Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx

7,8-Diaminoperlargonic acid aminotransferase from
Mycobacterium tuberculosis, a potential therapeutic
target
Characterization and inhibition studies
Ste
´
phane Mann and Olivier Ploux
Synthe
`
se Structure et Fonction de Mole
´
cules Bioactives, Universite
´
Pierre et Marie Curie-Paris 6, UMR 7613, Paris, France
Tuberculosis remains one of the major infectious dis-
eases in the world, with a newly infected human every
second, one-third of the total population already infec-
ted, and 2 million deaths per year, according to the
WHO [1]. Furthermore, strains of Mycobacterium
tuberculosis, the pathogen, that are resistant to one or
several antibiotics used in therapy have been identified
and might thus compromise efforts to eradicate the
disease. New therapeutic targets and drugs, as well as
new vaccines and public health efforts are thus
urgently needed to decrease the incidence of tuberculo-
sis worldwide.
Keywords
7,8-diaminopelargonic acid
aminotransferase; amiclenomycin; biotin
biosynthesis; Mycobacterium tuberculosis;
S-adenosyl-

L-methionine
Correspondence
O. Ploux, Synthe
`
se Structure et Fonction de
Mole
´
cules Bioactives, UMR7613 CNRS-
UPMC, Universite
´
Pierre et Marie Curie,
boı
ˆ
te 182, 4, place Jussieu, F-75252 Paris
cedex 05, France
Fax: +33 1 44 27 71 50
Tel: +33 1 44 27 55 11
E-mail:
URL: />(Received 1 June 2006, revised 13 July
2006, accepted 23 August 2006)
doi:10.1111/j.1742-4658.2006.05479.x
Diaminopelargonic acid aminotransferase (DAPA AT), which is involved
in biotin biosynthesis, catalyzes the transamination of 8-amino-7-oxonona-
noic acid (KAPA) using S-adenosyl-l-methionine (AdoMet) as amino
donor. Mycobacterium tuberculosis DAPA AT, a potential therapeutic tar-
get, has been overproduced in Escherichia coli and purified to homogeneity
using a single efficient step on a nickel-affinity column. The enzyme shows
an electronic absorption spectrum typical of pyridoxal 5¢-phosphate-
dependent enzymes and behaves as a homotetramer in solution. The pH
profile of the activity at saturation shows a single ionization group with a

pK
a
of 8.0, which was attributed to the active-site lysine residue. The
enzyme shows a Ping Pong Bi Bi kinetic mechanism with strong substrate
inhibition with the following parameters: K
mAdoMet
¼ 0.78 ± 0.20 mm,
K
mKAPA
¼ 3.8 ± 1.0 lm, k
cat
¼ 1.0 ± 0.2 min
)1
, K
iKAPA
¼ 14 ± 2 lm.
Amiclenomycin and a new analogue, 4-(4c-aminocyclohexa-2,5-dien-1r-
yl)propanol (referred to as compound 1), were shown to be suicide sub-
strates of this enzyme, with the following inactivation parameters: K
i
¼
12±2lm, k
inact
¼ 0.35 ± 0.05 min
)1
, and K
i
¼ 20±2lm, k
inact
¼

0.56 ± 0.05 min
)1
, for amiclenomycin and compound 1, respectively. The
inactivation was irreversible, and the partition ratios were 1.0 and 1.1 for
amiclenomycin and compound 1, respectively, which make these inactiva-
tors particularly efficient. compound 1 (100 lgÆmL
)1
) completely inhibited
the growth of an E. coli C268bioA mutant strain transformed with a
plasmid expressing the M. tuberculosis bioA gene, coding for DAPA AT.
Reversal of the antibiotic effect was observed on the addition of biotin or
DAPA. Thus, compound 1 specifically targets DAPA AT in vivo.
Abbreviations
AdoMet, S-adenosyl-L-methionine; DAPA, 7,8-diaminopelargonic acid (7,8-diaminononanoic acid); DAPA AT, 7,8-diaminopelargonic acid
aminotranferase; KAPA, 8-amino-7-oxononanoic acid; PLP, pyridoxal 5¢-phosphate.
4778 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS
The biosynthesis of biotin (vitamin H), a cofactor
for carboxylases, decarboxylases and transcarboxylas-
es, has been identified as an interesting target for anti-
biotics and herbicides. Indeed, this metabolic pathway
is specific to micro-organisms and higher plants [2].
Two antibiotics isolated from Streptomyces species,
actithiazic acid [3] and amiclenomycin [4–8], have been
found to be active against mycobacteria, and target
enzymes of the biotin biosynthesis pathway. Further-
more, bioA, the gene coding for 7,8-diaminopelargonic
acid aminotransferase (DAPA AT; EC 2.6.1.62), which
is involved in biotin biosynthesis, has been implicated
in long-term survival of mycobacteria [9]. It thus seems
that biotin biosynthesis, and in particular the transami-

nation step catalyzed by DAPA AT, are valid targets
for antibiotic directed against mycobacteria. Obvi-
ously, mycobacteria could reverse the effect of such
antibiotics by taking up external biotin. However, such
a transporter remains elusive in the annotated genes of
M. tuberculosis [10,11], and reversal of the amicleno-
mycin antibacterial effect is observed at biotin concen-
trations above 0.01 lgÆmL
)1
[4], a concentration at
least 10 times higher than that found in human plasma
[12]. Interestingly, the recently described bioA mutant
of Mycobacterium smegmatis survived poorly in rich
medium, suggesting that the observed phenotype was
not reversed by the presence of external biotin [9].
DAPA AT is a pyridoxal 5¢-phosphate (PLP)
enzyme that catalyzes the transamination of 8-amino-
7-oxononanoic acid (KAPA) to yield 7,8-diaminonona-
noic acid (DAPA) [13,14] (Fig. 1). In Escherichia coli,
the amino donor in this reaction is S-adenosyl-l-
methionine (AdoMet) [15]. The enzyme from E. coli
has been well characterized [13–17], and its 3D struc-
ture determined [18,19]. We have reported the total
synthesis of natural amiclenomycin [20] and some of
its analogues [21] and have deciphered the mode of
action of this antibiotic at the molecular level [22–25].
It irreversibly inactivates E. coli DAPA AT by forming
an aromatic adduct with the bound PLP. Interestingly,
modification of the structure of amiclenomycin gave
some active compounds, encouraging the design of

new inhibitors that might be useful in antibiotic devel-
opment [25].
In an effort to contribute to the discovery of new
therapeutic targets in M. tuberculosis, it is our inten-
tion to fully characterize M. tuberculosis DAPA AT
and screen likely molecules for their inhibiting proper-
ties. We report here the cloning and heterologous
expression of the M. tuberculosis bioA gene. M. tuber-
culosis DAPA AT was purified to homogeneity and
characterized. We also provide evidence that amicleno-
mycin and a new analogue irreversibly inactivate
M. tuberculosis DAPA AT.
Results and Discussion
Cloning, expression and purification of
M. tuberculosis DAPA AT
We used PCR-based technology to construct two
M. tuberculosis bioA genes which were cloned into a
pUC18 vector, downstream of the lac promoter. The
first construct, pUC18-MTbioA, contained a ribosome-
binding site consensus sequence 7 bp ahead of the first
ATG codon, while the second, pUC18-MTHis
6
bioA,
contained the same ribosome-binding site and a
sequence coding for His
6
inserted between the first and
second codon of the bioA gene. The first construct
would therefore produce a M. tuberculosis DAPA AT
with the wild-type sequence (referred to as wild-type

DAPA AT in this work), and the latter would give an
N-terminal His
6
-tagged DAPA AT, for convenient
purification. The sequence of the recombinant genes
was verified by DNA sequencing. The functionality of
the recombinant enzymes was demonstrated in vivo by
transforming E. coli C268 bioA
–
cells with both con-
structs. Transformed cells were able to grow on a
COOH
NH
2
O
KAPA
NH
2
H
2
N
COOH
NH
2
OH
DAPA
COOH
NH
2
NH

2
DAPA
aminotransferase
AdoMet
S-Adenosyl-
(2-oxo-4-thiobutyrate)
Biotin
Amiclenomycin
Compound 1
Fig. 1. The reaction catalyzed by DAPA AT
and the chemical structure of amicleno-
mycin and compound 1.
S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase
FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4779
biotin-free Luria–Bertani agar plate (containing
0.45 UÆmL
)1
avidin), thus reversing the bio
–
phenotype
by complementation, which proved that the heterolo-
gous expression was efficient and that both recombin-
ant M. tuberculosis DAPA ATs were functional.
The production of soluble His
6
-tagged M. tuberculo-
sis DAPA AT was low in E. coli JM105 ⁄ pUC18-
MTHis
6
bioA: the crude extract had a specific activity

of 0.04 mUÆmg
)1
. Induction by isopropyl b-d-thiogal-
actopyranoside (0.1–0.5 mm) in this lacI
q
strain moder-
ately increased the production of soluble enzyme by a
factor of 2. As we noted the presence in the M. tuber-
culosis bioA sequence of codons rarely used in E. coli
(eight CCC Pro, one AGG Arg and three CGA Arg
codons), we attempted to produce the enzyme in
E. coli Rosetta(DE3) ⁄ pLysS or E. coli BL21 Codon-
Plus(DE3)RP. In these hosts, the expression was con-
stitutive, as the lac repressor is not overproduced,
and the specific activity of the soluble extract was
0.10 mUÆmg
)1
in E. coli Rosetta(DE3) ⁄ pLysS ⁄ pUC18-
MTHis
6
bioA and 0.12 mUÆmg
)1
in E. coli BL21
CodonPlus(DE3)RP ⁄ pUC18-MTHis
6
bioA. This slightly
increased production compared with that in E. coli
JM105 ⁄ pUC18-MTHis
6
bioA was attributed to the

overproduction of the rare tRNAs. However, when
produced in E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-
MTHis
6
bioA, DAPA AT was predominantly in an
insoluble form. Unfortunately, attempts to solubilize
the precipitated proteins in 8 m urea and renature the
DAPA AT were unsuccessful. The His
6
-tagged DAPA
AT was thus purified from the soluble crude extract of
E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTHis
6
bioA
using a single purification step, nickel affinity chroma-
tography. Homogeneous enzyme was thus obtained,
as judged by SDS⁄ PAGE analysis (Fig. 2). Three
milligrams of pure protein with a specific activity of
8.8 ± 0.3 mUÆmg
)1
, was obtained from 1 L of culture,
making this purification scheme quite efficient, with a
73-fold purification. Concentration of the protein solu-
tion was achieved by ammonium sulfate precipitation
followed by solubilization and dialysis rather than by
ultrafiltration which caused precipitation. The pure
enzyme was kept at )80 °C without significant loss of
activity.
Wild-type M. tuberculosis DAPA AT was similarly
produced in E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-

MTbioA. However, purification of the enzyme from
the soluble fraction required a two-step purification
protocol using Q-Sepharose and Mono Q columns.
The specific activity of the pure enzyme was 9.4 ±
0.3 mUÆmg
)1
, a value very similar to that for the His
6
-
tagged enzyme, which shows that the six N-terminal
histidine residues of His
6
-tagged DAPA AT do not
perturb the catalytic activity.
Biochemical characterization
As shown in Fig. 2, wild-type and His
6
-tagged
M. tuberculosis DAPA AT showed a single band when
separated by SDS ⁄ PAGE, with an approximate
molecular mass of 45 kDa, in agreement with the bioA
DNA sequence. The two enzymes were separately
chromatographed on a calibrated Superdex HR S200
column, in native conditions, at pH 8.0. Both recom-
binant proteins were eluted as a single species with an
estimated molecular mass of 189 kDa. Therefore,
M. tuberculosis DAPA AT behaved as a homotetramer
in solution.
The electronic absorption spectrum of pure His
6

-
tagged M. tuberculosis DAPA AT, at pH 8.0, exhibited
characteristic bands at 332 nm and 414 nm, typical of
the internal aldimine of PLP-dependent enzymes [26],
which we attributed to the internal aldimine between
the bound PLP and the enzyme (Fig. 3). The absorb-
ance ratio, A
414
⁄ A
280
, was 0.219 for the pure enzyme.
The specific activity of His
6
-tagged M. tuberculosis
DAPA AT was measured at different pH values, from
6.8 to 9.1, in the presence of 20 lm KAPA and 1 mm
AdoMet. Figure 4 shows the data on a log-log plot
together with the pH profile for E. coli DAPA AT,
measured in the same conditions, for comparison. The
data were fitted to Eqn (1) assuming one ionisable
group on the enzyme (pK
a1
):
a ¼ a
max
=ð1 þ 10
p
K
a1
ÀpH

Þð1Þ
As Fig. 4 shows, the maximum specific activity for the
M. tuberculosis enzyme is 10 times lower than that
measured for the E. coli enzyme. The pK
a
values
Fig. 2. Analysis by SDS ⁄ PAGE of the purification of His
6
-tagged
M. tuberculosis DAPA AT on a Ni-affinity column. Lane 1, crude
extract; lane 2, unretained fraction; lane 3, molecular mass stand-
ards (from top to bottom: 66 kDa, 45 kDa, 36 kDa, 29 kDa,
24 kDa); lanes 4–9, fractions eluted with 400 m
M imidazole; lane
10, purified wild-type M. tuberculosis DAPA AT; lane 11, purified
His
6
-tagged M. tuberculosis DAPA AT; lane 12, molecular mass
standards (66 kDa, 45 kDa, 36 kDa, 29 kDa, 24 kDa, 20 kDa).
M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux
4780 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS
obtained were 7.6 and 8.0 for E. coli and M. tuberculo-
sis DAPA AT, respectively. It should be noted that the
data points between pH 6.5 and pH 7.1 for M. tuber-
culosis DAPA AT do not fit well to the simple ioniza-
tion model described by Eqn (1). Further pH studies
are necessary to clarify this. Indeed, interpretation of
simple pH effects on activity are not straightforward
[27], but because the substrates were almost at satur-
ating concentrations, one can reasonably attribute the

ionization observed to the active-site base that cata-
lyses the proton transfer. In E. coli DAPA AT, the
active-site base has been proposed to be Lys274 on the
basis of structural data. This lysine residue is con-
served in all DAPA AT sequences known so far [19].
There is no doubt that the corresponding lysine in the
M. tuberculosis enzyme, Lys283, plays the same role.
Several potential amino donors were tested at high
concentration (5 mm) on our enzyme: l-Asp, l-Glu,
l-Met, l-Lys, and d,l-homocysteine. None of them
was a substrate for the transamination reaction, i.e.,
no activity was detected when AdoMet was replaced
by these amines. Consequently, AdoMet was consid-
ered to be the natural amino donor and used for
further kinetic studies. Of all the DAPA ATs
characterized [13,14,28], the enzyme from Bacillus
subtilis is the only one that does not use AdoMet as
the amino donor. It uses lysine as the amino donor
instead [29]. Thus, there might be two different classes
of DAPA AT that differ with regard to the second
substrate.
Determination of the kinetic parameters of the
His
6
-tagged DAPA AT
The double-reciprocal plot of initial velocities against
KAPA concentration for several concentrations of the
second substrate, AdoMet, is typical of a Ping Pong
Bi Bi mechanism, with strong substrate inhibition by
KAPA (Fig. S1) [30]. The plot is very similar to those

already published by Stoner & Eisenberg [14] and us
[24], for the E. coli enzyme, i.e., at low KAPA concen-
tration the lines appear parallel, whereas at higher
KAPA concentration they bend up as they approach the
ordinate axis. Such plots are problematic for determin-
ing the four kinetic parameters, i.e., K
iKAPA
, K
mKAPA
,
K
mAdoMet
, and V
m
. We thus used a different strategy
to obtain an estimation of the kinetic parameters (a
full description is available in the Supplementary
material). When KAPA concentrations above 10 lm
were used, this substrate appeared as a simple compet-
itive inhibitor of the reaction, as shown in the Hanes–
Woolf plot of the data (Fig. 5A). The parallel lines are
characteristic of competitive inhibition by KAPA, i.e.,
KAPA forms a dead end complex with the enzyme–
PLP form, in competition with AdoMet. Replotting
the apparent K
m
⁄ V
m
as a function of KAPA con-
centration gave: K

iKAPA
¼ 14 ± 2 lm, K
mAdoMet
¼
0.1
1.0
10.0
100.0
6.5 7.0 7.5 8.0 8.5 9.0 9.5 10.0
Specific activity (mU.mg
-1
)
pH
Fig. 4. Activity versus pH profile for the His
6
-tagged M. tuberculo-
sis DAPA AT and for E. coli DAPA AT. The specific activities of
both enzymes were determined in the presence of saturating con-
centrations of substrates at various pH values. See Experimental
procedures for details. The specific activity was plotted against the
pH on a log-log plot. The data points were fitted to Eqn
(1). h E. coli DAPA AT; d His
6
-tagged M. tuberculosis DAPA AT.
0.00
0.05
0.10
0.15
0.20
0.25

0.30
0.35
300 350 400 450 500 550
Absorbance
Wavelength (nm)
Fig. 3. UV-visible spectrum of His
6
-tagged M. tuberculosis DAPA
AT. The absorption spectrum of purified His
6
-tagged M. tuber-
culosis DAPA AT (0.44 mgÆmL
)1
)in50mM Tris ⁄ HCl buffer
(pH 8.0) ⁄ 10 m
M 2-mercaptoethanol was recorded against a blank
containing the same buffer.
S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase
FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4781
0.58 ± 0.1 mm and V
m
¼ 22 ± 6 mUÆmg
)1
(Fig. 5B).
Thus the catalytic constant is k
cat
¼ 1.0 ± 0.2 min
)1
.
To estimate K

mKAPA
, we used the constant ratio
method [14,30]. Initial velocities were measured using a
constant molar ratio of the two substrates, AdoMet
and KAPA. The double-reciprocal plot in these condi-
tions gave straight lines, a characteristic of the Ping
Pong mechanism, but in our case they did not intersect
at the same point on the ordinate axis, because inhibi-
tion by KAPA was not negligible (Fig. S2). The secon-
dary plots (Fig. S3 and Fig. S4) allowed the estimation
of K
mAdoMet
¼ 0.96 ± 0.1 mm and V
m
¼ 21 ± 7
mUÆmg
)1
and K
mKAPA
¼ 3.8 ± 1.0 lm. Because two
different values for K
mAdoMet
were obtained by our
analyses, the mean of these values (0.78 ± 0.20 mm)
was considered to be the best estimate.
Comparison of the kinetic parameters of the E. coli
and M. tuberculosis enzymes shows that the K
m
values
for the latter are 3–4 times higher, and that the k

cat
for
the M. tuberculosis enzyme is eight times lower than
that of the E. coli enzyme. Furthermore, the inhibition
constant, K
iKAPA
, for the M. tuberculosis enzyme is
half that measured for the E. coli enzyme. Overall,
M. tuberculosis DAPA AT is much less efficient than
the E. coli enzyme. This result is quite surprising as
the two enzymes share strong sequence identity (50%)
and all the active-site residues are conserved. Deter-
mination of the 3D structure of M. tuberculosis DAPA
AT will certainly shed light on this issue.
Inactivation and titration of His
6
-tagged DAPA AT
by amiclenomycin and 4-(4c-aminocyclohexa-
2,5-dien-1r-yl)propanol (compound 1)
When the His
6
-tagged M. tuberculosis DAPA AT was
preincubated, at pH 8.0, in the presence of amicleno-
mycin or compound 1 at various concentrations,
inactivation occurred. The remaining activity was
measured under standard conditions. In these condi-
tions, the inhibitor was diluted in the assay mixture
(30-fold dilution), thus stopping the inactivation pro-
cess. Figure 6A shows the remaining activity against
time on a semi-log plot for the inactivation by ami-

clenomycin. Because M. tuberculosis DAPA AT is a
rather slow enzyme, its concentration was sometimes
comparable to the inactivator concentration in these
experiments. Nevertheless, the data fitted well to a
pseudo-first-order kinetic process, and the observed
inactivation rates, k
obs
, varied hyperbolically with the
inactivator concentration. Thus, the simple two-step
model for irreversible inactivation may apply, and
the following kinetic parameters, K
i
and k
inact
, were
derived from a Kitz–Wilson plot (Fig. 6B), for
amiclenomycin and compound 1, respectively: K
i
¼
12±2lm, k
inact
¼ 0.35 ± 0.05 min
)1
, and K
i
¼
20±2lm, k
inact
¼ 0.56 ± 0.05 min
)1

. The inactiva-
tion was irreversible, as a sample of His
6
-tagged
M. tuberculosis DAPA AT inactivated at 90% by ami-
clenomycin did not recover its activity after prolonged
dialysis in the presence of 0.1 mm PLP. The partition
ratio for the inactivation by amiclenomycin was meas-
ured by incubating the His
6
-tagged M. tuberculosis
DAPA AT (5.7 lm) for 45 min with a substoichiometric
0.0
10.0
20.0
30.0
40.0
50.0
60.0
70.0
01234567
[AdoMet]/v (10
3
min)
[AdoMet] (mM)
A
0.0
10.0
20.0
30.0

40.0
0 50 100 150
K
m

app
/V
m
(10
3
min)
[Racemic-KAPA] (µM)
B
Fig. 5. Hanes–Woolf plot of the inhibition of His
6
-tagged M. tuber-
culosis DAPA AT by KAPA. (A) The activity was measured at var-
ious AdoMet and KAPA concentrations. n 20 l
M KAPA; h 50 lM
KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA. (B) Re-
plot of the ordinate intercepts against KAPA concentrations. Data
were fitted to straight lines using linear regression analysis.
M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux
4782 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS
amount of amiclenomycin and by measuring the resid-
ual enzymatic activity. Plotting the fraction of residual
activity against the molar ratio of amiclenomycin over
that of the enzyme active sites (Fig. 7) gave a straight
line that intersected the abscissa at 1.1 molar ratio.
The same experiment was run for the inactivation by

compound 1, and the partition ratio was found to be
1.0. Thus, these suicide substrates inactivate M. tuber-
culosis DAPA AT almost every turnover, which make
these inactivators particularly efficient. Figure 8 shows
the mechanism by which amiclenomycin and analogues
inactivate E. coli DAPA AT [25]. There is no doubt
that the inactivation of M. tuberculosis DAPA AT
observed here follows the same reaction pathway. This
mechanism is reminiscent of that proposed by Rando
[31] for the inactivation of c-aminobutyric acid transa-
minase by gabaculine and more recently by others for
the inactivation of c-aminobutyric acid transaminase
[32], d-amino acid aminotransferase [33], and alanine
racemase [34] by cycloserine. It is quite interesting to
note that all these PLP-dependent enzymes are inhib-
ited by a similar mechanism, ultimately yielding an
aromatic ring that does not dissociate from the active
site. We investigated if the M. tuberculosis DAPA AT
was inhibited by gabaculine and the antituberculous
drug cycloserine, which seems to be poorly specific. In
fact, none of these compounds inhibited DAPA AT
even at high concentration (1.3 mm), showing that the
DAPA AT is quite specific.
As shown above, the nature of the main chain
amino acid in amiclenomycin versus alcohol in com-
pound 1 has only a very moderate effect on the inacti-
vation parameters. This finding is quite encouraging
for the design of new inhibitors because the synthesis
of amiclenomycin takes longer than that of com-
10

100
01234567
Residual activity (%)
Time (min)
A
0
2
4
6
8
10
-0.10 -0.05 0.00 0.05 0.10 0.15 0.20
1/k
obs
(min)
1/[Amiclenomycin] (µ
M
-1
)
B
Fig. 6. Kinetics of inactivation of His
6
-tagged M. tuberculosis
DAPA-AT by amiclenomycin. (A) The enzyme was preincubated in
the presence of various concentrations of amiclenomycin: d no
inhibitor; s 5.7 l
M; n 11.4 lM; n 17.1 lM; r 25.7 lM. At different
time points, the residual activity was measured and plotted on a
semi-log plot against time. The data were fitted to simple exponen-
tial decay. The slopes of the lines gave an estimate of the observed

inactivation constants, k
obs
. (B) Double-reciprocal plot of the
observed rate of inactivation, k
obs
, against the inhibitor concentra-
tion. The data were fitted to straight lines using a linear regression
analysis.
0
20
40
60
80
100
0.0 0.2 0.4 0.6 0.8 1.0 1.2
Residual activity (%)
Molar ratio
Fig. 7. Titration of His
6
-tagged M. tuberculosis DAPA AT by ami-
clenomycin. The enzyme and amiclenomycin, at various molar
ratios, were incubated at pH 8.0 for 45 min at 37 °C. The residual
activity was then determined and plotted against the molar ratio.
The data were fitted to a straight line using linear regression
analysis.
S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase
FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4783
pound 1 and other analogues [20,21]. Furthermore,
varying this part of the molecule might afford new
interesting properties such as bioavailability.

In vivo antibiotic effect of compound 1
When E. coli C268 ⁄ pUC18-MTHis
6
bioA was grown on
solid rich medium devoid of biotin (avidin-supplemen-
ted Luria–Bertani agar medium), growth was inhibited
by increasing the concentration of compound 1. The
minimal concentration that completely inhibited growth
was found to be 100 lgÆmL
)1
. When avidin was not
added, the biotin present in the Luria–Bertani medium
(% 0.2 lm) was sufficient to reverse the growth inhibi-
tion. Furthermore, adding 100 lm DAPA to the med-
ium in the presence of avidin also reversed the growth
inhibition. Taken together, these data indicate that,
firstly, compound 1 is able to cross the cell wall, and
that, secondly, M. tuberculosis DAPA AT is the only
in vivo target of this inhibitor. The in vivo effect of com-
pound 1 was similarly tested on M. smegmatis CIP
56.5, a wild-type strain. The minimal concentration that
completely inhibited growth, measured in Luria–Bertani
medium without biotin, was 10 lgÆmL
)1
. Biotin present
in the medium was sufficient to reverse the effect. These
experiments could not be repeated with amiclenomycin,
because we did not have sufficient amounts of this
molecule. However, Okami et al. [4–6] reported a mini-
mum inhibitory concentration for amyclenomycin of

3–6 lgÆmL
)1
, on mycobacteria. This value is lower than
that measured for compound 1 for the E. coli strain but
similar to that obtained for M. smegmatis. In our case,
the target, DAPA AT, is overproduced in the E. coli
strain, thus increasing the minimum inhibitory concen-
tration. The in vivo effect of compound 1 on M. tuber-
culosis cells needs to be studied.
In conclusion, we have purified and characterized
DAPA AT from M. tuberculosis. The purification
scheme is simple enough to provide sufficient pure
enzyme for structural studies. This work is underway
in our laboratory. We have also provided evidence that
amiclenomycin and compound 1 are suicide substrates
of M. tuberculosis DAPA AT. The fact that com-
pound 1 is active in vivo and that it specifically targets
DAPA AT makes this molecule an interesting lead to
new antibiotics.
Experimental procedures
Materials and equipment
The M. tuberculosis H37Rv bioA (Rv1568) gene, cloned into
a plasmid, was a gift from P. Alzari (Institut Pasteur, Paris,
France). M. smegmatis CIP 56.5 was obtained from the
Institut Pasteur Collection. E. coli strains JM105 and BL21
Rosetta(DE3) ⁄ pLysS were from Promega (Madison, WI,
USA) and E. coli BL21 CodonPlus(DE3)RP was from
Stratagene (La Jolla, CA, USA). E. coli C268 (DbioA his
Sm
R

) was a gift from A. Campbell [35], and E. coli MEC1
(thr-1 leuB6(Am) glnV44(AS) bioA109 LAM- rfbC1 thi-1;
CGSC#7257) [36] was generously given by the E. coli Gen-
etic Stock Center (Yale, NH, USA). Plasmid pUC18 was
from Promega. Synthetic oligonucleotides were products of
Proligo (Paris, France) and were used without any further
purification. Chemicals were purchased from Sigma-Aldrich
(St Louis, MO, USA) and were of the highest purity avail-
able. Racemic-KAPA was obtained as already described
[37]. (7S,8R)-DAPA was a gift from J. Crouzet (Sanofi-
Aventis, Vitry sur Seine, France). Amiclenomycin was pre-
pared as already described [20]. Dethiobiotin synthase (EC
6.3.3.3) was expressed and purified as previously described
[24]. Restriction endonucleases, Taq polymerase, T4 DNA
ligase and molecular biology kits were from either Promega
or Roche (Meylan, France). Culture medium components
were purchased from Difco Laboratories (Detroit, MI,
USA). Chromatographic equipment (GradiFrac, FPLC)
and column phases were from Amersham Biosciences
Enz-Lys
NH
2
N
O
O
HO
3
P
N
H

R
H
H
H
Enz-Lys
NH
3
N
O
O
HO
3
P
N
H
R
H
H
Enz-Lys
NH
2
N
O
O
HO
3
P
N
H
R

H
H
H
H
Enz-Lys
NH
2
N
O
O
HO
3
P
N
H
R
H
H
H
Base
BaseH
External aldimine
Quinonoid
Aromatic adductPMP adduct
Fig. 8. Proposed inactivation mechanism of DAPA AT by amiclenomycin and analogues. The conserved active-site Lys residue is probably
responsible for the transamination reaction, and the aromatization step is promoted by an as yet unknown base. R represents the various
main chains of the analogues.
M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux
4784 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS
(Orsay, France). UV-visible spectra were obtained on a

Uvikon-930 Kontron (Munchen, Germany) spectrophoto-
meter or a Lambda-40 Perkin–Elmer (Norwalk, CT, USA)
apparatus. Sonication was performed on a VibraCell soni-
cator from Bioblock (Illkirch, France). SDS ⁄ PAGE was
carried out on a Bio-Rad (Hercules, CA, USA) Protean II
system, using the conditions described by the manufacturer.
DNA electrophoresis was performed on a Mupid (Eurogen-
tec, Seraing, Belgium) apparatus, in 40 mm Tris ⁄ acetate
buffer (pH 7.5) ⁄ 1mm EDTA. Centrifugations were per-
formed in a Sorval RF5plus centrifuge (Kendro, Court-
aboeuf, France) or an Eppendorf Centrifuge 5415D
(Eppendorf, Le Pecq, France).
1
H-NMR (400 MHz) and
13
C-NMR (100 MHz) spectra were recorded on a ARX400
Brucker spectrometer (Rheinstetten, Germany). CI mass
spectra were obtained with a Nermag R 30–10 apparatus
(Quad Service, Poissy, France).
Synthesis of compound 1
The aminocyclohexadiene 1, 4-(4c-aminocyclohexa-2,5-dien-
1r-yl)propanol, was prepared from its N-allyloxycarbonyl
precursor 2, i.e., allyl[4c-(3-oxopropyl)-cyclohexa-2,5-dien-
1r-yl]-carbamate, the synthesis of which has already been
published [20]. Phenylsilane (150 lL, 1.2 mmol) and a solu-
tion of Pd(PPh
3
)
4
(15 mg, 0.013 mmol) in dry dichloro-

methane (1.5 mL) were added under argon to a solution of
precursor 2 (167 mg, 0.7 mmol) in dry dichloromethane
(1.5 mL). The mixture was stirred for 50 min at room tem-
perature, concentrated under vacuum and chromatographed
on a silica gel (flash silica, Merck 230, 0.04–0.063 mm) col-
umn using dichloromethane ⁄ methanol (9 : 1, v ⁄ v) as eluent.
Eluted fractions were combined and acidified to pH 4 using
1 m HCl. After concentration under vacuum the hydrochlo-
ride salt of compound 1 was obtained as an yellow oil
(80 mg, 60%).
1
H NMR (D
2
O) d: 1.40–1.48 (m, 4H, CH
2
CH
2
CH
2
O),
2.72 (m, 1H, CHCH
2
), 3.47 (t, 2H, CH
2
O,
3
J ¼ 5.9 Hz),
4.27 (d, 1H, CHNH
2
,

5
J ¼ 7.9 Hz);
13
C NMR (D
2
O) d:
28.22 (CHCH
2
), 29.96 (CH
2
CH
2
CH
2
), 34.74 (CHCH
2
),
45.03 (CHNH
2
), 61.78 (CH
2
OH), 119.90 (NH
2
CHCH ¼
CH), 136.11 (NH
2
CHCH ¼ CH); MS (CI) MH
+
m ⁄ z 154.
Cloning of M. tuberculosis bioA gene

The wild-type and His
6
-tagged bioA recombinant genes
were obtained using PCR amplification of the bioA gene
cloned into plasmid pDEST17 (P. Alzari, Institut Pasteur).
Amplifications were achieved using the Taq DNA polym-
erase (Promega) under the conditions recommended by the
manufacturer but in the presence of 6% (v ⁄ v) dimethyl
sulfoxide. The following sets of primers were used to obtain
the wild-type recombinant gene: 5¢-CGCGCGAATTCAG
GAGGAATTTAAAATGGCTGCGGCGACTGGCGGG-3¢
containing an EcoRI restriction site and a ribosome-binding
site, and 5¢-GCAAGCTTTCATGGCAGTGAGCCTACG
AGCCG-3¢ containing a HindIII restriction site. For the
His
6
-tagged bioA gene, the primers were the following: 5¢-
CGCGCGAATTCAGGAGGAATTTAAAATGCACCAC
CACCACCACCACGCTGCGGCGACTGGCG-3¢ contain-
ing an EcoRI restriction site, a ribosome-binding site and
a His
6
tag coding sequence, and 5¢-GCAAGCTTTCATG
GCAGTGAGCCTACGAGCCG-3¢ containing a HindIII
restriction site. The DNA fragments were purified (PCR
Preps, Promega), digested with EcoRI and HindIII, purified
on agarose gel, and ligated into pUC18 previously cut by
the same restriction enzymes. After transformation in
E. coli JM105, positive clones were selected, and the plas-
mids were extracted and purified (Wizzard Plus Minipreps,

Promega) for DNA sequencing (ECSG, Evry, France).
Plasmids pUC18-MTHis
6
bioA and pUC18-MTbioA were
thus obtained and used to transform various E. coli strains.
Transformation and phenotype determination
E. coli C268 (DbioA his Sm
R
) was transformed with either
plasmid pUC18-MTbioA or plasmid pUC18-MTHis
6
bioA
using the CaCl
2
technique [38]. A control experiment with
no plasmid DNA was run at the same time. Biotin auxotro-
phy was determined by plating the cells on Luria–Bertani
agar medium containing 100 lgÆmL
)1
ampicillin and avidine
(0.45 UÆmL
)1
). Plates were incubated overnight at 37 °C.
Expression and purification of wild-type and
His
6
-tagged recombinant M. tuberculosis DAPA
AT
Wild-type DAPA AT
E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTbioA was

grown overnight at 37 °C in Luria–Bertani medium
(800 mL batches in Erlenmeyer flasks), supplemented with
100 lgÆmL
)1
ampicillin and 50 lgÆmL
)1
chloramphenicol.
The cells were collected by centrifugation (4000 g, 15 min)
and kept at )20 °C until use. All the following steps were
carried out at 4 °C.
Crude extract
The cells were thawed on ice and suspended in 50 mm
Tris ⁄ HCl buffer, pH 8.0, 10 mm 2-mercaptoethanol, 0.2 mm
PLP, and disrupted by sonication for 70 s (seven 10-s pulses
with intermittent 1-min cooling periods). The cellular debris
were removed by centrifugation (10 000 g, 20 min).
Q-Sepharose
The supernatant was loaded on a Q-Sepharose column
(2 cm internal diameter · 14 cm long) equilibrated with
buffer A (50 mm Tris ⁄ HCl buffer, pH 8.0, 10 mm 2-mer-
captoethanol). After the column had been washed with
50 mL buffer A, the proteins were eluted using a linear
S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase
FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4785
gradient (0–0.4 m NaCl in buffer A, 400 mL). Active frac-
tions were detected using the coupled enzymatic assay (see
below) and pooled.
FPLC Mono Q
The enzyme was finally purified on a Mono Q HR 10 ⁄ 10
FPLC column using a linear salt gradient (0–450 mm NaCl

in buffer A, 80 mL). Active fractions were detected using
the coupled enzymatic assay (see below) and pooled. The
purified enzyme solution was desalted and concentrated by
repetitive ultrafiltrations (Centriprep 30; Millipore, Bedford,
MA, USA) and stored in buffer A containing 20% (v⁄ v)
glycerol, at )80 °C.
His
6
-tagged DAPA AT
An overnight preculture (50 mL Luria–Bertani medium,
100 lgÆmL
)1
ampicillin, 50 lgÆ mL
)1
chloramphenicol) of
E. coli BL21 CodonPlus(DE3)RP ⁄ pUC18-MTHis
6
bioA was
used to inoculate 5 L Luria–Bertani medium (1-L batches
in Erlenmeyer flasks) supplemented with 100 lgÆmL
)1
ampi-
cillin and 50 lgÆmL
)1
chloramphenicol. The culture was
shaken (180 r.p.m.) overnight at 37 °C. The cells were col-
lected by centrifugation (4000 g, 15 min) and kept at
)20 °C until use. The following steps were all run at 4 °C.
The cell paste was resuspended in 40 mL buffer B: 50 mm
Tris ⁄ HCl buffer, pH 8.0, 0.5 m NaCl, and the suspension

was sonicated on ice for 70 s (seven 10-s pulses with inter-
mittent 1-min cooling periods). After centrifugation
(10 000 g, 20 min), the supernatant was supplemented with
PLP (0.1 mm final concentration) and directly loaded on a
nickel affinity column (chelating Sepharose; 1.6 cm internal
diameter, 5 cm long, 10 mL) prepared as recommended by
the manufacturer and equilibrated with buffer B. After
loading, the column was washed with 100 mL buffer B,
and the proteins were eluted with 100 mL buffer B contain-
ing 100 mm imidazole and then 100 mL buffer B containing
200 mm imidazole. The column was run at a flow rate of
2mLÆmin
)1
, and 4-mL fractions were collected. The pres-
ence of protein in the fractions was detected using the
Bradford assay, and the purity of individual fractions was
analyzed by SDS ⁄ PAGE. Fractions containing pure DAPA
AT were pooled, and the protein was precipitated by the
addition of ammonium sulfate at 70% saturation. The pre-
cipitated protein was recovered by centrifugation (10 min at
12 000 g), solubilized in 600 lL50mm Tris ⁄ HCl buffer,
pH 8.0, 10 mm 2-mercaptoethanol and dialyzed overnight
against 1 L of the same buffer supplemented with 0.1 mm
PLP. The enzyme solution was then stored at )80 °C.
Determination of the oligomerization state
The native molecular mass of pure M. tubersulosis His
6
-
tagged DAPA AT was estimated by gel filtration on an
FPLC apparatus equipped with a calibrated Superdex 200

HR 10 ⁄ 30 column and using 50 mm Tris ⁄ HCl buffer
(pH 8.0) ⁄ 10 mm 2-mercaptoethanol as eluent (0.5 mLÆmin
)1
flow rate, detection set at 280 nm). Commercial standards
(200 lL) dissolved in the eluent at % 1mgÆmL
)1
(blue dex-
tran, l-tryptophane, b-amylase, BSA, chymotrypsin, alco-
hol dehydrogenase, cytochrome c, carbonic anhydrase,
standards from Sigma) were separated on the column, and
the K
av
measured for each standard was plotted against the
logarithm of their molecular mass [39]. The linear plot thus
obtained was used to estimate the native molecular mass of
the His
6
-tagged DAPA AT (100 lL of a 0.1 mgÆmL
)1
solu-
tion was injected several times, and the average K
av
was
used for the determination).
Protein assay
Protein concentrations were determined using the colori-
metric assay described by Bradford [40] and as supplied by
Bio-Rad.
DAPA AT assays
Coupled assay

The assay (100-lL final volume) consisted of, unless other-
wise stated: 100 mm 4-(2-hydroxyethyl)-1-piperazinepro-
panesulfonic acid (EPPS) buffer, pH 8.6, 10 mm ATP,
50 mm NaHCO
3
,10mm MgCl
2
, dethiobiotin synthase
(800 ng), 0.1 mm PLP, 20 lm KAPA, 1 mm AdoMet and
DAPA AT (185 ng). The mixture was preincubated for
2 min at 37 °C, and the reaction was then initiated by add-
ing the DAPA AT. The reaction was stopped by adding
25 lL 15% (w ⁄ v) trichloroacetic acid, and the dethiobiotin
formed was quantified by the standard disc bioassay proce-
dure, using E. coli C268 as described [24]. One unit is
defined as the amount of enzyme producing 1 lmol product
per min in the conditions described above.
Direct assay
The assay (100 lL final volume) consisted of, unless other-
wise stated: 100 mm EPPS buffer, pH 8.6, 0.1 mm PLP,
20 lm KAPA, 1 mm AdoMet and DAPA AT (0.65 lg).
The assay was run as described above for the coupled
assay. The DAPA formed was quantified by the standard
disc bioassay procedure using E. coli MEC1 [13] in a modi-
fied Vogel–Bonner minimal medium [24], prepared without
casamino acids. A range of authentic DAPA samples from
0.7 to 20 pmol was used as standards.
Although the direct assay is more sensitive and simpler
(no coupling enzyme) than the coupled assay, we found the
former less reliable. Therefore, the coupled assay was used

throughout this work except when high sensitivity was
M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux
4786 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS
required (inactivation studies and alternate amino donor
experiments, see below).
pH profile
The His
6
-tagged M. tuberculosis DAPA AT enzymatic
activity was measured using the coupled assay (as described
above) but at various pH values, using the following buffer
solutions: 100 mm Hepes from pH 6.8 to pH 8.2, 100 mm
EPPS from pH 7.6 to pH 8.6, and 100 mm TAPS (N-
[tris(hydroxymethyl)methyl]-3-aminopropanesulfonic acid)
from pH 7.7 to pH 9.1. The E. coli DAPA AT was purified
as previously described [18] and assayed under the same
conditions. Control experiments were run to ensure that the
dethiobiotin synthase-catalyzed step was never rate deter-
mining in these conditions. The activity versus pH profile
data were fitted to Eqn (1), using a nonlinear regression
analysis supported by Kaleidagraph software (Synergy Soft-
ware, Reading, PA, USA).
Amino donor
The direct enzymatic assay was carried out as described
above, except that AdoMet was replaced by various amines
at concentrations up to 5 mm and a higher amount of His
6
-
tagged M. tuberculosis DAPA AT was used (1.3 lg).
Determination of the kinetic parameters

of DAPA AT
Kinetic parameters were determined on the His
6
-tagged
DAPA AT using the coupled enzymatic assay, as described
above, and by varying AdoMet and KAPA concentrations.
The inhibition type and the inhibition constant displayed by
KAPA were determined using the Hanes–Woolf plot. V
m
and K
mAdoMet
were also derived from the Hanes–Woolf
plot. K
mKAPA
was then estimated using the constant ratio
method, i.e., the rate of the reaction was measured while
keeping the substrate concentrations at a constant ratio.
[AdoMet] ⁄ [KAPA]ratio was set at 125, 250 and 375, and
[AdoMet] was varied from 0.25 mm to 4 mm. It was experi-
mentally difficult to obtain good quality data using lower or
higher molar ratios, because increasing the KAPA concen-
tration led to strong inhibition and increasing the AdoMet
concentration above 4 mm also led to a slight inhibition.
See the Supplementary material for detailed analysis.
Kinetics of DAPA-AT inactivation by
amiclenomycin and compound 1
A solution (35 lL) of His
6
-tagged DAPA AT (8.9 lg) in
50 mm Tris ⁄ HCl buffer, pH 8.0, containing 10 mm

2-mercaptoethanol and amiclenomycin or compound 1 at
various concentrations (for amiclenomycin: 5.7, 11.4, 17.1,
25.7 lm, and 9.8, 22.0, 24.6, 34.4, 30.0, 40.0, 50.0 lm for
compound 1) was incubated at 37 °C. The residual activity
was measured at different time points by withdrawing 3.5-
lL samples of the preincubation mixture and adding them
to the coupled assay mixture. The dethiobiotin formed was
then quantified by the standard disc bioassay, as described
above. Plotting the logarithm of the residual activity
against time gave straight lines, the slope of which gave the
apparent inactivation rate constant, k
obs
. Replotting k
obs
against inhibitor concentration in a double-reciprocal plot
allowed the estimation of K
i
and k
inact
. Inactivation experi-
ments using d-cycloserine or l-cycloserine (1.3 mm)or
gabaculine (1.3 mm) were run under the same conditions.
Titration of DAPA AT by amiclenomycin
His
6
-tagged DAPA AT (8.9 lg, 5.7 lm active sites, based on
a molecular mass of 45 kDa per monomer) was incubated in
50 mm Tris ⁄ HCl buffer, pH 8.0, containing 10 mm 2-merca-
ptoethanol and amiclenomycin or compound 1 (from 1.7 to
5.7 lm). After 45 min of incubation at 37 °C, samples were

withdrawn (3.5 lL, corresponding to 0.89 lg DAPA AT),
and the residual enzymatic activity was measured using the
coupled assay, as described above. Plotting the residual
activity against the molar ratio of inactivator over that of
DAPA AT active sites gave a straight line that extrapolated
to 1.1 for amiclenomycin and to 1.0 for compound 1.
Irreversibility of the inactivation by
amiclenomycin
His
6
-tagged DAPA-AT (4.3 lg) was incubated in 50 mm
Tris ⁄ HCl buffer, pH 8.0, containing 10 mm 2-mercaptoeth-
anol and amiclenomycin (34 lm) for 34 min at 37 °Cina
final volume of 17.5 lL. A 3.5-lL sample was withdrawn,
and the residual activity was measured using the direct en-
zymatic assay, as described above. At the same time, the
remaining mixture was diluted to a final volume of 100 lL
with 50 mm Tris ⁄ HCl buffer (pH 8.0) ⁄ 10 mm 2-mercapto-
ethanol ⁄ 0.1 mm PLP to stop the inactivation process.
The resulting solution was dialyzed against 0.25 L 50 mm
Tris ⁄ HCl buffer (pH 8.0) ⁄ 10 mm 2-mercaptoethanol ⁄
0.1 mm PLP for 15 h at 10 °C. The residual activity of the
enzyme solution was then measured, taking into account
the dilution factor due to the dialysis step. A blank contain-
ing all components but without the inhibitor was carried
out in parallel and treated in the same way.
Effect of compound 1 on E. coli C268/pUC18-
MTHis
6
bioA and M. smegmatis growth

A culture of E. coli C268 ⁄ pUC18-MTHis
6
bioA cells in
Luria–Bertani medium containing 100 lgÆmL
)1
ampicillin
was grown until A
600
reached a value of 0.9. The cells were
S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase
FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4787
then diluted 20 000-fold with sterile modified Vogel–Bonner
medium and plated (50 lL) on a biotin-free Luria–Bertani
agar medium containing 0.45 UÆmL
)1
avidin, 100 lgÆmL
)1
ampicillin and various concentrations of compound 1 (0–
100 lgÆmL
)1
). Control experiments were carried out in the
same manner but either without avidin in the medium or
by adding avidin (0.45 U ÆmL
)1
) and DAPA (100 lm). After
an overnight incubation at 37 °C, isolated colonies were
counted. The same experiments were carried out using
M. smegmatis.
Acknowledgements
We thank Dr P. Alzari for the gift of M. tuberculosis

bioA gene (Rv1568) cloned into a plasmid. M L. Dupre
´
is thanked for technical assistance in calibrating the gel
filtration column, C. Deshayes for excellent technical
assistance in cloning the bioA gene.
References
1 Dye C (2006) Global epidemiology of tuberculosis.
Lancet 367, 938–940.
2 Marquet A, Bui BT & Florentin D (2001) Biosynthesis
of biotin and lipoic acid. Vitam Horm 61, 51–101.
3 Eisenberg MA & Hsiung SC (1982) Mode of action of
the biotin antimetabolites actithiazic acid and alpha-
methyldethiobiotin. Antimicrob Agents Chemother 21,
5–10.
4 Okami Y, Kitahara T, Hamada M, Naganawa H &
Kondo S (1974) Studies on a new amino acid antibiotic,
amiclenomycin. J Antibiot (Tokyo) 27, 656–664.
5 Kitahara T, Hotta K, Yoshida M & Okami Y (1975)
Biological studies of amiclenomycin. J Antibiot (Tokyo)
28, 215–221.
6 Hotta K, Kitahara T & Okami Y (1975) Studies of the
mode of action of amiclenomycin. J Antibiot (Tokyo)
28, 222–228.
7 Poetsch M, Zahner H, Werner RG, Kern A & Jung G
(1985) Metabolic products from microorganisms. 230.
Amiclenomycin-peptides, new antimetabolites of biotin.
Taxonomy, fermentation and biological properties.
J Antibiot (Tokyo) 38, 312–320.
8 Kern A, Kabatek U, Jung G, Werner RG, Poetsh M &
Zahner H (1985) Amiclenomycin peptides: isolation and

structure elucidation of new biotin antimetabolites.
Liebigs Ann Chem 5, 877–892.
9 Keer J, Smeulders MJ, Gray KM & Williams HD
(2000) Mutants of Mycobacterium smegmatis impaired
in stationary-phase survival. Microbiology 146, 2209–
2217.
10 Camus JC, Pryor MJ, Medigue C & Cole ST (2002)
Re-annotation of the genome sequence of Mycobacter-
ium tuberculosis H37Rv. Microbiology 148, 2967–2973.
11 Rodionov DA, Mironov AA & Gelfand MS (2002)
Conservation of the biotin regulon and the BirA regula-
tory signal in Eubacteria and Archaea. Genome Res 12,
1507–1516.
12 Hayakawa K & Oizumi J (1987) Determination of
free biotin in plasma by liquid chromatography
with fluorimetric detection. J Chromatogr 413, 247–
250.
13 Stoner GL & Eisenberg MA (1975) Purification and
properties of 7,8-diaminopelargonic acid aminotransfer-
ase. J Biol Chem 250, 4029–4036.
14 Stoner GL & Eisenberg MA (1975) Biosynthesis of 7,8-
diaminopelargonic acid from 7-keto-8-aminopelargonic
acid and S-adenosyl-l-methionine. The kinetics of the
reaction. J Biol Chem 250, 4037–4043.
15 Breen RS, Campopiano DJ, Webster S, Brunton M,
Watt R & Baxter RL (2003) The mechanism of
7,8-diaminopelargonate synthase; the role of
S-adenosylmethionine as the amino donor. Org Biomol
Chem 1, 3498–3499.
16 Eliot AC, Sandmark J, Schneider G & Kirsch JF (2002)

The dual-specific active site of 7,8-diaminopelargonic
acid synthase and the effect of the R391A mutation.
Biochemistry 41, 12582–12589.
17 Sandmark J, Eliot AC, Famm K, Schneider G & Kirsch
JF (2004) Conserved and nonconserved residues in the
substrate binding site of 7,8-diaminopelargonic acid
synthase from Escherichia coli are essential for catalysis.
Biochemistry 43
, 1213–1222.
18 Kack H, Gibson KJ, Gatenby AA, Schnieder G &
Lindquvist Y (1998) Purification and preliminary X-ray
crystallographic studies of recombinant 7,8-diaminope-
largonic acid synthase from Escherichia coli. Acta Crys-
tallogr Sect D 54, 1397–1398.
19 Kack H, Sandark J, Gibson KJ, Schneider G & Lindq-
vist Y (1999) Crystal structure of diaminopelargonic
acid synthase: evolutionary relationships between pyri-
doxal-5¢-phosphate-dependent enzymes. J Mol Biol 291,
857–876.
20 Mann S, Carillon S, Breyne O & Marquet A (2002)
Total synthesis of amiclenomycin, an inhibitor of biotin
biosynthesis. Chemistry 8, 439–450.
21 Mann S, Carillon S, Breyne O, Duhayon C, Hamon L
& Marquet A (2002) Synthesis and stereochemical ass-
sigments of cis- and trans-1-amino-4-ethylcyclohexa-2,5-
diene as models for amiclenomycin. Eur J Org Chem
2002, 736–744.
22 Sandmark J, Mann S, Marquet A & Schneider G (2002)
Structural basis for the inhibition of the biosynthesis of
biotin by the antibiotic amiclenomycin. J Biol Chem

277, 43352–43358.
23 Mann S, Lesage D, Tabet JC & Marquet A (2003)
Identification of the products of reaction between pyri-
doxalphosphate and amiclenomycin and other related
M. tuberculosis DAPA aminotransferase S. Mann and O. Ploux
4788 FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS
1-amino-cyclohexa-2,5-dienes. Tetrahedron 59, 5209–
5214.
24 Mann S, Florentin D, Lesage D, Drujon D, Ploux O &
Marquet A (2003) Inhibition of diamino pelargonic acid
aminotransferase, an enzyme of the biotin biosynthetic
pathway, by amiclenomycin: a mechanistic study. Helv
Chim Acta 86, 3836–3850.
25 Mann S, Marquet A & Ploux O (2005) Inhibition of
7,8-diaminopelargonic acid aminotransferase by amicle-
nomycin and analogues. Biochem Soc Trans 33, 802–
805.
26 Metzler CM & Metzler DE (1987) Quantitative descrip-
tion of absorption spectra of a pyridoxal phosphate-
dependent enzyme using lognormal distribution curves.
Anal Biochem 166, 313–327.
27 Fersht A (1998) Structure and Mechanism in Protein Sci-
ence: a Guide to Enzyme Catalysis and Protein Folding,
3rd edn. W.H. Freeman, New York.
28 Izumi Y, Sato K, Tani Y & Ogata K (1975) 7,8-Diami-
nopelargonic Acid aminotransferase, an enzyme
involved in biotin biosynthesis by microorganisms.
Agric Biol Chem 39, 175–181.
29 Van Arsdell SW, Perkins JB, Yocum RR, Luan L,
Howitt CL, Chatterjee NP & Pero JG (2005) Removing

a bottleneck in the Bacillus subtilis biotin pathway:
bioA utilizes lysine rather than S-adenosylmethionine
as the amino donor in the KAPA-to-DAPA reaction.
Biotechnol Bioeng 91, 75–83.
30 Segel IH (1975) Enzyme Kinetics. John Wiley & Sons,
New York.
31 Rando RR (1977) Mechanism of the irreversible inhibi-
tion of gamma-aminobutyric acid-alpha-ketoglutaric
acid transaminase by the neutrotoxin gabaculine.
Biochemistry 16, 4605–4610.
32 Olson GT, Fu M, Lau S, Rinehart KL & Silverman RB
(1998) An aromatization mechanism of inactivation of
c-aminobutyric acid aminotransferase for the antibiotic
l-cycloserine. J Am Chem Soc 120, 2256–2267.
33 Peisach D, Chipman DM, Van Ophem PW, Manning
JM & Ringe D (1998) d-Cycloserine inactivation of
d-amino acid aminotransferase leads to a stable nonco-
valent protein complex with an aromatic cycloserine-
PLP derivative. J Am Chem Soc 120, 2268–2274.
34 Fenn TD, Stamper GF, Morollo AA & Ringe D (2003)
A side reaction of alanine racemase: transamination of
cycloserine. Biochemistry 42, 5775–5783.
35 Cleary PP, Campbell A & Chang R (1972) Location of
promoter and operator sites in biotin gene cluster of
Escherichia coli. Proc Natl Acad Sci USA 69, 2219–2223.
36 Rolfe B & Eisenberg MA (1968) Genetic and biochem-
ical analysis of the biotin loci of Escherichia coli K-12.
J Bacteriol 96, 515–524.
37 Ploux O & Marquet A (1996) Mechanistic studies on
the 8-amino-7-oxopelargonate synthase, a pyridoxal-5¢-

phosphate-dependent enzyme involved in biotin biosyn-
thesis. Eur J Biochem 236, 301–308.
38 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring
Harbor Laboratory Press, Plainview.
39 Granath KA & Kvist BE (1967) Molecular weight dis-
tribution analysis by gel chromatography on Sephadex.
J Chromatogr 28, 69–81.
40 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein util-
izing the principle of protein-dye binding. Anal Biochem
72
, 248–254.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Double-reciprocal plot for M. tuberculosis
DAPA AT.
Fig. S2. Double-reciprocal plot for M. tuberculosis
DAPA AT using the constant ratio method.
Fig. S3. Replot of the ordinate intercepts as a function
of 1 ⁄ r, obtained from Fig. S1.
Fig. S4. Replot of the slope obtained from Fig. S1
against r.
Fig. S5. Synthetic scheme for compound 1.
This material is available as part of the online article
from
S. Mann and O. Ploux M. tuberculosis DAPA aminotransferase
FEBS Journal 273 (2006) 4778–4789 ª 2006 The Authors Journal compilation ª 2006 FEBS 4789