap substrate [24]. Therefore, in contrast to
FEN-1, DmGEN prefers a free 5¢-end of flap, which is
either single- or double-stranded, this is deduced from
the fact that DmGEN preferred the blocked-flap struc-
ture, but not the hairpinned-flap structure. These
results suggest that binding of the substrate to
DmGEN might differ from that of FEN-1. This is also
suggested by the fact that most of the positively
charged amino acids residues, which are essential for
binding of FEN-1 to DNA [14], were not conserved in
the DmGEN protein (Fig. 2C).
The most interesting activity of DmGEN is that it
cleaves the blocked-flap structure and the hairpinned-
flap structure substrate (Fig. 7B, Fig. S1). The
blocked-flap structure can be regarded as a model
for the normal replication fork. Interestingly,
DmGEN cleaved the lagging strand of the model
replication fork with gaps (Fig. 7C). Furthermore,

DmGEN was localized in the nucleus of Drosophila
Fig. 6. Nuclease activities of DmGEN (51 nM) and HsFEN-1
(4.7 n
M) on various flap structure substrates (5 nM). Incubation was
carried out at 37 °C for 60 min for DmGEN and 15 min for HsFEN-
1ina20lL reaction volume. Electrophoresis was carried out on a
20% polyacrylamide ⁄ 8
M urea gel. Substrates are depicted sche-
matically in each panel. Asterisk indicates the position of the radio-
label. Substrate and cleavage product sizes were as indicated.
Amounts of nuclease products were calculated with the aid of the
IMAGE J 1.36b image analyzer. wt: DmGEN wild-type; mut: DmGEN
E143A E145A double mutant; hFEN-1: HsFEN-1 wild-type.
Flap endonuclease activity in DmGEN Y. Kanai et al.
3922 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
A
B
C
Fig. 7. (A) Nuclease activity of HsFEN-1
(4.7 n
M) on the flap structure substrate and
blocked-flap structure substrates (5 n
M). The
reaction condition is described in Experi-
mental procedures. Time-course experi-
ments were performed. Substrates are
depicted schematically in each panel. Aster-
isk indicates the position of the radiolabel.
Substrate and cleavage product sizes were
as indicated. Electrophoresis was carried

out on a 20% polyacrylamide ⁄ 8
M urea gel.
hFEN-1: HsFEN-1. (B) Nuclease activity of
DmGEN (48 n
M) on the flap structure sub-
strate and blocked-flap structure substrates
(25 n
M). (C) Nuclease activity of DmGEN
protein (97 n
M) on the model replication fork
substrates (25 n
M). (B,C) Electrophoresis
was carried out on 10% polyacrylamide ⁄ 7
M
urea gels. Amounts of nuclease products
were calculated with the aid of the
IMAGE J
1.36b image analyzer. wt: DmGEN wild-
type; mut: DmGEN E143A E145A mutant.
Y. Kanai et al. Flap endonuclease activity in DmGEN
FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3923
early embryos, in which DNA replication is actively
occurred (Fig. 8). To maintain chromosome integrity,
several DNA repair pathways coupled with the
lagging strand of the replication fork are working
[29,30]. Lopes et al. reported that ssDNA gaps accu-
mulate along replicated duplexes in vivo, when DNA
replication forks pause and restart near lesions on
the template [31]. They also argued that translesion
synthesis and recombinational repair play a crucial

role in repairing these ssDNA gaps [31]. RAD51-
mediated DNA recombinational repair needs free
3¢-overhang DNA [32,33]. We speculate that
DmGEN may cleave the lagging strand of the repli-
cation fork with gaps. As a result of the cleavage,
DmGEN produces free 3¢-overhang DNA, which
subsequently becomes available for RAD51-mediated
recombinational repair.
The above-described properties of DmGEN obvi-
ously differ from other members of the RAD2 ⁄ XPG
family of nucleases. Thus, we suggest that DmGEN
should be categorized in a new class (class IV) of
the RAD2 ⁄ XPG family. Homologues of DmGEN
are widely found in animals and plants. This sugg-
ests that DmGEN may play an important biological
role. Further characterization of DmGEN may shed
new light on biological events related to DNA
metabolism.
Experimental procedures
Expression and purification of DmGEN protein
PCR was carried out using the EST clone RE33588, con-
taining the entire Drosophila GEN (DmGEN) coding
AB
C
D
E
F
G
H
I

J
K
L
Fig. 8. A rabbit polyclonal anti-DmGEN serum was used for Immunostaing of 0–3 h Drosophila embryos. Microscopic imaging of embryos
labeled with DNA in blue (DAPI) and DmGEN in green (a-DmGEN pAb). (A–C) Embryo at stage 2 (0:25 to 1:05 h embryo). (D–I) Embryo at
stage 3 (1:05 to 2:10 h embryo). (J–L) Negative control. Magnification: ·100 (A–F); ·400 (G–I); ·100 (J–L).
Flap endonuclease activity in DmGEN Y. Kanai et al.
3924 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
sequence. The primers synthesized chemically were 5¢-CA
TATGGGCGTCAAGGAATTATG-3¢ and 5¢-GGATCCC
TTAATCACTAATCACCACCA-3¢. The resultant 2181 bp
NdeI ⁄ BamHI DNA fragment was cloned into the corres-
ponding sites of the pCold I expression vector (Takara,
Shiga, Japan). For protein expression, the pCold I–
DmGEN plasmid was transformed into the E. coli
BL21(DE3) (Novagen, Darmstadt, Germany). Bacteria
containing the plasmid were grown at 30 °C in 2000 mL
of Luria–Bertani medium supplemented with 50 lgÆmL
)1
ampicillin. Cells were grown to D ¼ 0.7 and isopropyl-
b-d-thiogalactoside was added to a final concentration of
1mm. After 24 h incubation at 15 °C, cells were harves-
ted by centrifugation at 3000 g for 10 min. Cell pellets
were resuspended in 40 mL of ice-cold binding buffer
(50 mm NaPO
4
pH 8.0, 0.5 m NaCl, 5 mm imidazole and
0.01% NP-40) and sonicated with five 10-s bursts. Cell
lysates were centrifuged at 15 000 g for 30 min and the
supernatant containing soluble proteins was collected as

the crude extract. The supernatant was loaded onto a
1 mL of Ni-NTA resin column (Invitrogen Japan, Tokyo,
Japan). The column was washed with 40 mL of washing
buffer (50 mm NaPO
4
pH 8.0, 0.5 m NaCl, 20 mm imidaz-
ole and 0.01% NP-40), and the bound protein was eluted
with 10 mL of elution buffer (50 mm NaPO
4
pH 8.0,
0.5 m NaCl, 0.5 m imidazole and 0.01% NP-40). The elut-
ed protein was dialyzed against TEG (50 mm Tris ⁄ HCl
pH 7.5, 1 mm EDTA and 10% glycerol). The dialysate
was loaded onto a 1 mL SP Sepharose Fast Flow column
(GE Healthcare, Buckinghamshire, UK) equilibrated with
TEG. After washing, the bound protein was eluted with
30 mL of a linear gradient of 0–1.5 m NaCl in TEG and
the collected protein was dialyzed against TEG. Finally,
the dialysate was loaded onto a Superdex-200 column
(GE Healthcare) equilibrated with TEMG (50 mm
Tris ⁄ HCl pH 7.5, 1 mm EDTA, 5 mm 2-mercaptoethanol
and 10% glycerol) containing 150 mm NaCl. The peak
fraction (1 mL) of DmGEN was dialyzed against the
TEMG buffer containing 150 mm NaCl, and stored at
)80 °C until used. We also purified the HsFEN-1 protein
from the E. coli BL21(DE3) transformed with the pET28–
HsFEN-1 plasmid and following a previously published
report [34], and used the purified HsFEN-1 as a positive
control.
Construction of an active-site double mutant

of DmGEN (E143A E145A)
We identified the active-site conserved residues of DmGEN
(E143 and E145) by amino acid sequence alignment with
the other members of the RAD2 ⁄ XPG family of nucleases
(Fig. 2B, asterisks 2 and 3), in particular, HsFEN-1, which
was previously functionally characterized using point muta-
tion analysis by Shen et al. [21]. The following primers were
chemically synthesized to create DmGEN point mutations:
5¢-CGTCCAAGGTCCCGGCG
CAGCGGCAGCCTACTG
TGCCTTT-3¢ and 5¢-AAAGGCACAGTAGGC
TGCCGC
TGCGCCGGGACCTTGGACG-3¢ (altered DNA sequen-
ces are underlined). Mutagenesis was performed using the
Quick Change II site-directed mutagenesis kit (Stratagene,
La Jolla, CA). Expression and purification of the mutant
DmGEN protein were carried out following the procedures
described above for wild-type DmGEN.
Preparation of substrates for nuclease assays
The nucleotide sequences of the oligonucleotides used to
form DNA substrates for this study are shown in Table 1.
DNA substrates were prepared as described previously [7].
The gapped-flap is a flap substrate that has a 4 bp gap at
the upstream primer of the dsDNA. By contrast, the
blocked-flap (BF) is a flap substrate in which a primer is
bound to the 5¢-tail of the single-stranded flap. The double-
flap is a flap substrate that has both a 5¢ flap and a 3¢ flap.
Model replication fork and Holliday junction substrates
were made as described by Boddy et al. [35]. Figure 1
shows the DNA structures generated.

Nuclease assay (with linear DNA as the
substrate)
The DmGEN protein was incubated with
32
P-labeled DNA
substrate in a 20 lL reaction mixture containing 50 mm
Tris ⁄ HCl pH 8.0, 5 mm MgCl
2
, 10% glycerol and 1 mm
dithiothreitol at 37 °C. The amounts of protein and
substrates used are given in the figure legends. The reaction
was stopped by adding 20 lL of gel-loading buffer (90%
formamide, 5 mm EDTA, 0.1% bromophenol blue and
0.1% xylene cyanol), the sample was heated for 5 min at
95 °C, and a fraction was loaded onto a 20% polyacryl-
amide gel containing 8 m urea in TBE buffer, and electro-
phoresis was carried out for 2 h. After drying, gels were
exposed to BioMax MS-1 (Eastman Kodak Co., New
York, NY) and the DNA bands were quantified using an
image analyzer (image j 1.36b, National Institutes of
Health, Bethesda, MD). FEN-1 was used as a positive con-
trol following the same procedure and using the conditions
described in the figure legends.
Immunostainning of Drosophila embryos
A polyclonal antibody against the DmGEN protein was
raised in a rabbit using the purified recombinant DmGEN
fragment (amino acid residues 508–680). Animals were fed
water and standard rabbit food and maintained on a 12-h
light/dark cycle. Polyclonal antiserum to the peptide was
raised in rabbits by subcutaneous injections of 0.3 mg of

the peptide emulsified in Freund’s complete adjuvant. Two
weeks after the primary injection, boosts of 0.3 mg of the
Y. Kanai et al. Flap endonuclease activity in DmGEN
FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3925
peptide in Freund’s incomplete adjuvant were injected every
2 weeks. The rabbits were bled one week after the final
boost under anesthesia. The rabbits were treated in accor-
dance with procedures approved by the Animal Ethics
Committee of the Tokyo University of Science. Western
immunoblot analysis showed that it reacts specifically with
the DmGEN protein in a crude extract of 0–3 h Drosophila
embryos. Embryos of Drosophila melanogaster (Canton S)
0–3 h old were collected, dechorionated, fixed and devitelli-
nized as described by Ashburner [36]. The procedure of
immunostaining was previously described by Takata et al.
[37]. A polyclonal rabbit anti-DmGEN serum and
Alexa488–anti-(rabbit IgG) (Sigma, St Louis, MO) were
used as primary and secondary antibodies, respectively. The
nuclei were stained with DAPI.
Acknowledgements
We thank Dr Yukinobu Uchiyama and Dr Kazuki
Iwabata (Tokyo University of Science) for helpful
discussions.
References
1 Szankasi P & Smith GR (1995) A role for exonuclease I
from S. pombe in mutation avoidance and mismatch
correction. Science 267, 1166–1169.
2 Harada YN, Shiomi N, Koike M, Ikawa M, Okabe M,
Hirota S, Kitamura Y, Kitagawa M, Matsunaga T,
Nikaido O et al. (1999) Postnatal growth failure, short

life span, and early onset of cellular senescence and sub-
sequent immortalization in mice lacking the xeroderma
pigmentosum group G gene. Mol Cell Biol 19,
2366–2372.
3 Larsen E, Gran C, Saether BE, Seeberg E & Klungland
A (2003) Proliferation failure and gamma radiation sen-
sitivity of Fen1 null mutant mice at the blastocyst stage.
Mol Cell Biol 23, 5346–5353.
4 Tian M, Jones DA, Smith M, Shinkura R & Alt FW
(2004) Deficiency in the nuclease activity of xeroderma
pigmentosum G in mice leads to hypersensitivity to UV
irradiation. Mol Cell Biol 24, 2237–2242.
5 Bardwell PD, Woo CJ, Wei K, Li Z, Martin A, Sack
SZ, Parris T, Edelmann W & Scharff MD (2004)
Altered somatic hypermutation and reduced class-switch
recombination in exonuclease 1-mutant mice. Nat
Immunol 5, 224–229.
6 Wei K, Clark AB, Wong E, Kane MF, Mazur DJ, Parris
T, Kolas NK, Russell R, Hou H, Kneitz B (2003) Inacti-
vation of exonuclease 1 in mice results in DNA mis-
match repair defects, increased cancer susceptibility, and
male and female sterility. Genes Dev 17, 603–614.
7 Ishikawa G, Kanai Y, Takata K, Takeuchi R,
Shimanouchi K, Ruike T, Furukawa T, Kimura S &
Sakaguchi K (2004) DmGEN, a novel RAD2 family
endo-exonuclease from Drosophila melanogaster.
Nucleic Acids Res 32, 6251–6259.
8 Furukawa T, Kimura S, Ishibashi T, Mori Y, Hashimo-
to J & Sakaguchi K (2003) OsSEND-1: a new RAD2
nuclease family member in higher plants. Plant Mol Biol

51, 59–70.
9 Moritoh S, Miki D, Akiyama M, Kawahara M, Izawa
T, Maki H & Shimamoto K (2005) RNAi-mediated
silencing of OsGEN-L (OsGEN-like), a new member of
the RAD2 ⁄ XPG nuclease family, causes male sterility
by defect of microspore development in rice. Plant Cell
Physiol 46, 699–715.
10 O’Donovan A, Davies AA, Moggs JG, West SC &
Wood RD (1994) XPG endonuclease makes the 3¢
incision in human DNA nucleotide excision repair.
Nature 371, 432–435.
11 Clarkson SG (2003) The XPG story. Biochimie 85,
1113–1121.
12 Lieber MR (1997) The FEN-1 family of structure-speci-
fic nucleases in eukaryotic DNA replication, recombina-
tion and repair. Bioessays 19, 233–240.
13 Bibikova M, Wu B, Chi E, Kim KH, Trautman JK &
Carroll D (1998) Characterization of FEN-1 from
Xenopus laevis. cDNA cloning and role in DNA
metabolism. J Biol Chem 273, 34222–34229.
14 Shen B, Singh P, Liu R, Qiu J, Zheng L, Finger LD &
Alas S (2005) Multiple but dissectible functions of
FEN-1 nucleases in nucleic acid processing, genome
stability and diseases. Bioessays 27, 717–729.
15 Genschel J, Bazemore LR & Modrich P (2002) Human
exonuclease I is required for 5¢- and 3¢ mismatch repair.
J Biol Chem
277, 13302–13311.
16 Bedale WA, Inman RB & Cox MM (1993) A reverse
DNA strand exchange mediated by recA protein and

exonuclease I. The generation of apparent DNA strand
breaks by recA protein is explained. J Biol Chem 268,
15004–15016.
17 Lee BI & Wilson DM (1999) The RAD2 domain of
human exonuclease 1 exhibits 5¢-to3¢ exonuclease and
flap structure-specific endonuclease activities. J Biol
Chem 274, 37763–37769.
18 Lee BI, Nguyen LH, Barsky D, Fernandes M & Wilson
DM (2002) Molecular interactions of human Exo1 with
DNA. Nucleic Acids Res 30, 942–949.
19 Dunand-Sauthier I, Hohl M, Thorel F, Jaquier-Gubler
P, Clarkson SG & Scharer OD (2005) The spacer region
of XPG mediates recruitment to nucleotide excision
repair complexes and determines substrate specificity.
J Biol Chem 280, 7030–7037.
20 Qiu J, Liu R, Chapados BR, Sherman M, Tainer JA &
Shen B (2004) Interaction interface of human flap
endonuclease-1 with its DNA substrates. J Biol Chem
279, 24394–24402.
Flap endonuclease activity in DmGEN Y. Kanai et al.
3926 FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS
21 Shen B, Nolan JP, Sklar LA & Park MS (1997)
Functional analysis of point mutations in human
flap endonuclease-1 active site. Nucleic Acids Res 25,
3332–3338.
22 Harrington JJ & Lieber MR (1994) The characterization
of a mammalian DNA structure-specific endonuclease.
EMBO J 13 , 1235–1246.
23 Murante RS, Rust L & Bambara RA (1995) Calf 5¢-to
3¢ exo ⁄ endonuclease must slide from a 5¢ end of the

substrate to perform structure-specific cleavage. J Biol
Chem 270, 30377–30383.
24 Liu R, Qiu J, Finger LD, Zheng L & Shen B (2006)
The DNA–protein interaction modes of FEN-1 with
gap substrates and their implication in preventing dupli-
cation mutations. Nucleic Acids Res 34, 1772–1784.
25 Bownes M (1975) A photographic study of development
in the living embryo of Drosophila melanogaster.
J Embryol Exp Morphol 33, 789–801.
26 Yamaguchi M, Date T & Matsukage A (1991) Distribu-
tion of PCNA in Drosophila embryo during nuclear
division cycles. J Cell Sci 100, 729–733.
27 Constantinou A, Gunz D, Evans E, Lalle P, Bates PA,
Wood RD & Clarkson SG (1999) Conserved residues of
human XPG protein important for nuclease activity and
function in nucleotide excision repair. J Biol Chem 274,
5637–5648.
28 Hohl M, Dunand-Sauthier I, Staresincic L, Jaquier-
Gubler P, Thorel F, Modesti M, Clarkson SG &
Scharer OD (2007) Domain swapping between FEN-1
and XPG defines regions in XPG that mediate
nucleotide excision repair activity and substrate
specificity. Nucleic Acids Res 35, 3053–3063.
29 Rossi ML, Purohit V, Brandt PD & Bambara RA
(2006) Lagging strand replication proteins in genome
stability and DNA repair. Chem Rev 106 , 453–473.
30 Kimura S, Tahira Y, Ishibashi T, Mori Y, Mori T,
Hashimoto J & Sakaguchi K (2004) DNA repair in
higher plants; photoreactivation is the major DNA
repair pathway in non-proliferating cells while excision

repair (nucleotide excision repair and base excision
repair) is active in proliferating cells. Nucleic Acids Res
32, 2760–2767.
31 Lopes M, Foiani M & Sogo JM (2006) Multiple mecha-
nisms control chromosome integrity after replication
fork uncoupling and restart at irreparable UV lesions.
Mol Cell 21 , 15–27.
32 Michel B (2000) Replication fork arrest and DNA
recombination. Trends Biochem Sci 25, 173–178.
33 Mazin AV, Zaitseva E, Sung P & Kowalczykowski SC
(2000) Tailed duplex DNA is the preferred substrate for
Rad51 protein-mediated homologous pairing. EMBO J
19, 1148–1156.
34 Kimura S, Ueda T, Hatanaka M, Takenouchi M,
Hashimoto J & Sakaguchi K (2000) Plant homologue of
flap endonuclease-1: molecular cloning, characterization,
and evidence of expression in meristematic tissues. Plant
Mol Biol 42, 415–427.
35 Boddy MN, Gaillard PH, McDonald WH, Shanahan P
& Yates R (2001) Mus81–Eme1 are essential compo-
nents of a Holliday junction resolvase. Cell 107,
537–548.
36 Ashburner M (1989) Antibody staining of embryos.
Drosophila, Laboratory Manual, pp. 214–216. Cold
Spring Harbor Press, New York, NY.
37 Takata K, Ishikawa G, Hirose F & Sakaguchi K (2002)
Drosophila damage-specific DNA-binding protein 1
(D-DDB1) is controlled by the DRE ⁄ DREF system.
Nucleic Acids Res 30, 3795–3808.
Supplementary material

The following supplementary material is available
online:
Table S1. Oligonucleotides used for constructing the
hairpinned-flap substrates shown in Fig. S1.
Fig. S1. Nuclease activity of HsFEN-1 (A) and DmGEN
(B) on the flap structure substrate and hairpinned-flap
structure substrates.
This material is available as part of the online article
from
Please note: Blackwell Publishing is not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corres-
ponding author for the article.
Y. Kanai et al. Flap endonuclease activity in DmGEN
FEBS Journal 274 (2007) 3914–3927 ª 2007 The Authors Journal compilation ª 2007 FEBS 3927