Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Identification and characterization of a nuclear receptor
subfamily I member in the Platyhelminth Schistosoma
mansoni (SmNR1)
Wenjie Wu
1,
*, Edward G. Niles
1
, Hirohisa Hirai
2
and Philip T. LoVerde
1
1 Department of Microbiology and Immunology, School of Medicine and Biomedical Science, State University of New York, Buffalo, NY,
USA
2 Primate Research Institute, Kyoto University, Inuyama, Japan
Nuclear receptors (NRs) belong to a superfamily of
transcriptional factors that regulate homeostasis, dif-
ferentiation, metamorphosis and reproduction in meta-
zoans. Members of the nuclear receptor superfamily
are characterized by a modular structure: a conserved
DNA-binding domain (DBD) that contains two zinc
finger motifs binding to the cis-regulatory region of a
target gene, and a conserved ligand-binding domain
(LBD) that is involved in transcriptional activation of
the target gene via ligand and coregulator binding.
Some NRs have no known ligand and are called
orphan receptors [1,2]. A DNA core motif recognized
by a NR is known as a hormone response element.
The typical hormone response element is a consensus
hexameric sequence AGGTCA, which is called a
half-site. NRs can bind to the half-site in different
orientations or repeats either as a monomer, a homo-

dimer or a heterodimer [2]. For heterodimer binding,
Keywords
nuclear receptors; Schistosoma mansoni;
SmNR1 ⁄ SmRXR1 interactions
Correspondence
P. T. LoVerde, Southwest Foundation for
Biomedical Research, PO Box 760549,
San Antonio, TX, 78245–0549, USA
Fax: +1 210 6703322
Tel: +1 210 2589852
E-mail:
*Present address
Southwest Foundation for Biomedical
Research, PO Box 760549, San Antonio,
Texas 78245-0549, USA
Note
The nucleotide sequences reported in this
paper have been submitted to the GenBank
under accession number: AY395037,
AY395051-AY395057
(Received 25 September 2006, revised
6 November 2006, accepted 9 November
2006)
doi:10.1111/j.1742-4658.2006.05587.x
A cDNA encoding a nuclear receptor subfamily I member in the platy-
helminth Schistosoma mansoni (SmNR1) was identified and characterized.
SmNR1 cDNA is 2406 bp long and contains an open reading frame
encoding a 715 residue protein. Phylogenetic analysis demonstrates that
SmNR1 is a divergent member of nuclear receptor subfamily I with no
known orthologue. SmNR1 was localized to S. mansoni chromosome 1 by

fluorescent in situ hybridization. Gene structure of SmNR1 was deter-
mined showing it to consist of eight exons spanning more than 14 kb.
Quantitative real-time RT-PCR showed that SmNR1 was expressed
throughout schistosome development with a higher expression in eggs,
sporocysts and 21-day worms. SmNR1 contains an autonomous transacti-
vation function (AF1) in the A ⁄ B domain as demonstrated in a yeast
one-hybrid assay; it interacts with SmRXR1 in a yeast two-hybrid assay
and in a glutathione S-transferase pull-down assay. Electrophoretic mobil-
ity shift assay showed that SmNR1 could form a heterodimer with
SmRXR1 to bind to DNA elements containing the half-site AGGTCA, a
direct repeat of the half-site separated by 0–5 nucleotides (DR1-DR5)
and a palindrome repeat of the half-site not separated by nucleic acids
(Pal0). Transient transfection in mammalian COS-7 cells showed that
SmNR1 ⁄ SmRXR1 could enhance the transcriptional activation of a
DR2-dependent reporter gene. Our results demonstrate that SmNR1 is a
partner of SmRXR1.
Abbreviations
BAC, bacterial artificial chromosome; DBD, DNA-binding domain; GST, glutathione S-transferase; LBD, ligand-binding domain; NR, nuclear
receptor; RAR, retinoic acid receptor; SD, synthetic dropout.
390 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
the nuclear receptor Retinoic X Receptor (RXR) acts
as a critical partner and thus plays a central role in a
variety of nuclear signaling pathways [3–6].
Schistosoma mansoni is a multicellular eukaryotic
parasite with a complex life cycle that involves mam-
malian and snail hosts. Study of schistosome NRs
enables us to understand how they regulate signaling
pathways in the schistosome itself and to understand
the molecular relationship between the schistosome
and vertebrate and snail hosts. Recently two S. man-

soni RXR homologues, SmRXR1 [7] and SmRXR2
[8,9], have been identified and characterized. SmRXR1
demonstrated that it may have an important role in
regulation female-specific p14 genes [7]. SmRXR2 also
showed a pattern of recognition of cis-sequences pre-
sent in the p14 gene [10]. SmRXR1 and SmRXR2 are
expressed throughout schistosome development sug-
gesting that they play a pleiotropic role in the regula-
tion of a number of genes [7–10]. Study of SmRXR
partners will add to our knowledge of nuclear receptor
gene regulation in schistosomes and to an understand-
ing of the evolution of RXR’s function. We present
herein the characterization of a nuclear receptor sub-
family I member from S. mansoni (SmNR1) and dem-
onstrate its interaction with SmRXR1.
Results
cDNA isolation
A 2343 bp cDNA containing the 5¢-UTR, entire open
reading frame, 3¢UTR and poly A tail was isolated by
PCR. An additional 62 bp 5¢ UTR was extended by 5¢
RACE generating a 2406 bp cDNA. The sequence was
confirmed as belonging to a single mRNA species by
sequencing the products of PCR on single-stranded
cDNA using primers within the 5¢-and 3¢ UTR.
The cDNA of SmNR1 encodes an open reading
frame of 2145 bp corresponding to a 715 amino acid
protein. The DNA binding domain (DBD) is highly
conserved, the P-box (EGCKG), which is involved in
determining DNA binding specificity, is identical to
most members of nuclear receptor subfamily I, for

instance retinoic acid receptor (RAR) and vitamin D3
receptor. In a C-terminal extension of the DBD, the
T-box which corresponds to a dimerization interface is
highly conserved, but the A-box showed less conserva-
tion (for example, 33.3% similarity to hRAR gamma
and 22.2% to dHR3) (Fig. 1A). The hinge region (D
domain) of SmNR1 is unusually long, similar to other
reported schistosome nuclear receptors [7–9,11–14].
The precise length of the D domain was not deter-
mined due to the highly divergent helices 1–2 in the
LBD. However, the DBD terminates at amino acid
332 and the signature sequence of the LBD (Ts) starts
at amino acid 513 (Fig. 1B). The end of the hinge
region to Ts is usually 40 amino acids in most NRs,
and the length of the hinge in SmNR1 thus can be
estimated to be 140 amino acids. The role of the
large hinge in schistosome NRs remains unknown. The
degree of conservation of the LBD in SmNR1 is lower,
helices 1–2 are highly divergent as mentioned above,
like that in other S. mansoni NRs [7–9,11–14].
Although the LBD of SmNR1 is less conserved, the
consensus signature of LBD (F,WY)(A,SI)(K,R,E,G)
XXX(F,L)XX(L,V,IXXX(D,S) (Q,K)XX(L,V)(L,I,F)
[15,16] (from the C-terminus of helix 3 to the middle
of helix 5) and the consensus motif II EFXXXLXXLX
LDXXEXALLKAIXLFSXDRXGLXXXXXVEXLQE
XXXXALXXY [17] (from helix 7 to helix 9) is highly
conserved (Fig. 1B). One amino acid in helix 10 has
been demonstrated to have an important role in het-
erodimer formation with RXRs. In SmNR1, a methi-

onine that occurs at position 668 may be an amino
acid that corresponds to the amino acids found in
hRARc and LXRa [18]. This suggests that helix 10 of
SmNR1 is probably involved in forming a dimer with
SmRXR (Fig. 1B). A putative AF2 activating domain
core (AF2-AD) is present in SmNR1 (Fig. 1B); it
exhibits a high degree of conservation (represented by
CLKEFL) in comparison with the common consensus
AF2-AD core structure of FFXEFF, where F denotes
a hydrophobic residue [19,20].
Phylogenetic analysis
A phylogenetic tree was constructed using the
maximum likelihood method under the Jones–Taylor–
Thornton substitution model, with a gamma distribu-
tion of rates between sites (eight categories, parameter
alpha). Support values for the tree were obtained by
bootstrapping 100 replicates (Fig. 2). The result shows
that SmNR1 is a divergent member belonging to NR
subfamily I. The same result was obtained by Bayesian
inference and neighbor-joining distance analysis (sup-
plementary Figs S1 and S2). Even though SmNR1 was
clustered with Onchocerca volvulus NR1 on the maxi-
mum likelihood tree, the low bootstrap value (29%)
did not support SmNR1 to be an orthologue to
O. volvulus NR1 (Fig. 2).
Chromosome localization and gene organization
A bacterial artificial chromosome (BAC) library of
S. mansoni [21] was screened with a SmNR1-specific
probe, and three positive clones (SmBAC1 28A22,
W. Wu et al. S. mansoni NR1

FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 391
SmBAC1 121N20 and SmBAC1 41A19) were identi-
fied. SmBAC1 41A19 was used as a probe for fluores-
cent in situ hybridization and SmNR1 was localized to
chromosome 1 (Fig. 3).
Gene organization of SmNR1 was determined by
sequencing BAC DNA (SmBAC1 41A19) and by
cDNA alignment with a 24 kb genomic DNA contig
(Contig_0012771) obtained from WTSI S. mansoni
WGS database ( />Trematode/S.mansoni/genome). The SmNR1 gene con-
sists of eight exons spanning over 14 kb (Fig. 4A), and
all splice donor and acceptor sites fit the GT-AG rule
(supplementary Table S1). The 5¢-UTR is encoded by
two exons, A ⁄ B, C (DBD), hinge and E–F domain
(LBD) are each encoded by 2–3 exons, respectively
(Fig. 4B).
We previously demonstrated that the splice junction
in the DBD encoding region was conserved in SmNR1
[22]. In vertebrate NRs, two conserved splice sites were
identified in the LBD encoding region, one is in motif
I (also known as signature sequence of LBD) and the
other is in motif II [17]. The splice junction of motif I
in SmNR1 is at the same position as that found only
in RARs (NR1B) [17] (Fig. 4C). The splice site of
A
DNA binding domain
B Ligand binding domain
Fig. 1. Sequence alignment. (A) Alignment
of DNA binding domain (C domain) and its
C-terminal extension. (B) Alignment of ligand

binding domain (E domain) (after helix 2).
Helices as described in [60] are boxed. The
putative autonomous activation domain
(AF2-AD) is also indicated. The number at
the end of each line indicates residue
position in the original sequence. H3-H12,
helices 3–12.
S. mansoni NR1 W. Wu et al.
392 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
motif II in SmNR1 is located at the same conserved
position as found in all analyzed NRs [17]. The con-
served splice junctions in SmNR1 suggest that the gene
structure of SmNR1 is ancient and has been main-
tained through out evolution of NRs.
Developmental expression
Quantitative real-time RT-PCR was performed to
evaluate mRNA expression of SmNR1. Normalized
gene expression [23] was standardized to the relative
quantities of S. mansoni a-tubulin. SmNR1 was
expressed in all tested stages, with a higher expression
in eggs (19.9-fold greater than male worms), sporocysts
(13.6-fold greater than male worms) and 21-day worms
(6.8-fold greater than male worms). It was expressed in
a similar manner in the other developmental stages
tested (Fig. 5). The results suggest that SmNR1 is
expressed throughout development but may have a
more significant role in the development of eggs,
sporocysts and 21-day worms.
Determination of transactivation
A yeast one-hybrid assay was employed to determine

whether ligand-independent autonomous transactiva-
tion function was present in SmNR1. Yeast strain
AH109 was transformed with pGBKT7-SmNR1,
pGBKT7-SmNR1(A ⁄ B) (containing the A ⁄ B domain)
and pGBKT7-SmNR1(CF) (without the A ⁄ B domain),
respectively, spread on synthetic dropout (SD) ⁄ –Leu
media and SD ⁄ –Leu ⁄ –His medium plus 3 mm 3-AT.
Yeasts transformed with pGBK-SmNR1 or pGBK-
SmNR1(A ⁄ B) grew on both SD ⁄ –Leu medium and
Fig. 2. Phylogenetic tree of SmNR1. A maximum likelihood tree
showing that SmNR1 (in black) is a member of the NR subfamily I.
The phylogenetic tree was constructed by maximum likelihood
method under the Jones–Taylor–Thornton substitution model with a
gamma distribution of rates between sites (eight categories, parame-
ter alpha). Support values for the tree were obtained by boot-
strapping, 100 replicates. The subfamilies are according to the
nomenclature system for the nuclear receptor (for nuclear receptor
nomenclature, see />nomenclature/Nomenclature.html). The GenBank accession numbers
of the analyzed sequences are provided in supplementary Table S2.
Fig. 3. Fluorescent in situ hybridization mapping of SmNR1. Mitotic
metaphase chromosomes (2n ¼ 16) of male schistosomes obtained
from the S. mansoni sporocyst stage. SmBAC 41A19 BAC DNA was
used as a probe and hybridized to chromosome 1. Scale bar ¼ 6 lm.
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 393
SD ⁄ –Trp ⁄ –His medium plus 3 mm 3-AT (Fig. 6A),
while yeasts transformed with pGBK-SmNR1(CF)
grew on SD ⁄ –Leu medium but not on SD ⁄ –Trp ⁄ –His
medium plus 3 mm 3-AT (Fig. 6A). The results sugges-
ted that both full-length and the A ⁄ B domain of

SmNR1 activated transcription of GAL4 reporter gene
in the absence of ligand, while the C-F domain did
not. Thus the A ⁄ B domain exhibits an autonomous
transactivation function (AF-1) element. Yeast trans-
formed with the control plasmids grew as expected (see
the legend to Fig. 6A for a complete explanation).
SmNR1 interacts with SmRXR1
A yeast two-hybrid assay was performed to address
whether SmNR1 interacted with SmRXR1 or
SmRXR2, or acted as a homodimer in a yeast system.
As the A ⁄ B domain of SmNR1 (as demonstrated above)
and SmRXR1 can activate transcription of GAL4
reporter [7], SmNR1(CF) and SmRXR1(CF) were used
in the DBD vectors. Yeast transformed with pSV40⁄
p53 (positive control), pSV40 ⁄ pLamin C (negative
control), pGBK-SmNR1(CF) ⁄ pACT-SmRXR1, pAS-
SmRXR1(CF) ⁄ pGAD-SmNR1, pGBK-SmNR1(CF) ⁄
pACT-SmRXR2, pAS-SmRXR2 ⁄ pGAD-SmNR1 and
pGBK-SmNR1(CF) ⁄ pGAD-SmNR1 grew on SD ⁄
–Trp ⁄ –Leu medium. If SmNR1 interacts with SmRXR1
or SmRXR2, or acts as a homodimer, the Gal4 DNA
binding domain fusion partner will bind to the Gal1
UAS element and the Gal4 activation domain will drive
transcription of HIS reporter gene. Yeasts cotrans-
formed with pGBK-SmNR1(CF) ⁄ pACT-SmRXR1
or pAS-SmRXR1(CF) ⁄ pGAD-SmNR1 grew on SD ⁄
–Trp ⁄ –His ⁄ –Leu medium plus 3 mm 3-AT, indicting
that SmNR1 and SmRXR1 interacted. Yeasts cotrans-
formed with pGBK-SmNR1(CF) ⁄ pACT-SmRXR2,
pAS-SmRXR2 ⁄ pGAD-SmNR1 or pGBK-SmNR1

(CF) ⁄ pGAD-SmNR1 did not grow on SD ⁄ –Trp ⁄
–His ⁄ –Leu medium plus 3 mm 3-AT, indicating that
SmNR1 did not interact with SmRXR2 or act as a
homodimer. The positive control yeast cotransformed
with plasmids pSV40 ⁄ p53 grew on SD ⁄ –Trp ⁄ –His ⁄ –Leu
A
C
B
Fig. 4. Gene structure of SmNR1. (A) Show-
ing exons and size of introns; roman numer-
als indicate exons. (B) Showing the size of
exons and their correspondence to the dif-
ferent NR domains. A ⁄ B, A ⁄ B domain; C, C
domain (DBD); D, D domain (hinge); Ts, sig-
nature sequence of the LBD; E, E domain
(LBD) after Ts. (C) Showing the splice junc-
tion of SmNR1 within motif I which is at the
same position as that found only in RARs
(NR1B) [17]. hRARa, human retinoic acid
receptor alpha (GenBank: AC018629);
CiRAR, C. intestinalis retinoic acid receptor
(www.jgi.doe.gov, Genomic sequence Scaf-
fold (v 1.0): (14). H4, helix 4; H5, helix 5.
Fig. 5. Quantitative real-time RT-PCR shows mRNA expression of
SmNR1. Gene expression [23] of SmNR1 was normalized to the
relative quantities of S. mansoni a-tubulin. For graphical representa-
tion of fold of expression, the normalized expression was recalcu-
lated by dividing the expression level of each stage by the lowest
expression stage (male worms). Egg, eggs; Sp, secondary sporo-
cysts in 30-day infected snail; Cer, Cercariae; 15d, 15-day schistos-

omules; 21d, 21-day schistosomules; 28d, 28-day worms; 35d,
35-day worms; Pair, adult worm pairs; Female, adult female
worms; Male, adult male worms.
S. mansoni NR1 W. Wu et al.
394 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
medium plus 3 mm 3-AT, yeast cotransformed with the
negative control plasmids pSV40 ⁄ pLamin C did not
grow on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus 3 mm 3-AT
as expected (Fig. 6B).
A glutathione S-transferase (GST) pull-down assay
was performed to verify the interaction of SmNR1 and
SmRXR1 in vitro. To address whether the heterodimer
interface is located in the EF domain, both SmNR1
and SmNR1(EF) were employed. GST-SmNR1 and
GST-SmNR1(EF) fusion proteins were immobilized on
glutathione beads.
35
S-labeled SmRXR1 was produced
in a rabbit reticulocyte system. GST protein was
used as a negative control. The pull-down results
showed that both SmNR1 and SmNR1(EF) interacted
with SmRXR1 (Fig. 7A). SmNR1(EF) interacted with
SmRXR1 at a level similar to that of SmNR1 suggest-
ing that there was a heterodimer interface located in
SmNR1 EF domain (Fig. 7B).
DNA binding assays with SmNR1 ⁄ SmRXR1
heterodimers
Electrophoretic mobility shift assays were performed
to determine DNA binding specificity of SmNR1. A
DNA element containing the half-site AGGTCA, a

direct repeat of the half-site spaced with 0–5 nucleic
acids (DR0-DR5) and palindrome repeat of the half-
site not separated by nucleic acids (Pal0) were
employed. No gel shift was observed when c-
32
P-labe-
led half-site DR0-DR5 or Pal0 were added to
SmNR1 alone (Fig. 8). Smears were observed when
the same oligonucleotides were added to SmRXR1,
and strong shifts were observed when the oligonucleo-
tides were added to SmNR1 ⁄ SmRXR1 (Fig. 8). A
weak shift was observed when labeled half-site was
added to SmNR1 ⁄ SmRXR1 (Fig. 8). The results indi-
cated that SmNR1 did not bind to the tested oligonu-
cleotides, SmRXR1 bound to the oligonucleotides in
an unstable state and SmNR1 ⁄ SmRXR1 heterodimer
strongly bound to the target oligonucleotides. The
results suggest that SmNR1 requires heterodimeriza-
tion with SmRXR1 to bind to the tested DNA ele-
ments.
The preference for SmNR1 ⁄ SmRXR1 heterodimer
binding to oligonucleotides was determined by competi-
A
B
Fig. 6. Yeast one and two-hybrid assays. (A) Yeast one hybrid
assay showing that SmNR1 contains an autonomous transactivation
function in A ⁄ B domain. Individual AH109 yeast colonies obtained
from an initial transformation were re-streaked on SD ⁄ –Trp medium
and on SD ⁄ –Trp ⁄ –His medium plus 3 m
M 3-AT. (a) Diagram of

reporter system used in yeast one-hybrid assay. The HIS3 reporter
gene is controlled by binding of the Gal4 DNA binding domain
(GAL4DB) to the GAL4 response elements. When a GAL4BD
fusion protein contains an activation domain, it will transactivate
the expression of the reporter genes. (b) On SD ⁄ –Trp medium,
yeasts transformed with pGBKT7-SmNR1 (streak 1), pGBKT7-
SmNR1(A ⁄ B) (streak 2), pGBKT7-SmNR1(CF) (streak 3), P53 (streak
4), PSV40 ⁄ P53 (streak 6), pLamin C (streak 7) and pLamin
C ⁄ PSV40 (streak 8) grew, because pGBKT7, P53 and pLamin C
plasmids expressed trp gene, yeasts transformed with PSV40 did
not grow because PSV40 plasmid did not express trp gene (streak
5, negative control). (c) On SD ⁄ –Trp ⁄ –His medium plus 3 m
M 3-AT,
yeasts transformed with P53 (streak 4), PSV40 (streak 5), pLamin
C (streak 7) and pLamin C ⁄ PSV40 (streak 8) did not grow, because
P53 and pLamin C plasmids did not express the trp gene. Yeasts
transformed with pGBKT7-SmNR1(CF) (streak 3) did not grow, indi-
cating that the C-F domain of SmNR1 could not active transcription
of the His reporter gene. Yeasts transformed with pGBKT7-SmNR1
(streak 1) and pGBKT7-SmNR1(A ⁄ B) (streak 2) grew indicating that
the A ⁄ B domain contains an activation function to active transcrip-
tion of His reporter gene. PSV40 ⁄ P53 (streak 6, positive control)
grew as expected. (B) Yeast two hybrid assay showing SmNR1
interaction with SmRXR1. (a) Diagram of the system used in yeast
two hybridization. If protein 1 (P1) interacts with protein 2 (P2), the
Gal4 DNA binding domain fusion partner will bind to the Gal1 UAS
element and the Gal4 activation domain will drive transcription of
the expression of the reporter gene. Individual AH109 yeast
colonies obtained from initial transformation were re-streaked
on SD ⁄ –Trp ⁄ –Leu medium (b) and on SD ⁄ –Trp ⁄ –Leu ⁄ –His

medium plus 3 m
M 3-AT (c). Streak 1, pSV40 ⁄ p53 (positive
control); streak 2, pSV40 ⁄ pLamin C (negative control); streak 3,
pGBK-SmNR1(CF) ⁄ pGAD-SmNR1; streak 4, pAS-SmRXR1(CF) ⁄
pGAD-SmNR1; streak 5, pGBK-SmNR1(CF) ⁄ pACT-SmRXR1; streak
6, pAS-SmRXR2 ⁄ pGAD-SmNR1; and streak 7, pGBK-SmNR1(CF) ⁄
pACT-SmRXR2.
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 395
tion of unlabeled DR0-DR5 and Pal0 with c-
32
P-labeled
DR4 (Fig. 9). A 10-, 50- and 200-fold molar excess of
unlabelled oligonucleotides was used for competition.
The results showed that a 10-fold excess of unlabelled
specific oligonucleotides led to a reduction in the signal,
while a 50- and 200-fold excess of unlabelled specific
competitors completely abolished the binding of the
labeled DR4. No reduction of binding was observed
when unlabelled nonspecific oligonucleotides were used
(Fig. 9). The order of preference for SmNR1 ⁄ SmRXR1
heterodimer binding to DNA elements was thus
determined by competition of a 10-fold excess of unlabe-
led specific oligonucleotides to be DR2 > DR5 >
DR3 > DR4 > DR1 > DR0 > Pal0.
To determine the role of the A ⁄ B domain of
SmNR1 in DNA binding, SmNR1(CF) ⁄ SmRXR1
binding to DR1 and DR2 were employed. Although
SmNR1(EF) can form a heterodimer with SmRXR1
(demonstrated by pull-down experiment, Fig. 7), no

shifts were observed when c-
32
P-labeled DR1 and DR2
were added to SmNR1(CF) ⁄ SmRXR1, while strong
shifts were observed when same oligonucleotides were
added to SmNR1⁄ SmRXR1 (Figs 8 and 10). The
results suggested that the A ⁄ B domain of SmNR1 was
necessary for SmNR1 ⁄ SmRXR1 heterodimer to bind
to the tested DNA elements. To determine the role of
the C-terminal extension of SmNR1 and SmRXR1 in
binding to DNA elements, in vitro synthesized SmNR1
(Ile247 to Ser372) (containing 20 amino acids at the 5¢
end of the DBD, the DBD and 40 amino acids at 3¢
end of the DBD) and SmRXR1 (Glu251 to Asn376)
(containing 20 amino acids at 5¢ end of the DBD, the
DBD and 40 amino acids at the 3¢ end of the DBD)
were tested. Both SmNR1 (Ile247 to Ser372) and
SmRXR1 (Glu251 to Asn376) bound to half-site, and
Fig. 8. DNA binding of SmNR1 and SmRXR1 in vitro. A single protein or a combination of two proteins were synthesized in a TNT quick cou-
pled transcription ⁄ translation system (Promega) and allowed to bind to c-
32
P-labeled DNA elements containing a half-site, DR0-DR5 and Pal0.
Lanes 1, 5, 9, 13, 17, 21, 25 and 29 contain lysate from the control transcription-translation reaction as negative controls. Lanes 2, 6, 10, 14,
18, 22, 26 and 30 contain lysate with in vitro translated SmNR1. Lanes 3, 7, 11, 15, 19, 23, 27 and 31 contain lysate with in vitro translated
SmNR1 and SmRXR1. Lanes 4, 8, 12, 16, 20, 24, 28 and 32 contain lysate with in vitro translated SmRXR1. NS, nonspecific binding.
A
B
Fig. 7. GST pull-down assay showing SmNR1 interaction with
SmRXR1 in vitro. (A)
35

S-labeled SmRXR1 was synthesized in vitro
using pCITE-SmRXR1 as template and then incubated with GST-
SmNR1, GST-SmNR1(EF) or GST (negative control) protein affixed
to glutathione-Sepharose beads. The beads were collected, washed
and the bound protein was resolved on 10% SDS acrylamide gel
and visualized by autoradiography. Each experiment was repeated
three times. (a) GST-SmNR1 ⁄ pCITE-SmRXR1 reaction. (b) GST-
SmNR1(EF) ⁄ pCITE-SmRXR1 reaction. (B) Bar graph representation
of the relative band intensities of SmNR1 ⁄ SmRXR1 and
SmNR1(EF) ⁄ SmRXR1 reaction and compared with SmRXR1 input.
(a) GST-SmNR1 ⁄ pCITE-SmRXR1 reaction. (b) GST-SmNR1(EF) ⁄
pCITE-SmRXR1 reaction. The diagram explains the reactions.
S. mansoni NR1 W. Wu et al.
396 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
SmNR1 (Ile247 to Ser372) bound to DR2, weakly to
DR1, DR4 and DR5. SmRXR1 (Glu251 to Asn376)
bound to DR1, DR2, DR4 and DR5 (Fig. 11).
SmNR1 (Ile247 to Ser372) and SmRXR1 (Glu251 to
Asn376) did not form a heterodimer to bind to the
DNA elements. The results suggest that although there
is a dimer interface located in DBD and C-terminal
extension [24–26], the D-E domain has an important
role in SmNR1 ⁄ SmRXR1 heterodimer binding to the
DNA elements. Figure 10 demonstrated that SmNR1
CF could not bind to DR1 or DR2 elements, while
SmNR1 missing both the A ⁄ B and E ⁄ F domains
(Fig. 11) was capable of binding to a half-site and
to several DR elements. We suggest that the E ⁄ F
domains of SmNR1 might prevent the interaction
between the C domain of SmNR1 and DNA response

elements, as previously demonstrated for S. mansoni
RXR2 [8].
Transcriptional activation of a DR2
element-dependent reporter gene
Electrophoretic mobility shift assay results showed
that SmNR1⁄ SmRXR1 heterodimer could bind to DNA
element DR2 strongly. A pUTK-3xDR2 reporter plasmid
was constructed to test the ability of SmNR1 ⁄ SmRXR1
to transactivate DR2-dependent reporter gene in
mammalian COS-7 cells. The results showed that
SmNR1 ⁄ SmRXR1 activated the reporter gene with a
significant difference to control plasmid PcDNA [degrees
of freedom (d.f.) ¼ 9, p ¼ 0.03] (Fig. 12).
Discussion
Phylogenetic analysis shows that SmNR1 is a divergent
member of NR subfamily I with no known orthologue.
This suggests that other unknown NR groups may be
expected to be present in invertebrate lineages as their
sequences become available for analysis. SmNR1 is a
new NR group which does not exist in Drosophila,
Caenorhabditis or vertebrates whose NR complement
is well studied.
Recently an alternative splice variant of SmNR1 was
identified (DQ439962). Our 5¢ sequence (nt 1–84)
aligns to nt 3397–3480 on the genomic DNA Con-
tig_0012771, while the first exon of DQ439962 runs
from nt 4069–4166. Both variants encode the same
protein sequence; this is therefore a case of alternative
splicing in the noncoding region similar to what was
found for the S. mansoni nuclear receptor, SmFtz-F1

[11]. Whether the corresponding mRNAs interact
differently with the translational machinery or have
different stabilities as proposed for SmFTZ-F1 [11] is
yet to be determined.
Fig. 9. Competition of DNA binding to SmNR1 ⁄ SmRXR1 heterodimer in vitro. Combination of SmNR1 and SmRXR1 proteins were synthes-
ized in vitro, added to c-
32
P-labeled DR4. Unlabelled DR0-DR5, Pal0 or unrelated oligonucleotides (·10, ·50 and ·200 fold, respectively) were
added to compete with labeled DR4. Lanes 1, 11 and 21 contain lysate from the control transcription-translation reaction as negative con-
trols. Lanes 2, 12 and 22 contain no competitor. Lanes 3, 13 and 23 contain nonspecific competitor. Lanes 4, 14 and 24 contain DR0 as
competitor. Lanes 5, 15 and 25 contain DR1 as competitor. Lanes 6, 16 and 26 contain DR2 as competitor. Lanes 7, 17 and 27 contain DR3
as competitor. Lanes 8, 18 and 28 contain DR4 as competitor. Lanes 9, 19 and 29 contain DR5 as competitor. Lanes 10, 20 and 30 contain
Pal0 as competitor. NS, nonspecific binding.
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 397
Most NRs which can form a heterodimer with RXR
are from subfamily I, for example, thyroid hormone
receptor and RAR [2]. Our studies show that SmNR1
exhibits similarity to RAR, PPAR and EcR, which
need RXR to form a heterodimer to confer hormone
response element binding [25,27–31]. RXRs have been
characterized in a wide variety of metazoans, including
in Cnidaria [32], Platyhelminths [7–9], Mollusca [33],
Nematoda [34] and Arthropoda [35,36], and verte-
brates [37,38]. The functional relationship between
vertebrate RXR with other NRs was described as the
1-2-3-4-5 rule [39,40] and was extended to insect
RXR ⁄ EcR heterodimers [28]. For example, vertebrate
RXR ⁄ RAR can bind to DR1, DR2 and DR5 but
not to DR3 or DR4, RXR ⁄ vitamin D3 receptor

heterodimer can bind to DR3 but not to DR1, DR2,
DR4 or DR5 [25,27,29,31,41]. In insects, Drosophila
USP (RXR homologue) forms a heterodimer with EcR
that can bind to DR0-DR5 [28] and to an imperfect
palindromic structure [42]. The DNA binding specifici-
ty of RXR ⁄ NR heterodimer in most invertebrates is
not well known. A recent study showed that S. man-
soni SmRXR1 ⁄ SmFtz-F1 heterodimer could bind to
SF-1 element (which contains a conserved half-site
AGGTCA) via SmFtz-F1 physical binding to the
DNA element, while SmRXR1 did not bind to the
DNA [43]. In the mollusk, Biomphalaria glabrata RXR
(BgRXR) was shown to bind to DR1 as a homodimer
or as a heterodimer with mammalian RARa, LXR,
FXR or PPARa [33]. In this study, we showed that
SmNR1 ⁄ SmRXR1 heterodimer could bind to DR0-
DR5, as such it is similar to the Drosophila USP ⁄ EcR
heterodimer [28] but with a different preference order
(Fig. 9). The results suggest that RXR ⁄ NR heterodi-
mer obtained the ability to bind to conserved half-site
repeats before the split of Arthopods and Platyhelm-
inths, but has not subsequently evolved a strict spacing
between half-sites as it can bind to all of DR1 to DR5
elements. This lack of binding specificity is different
from the vertebrate RXR ⁄ RAR interaction that can
bind to DR1, DR2 and DR5 but not to DR3 or DR4
[25,31]. SmRXR1 alone was known to bind to a non-
conserved direct repeat in the promoter region of
S. mansoni p14 gene [7]. In this report, we demonstra-
ted that SmRXR1 alone could also bind to a con-

served half-site and direct repeats of half-site (Fig. 8).
In addition, we showed that SmNR1 ⁄ SmRXR1 het-
erodimer could bind in vitro to a perfect palindrome
(Pal0) containing element (Figs 8 and 9). Further stud-
ies of SmNR1 will help us to understand the mechan-
ism of RXR ⁄ NR signal pathway in invertebrates and
its evolutionary role.
A yeast one-hybrid assay was employed and a ligand-
independent autonomous transactivation function
(AF1) was determined to be present in the A ⁄ B domain
of SmNR1. Furthermore, we demonstrated that the
A ⁄ B domain has an important role in determining
SmNR1 ⁄ SmRXR1 heterodimer binding to the DNA
element. That amino acids in the A ⁄ B domain
can affect DNA binding and dimerization has previ-
ously been reported in the chicken thyroid hormone
receptor [44].
Our data shows that SmNR1 ⁄ SmRXR1 can activate
transcription from a DR2-dependent reporter plasmid
in mammalian cells (Fig. 12). Future studies will exam-
ine transcriptional activation in detail. Although the
full-length of SmNR1 could not bind to the response
element without the presence of SmRXR1 in vitro
(Fig. 8), SmNR1 alone enhanced transactivation of
Fig. 10. DNA binding of SmNR1(CF) ⁄ SmRXR1 in vitro. A single pro-
tein or a combination of two proteins were synthesized in a TNT
quick coupled transcription ⁄ translation system and allowed to bind to
c-
32
P-labeled DR1 and DR2, respectively. Lane 1, lysate from the

control transcription-translation reaction with labeled DR1 as negative
control; lanes 2–4, SmNR1(CF) ⁄ SmRXR1 with labeled DR1 plus indi-
cated amounts of unlabeled DR1 as competitor; lanes 5–7,
SmNR1 ⁄ SmRXR1 plus indicated amounts of unlabeled DR1 as com-
petitor (positive control); lane 8, lysate from the control transcription-
translation reaction with labeled DR2 as negative control; lanes 9–11,
SmNR1(CF) ⁄ SmRXR1 with labeled DR2 plus indicated amounts of
unlabeled DR2 as competitor; lanes 12–14, SmNR1 ⁄ SmRXR1 with
labeled DR2 plus indicated amounts of unlabeled DR2 as competitor
(positive control). NS, nonspecific binding.
S. mansoni NR1 W. Wu et al.
398 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
transcription in mammalian cells. Whether SmNR1
can dimerize with mammalian RXR or whether a low
level of homodimer formation of SmNR1 is needed is
unknown. However, our yeast two-hybrid and pull-
down assays show no evidence for homodimerization
of SmNR1 (Fig. 6, unpublished data). The ability of
SmNR1 ⁄ SmRXR1 to transactivate DR2-dependent
reporter gene in mammalian cells suggests that
SmNR1 ⁄ SmRXR1 can interact with mammalian coac-
tivators of transcription, and S. mansoni coactivators
of transcription may have a similar mechanism to
SmNR1 ⁄ SmRXR1. Recently four NR coactivators,
SmGCN5, SmPRMT1, SmCBP1 and SmCBP2 were
isolated from S. mansoni [45–47]. It was shown that
they could interact with schistosome NRs. For exam-
ple, SmCBP1 interacted with S. mansoni nuclear recep-
tor SmFTZ-F1 and exhibit transcriptional activity in
mammalian cells [47]. Importantly, the interaction of

SmNR1 ⁄ SmRXR1 is demonstrated by in vitro (GST
pull-down assays) and in vivo (yeast two-hybrid and
mammal cell assays) results. Likewise, the ability of
the heterodimer to bind DNA is shown by in vitro
(electrophoretic mobility shift assay) assays and to
bind DNA and drive transcription in a mammalian cell
reporter gene assay in in vivo results.
Experimental procedures
Parasites
The NMRI strain of S. mansoni was maintained in snails
(Biomphalaria glabrata) and Syrian golden hamsters
(Mesocricetus auratus ). Cercariae were released from infec-
Fig. 11. DNA binding of SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376) in vitro. DNA binding of a protein containing 20 amino acids at
the 5¢ end of the DBD, the DBD and the 40 amino acids at the 3¢ end of the DBD of SmNR1 (Ile247-Ser372) and SmRXR1 (Glu251-Asn376)
were tested in vitro. Lanes 1, 5, 9, 13, 17, 21, 25 and 29, lysate from the control transcription-translation reaction as negative control; lanes
2, 6, 10, 14, 18, 22, 26 and 30 contain with lysate with in vitro translated SmNR1(Ile247-Ser372); lanes 3, 7, 11, 15, 19, 23, 27 and 31, lysate
with in vitro translated SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376); lanes 4, 8, 12, 16, 20, 24, 28 and 32, lysate with in vitro trans-
lated SmRXR1(Glu251-Asn376). NS, nonspecific binding.
0
1
2
3
4
5
6
PcDNA SmNR1 SmRXR1
SmNR1+SmRXR1
*
Fold activation
Fig. 12. SmNR1 ⁄ SmRXR1 transactivated DR2-dependent reporter

gene in vivo. Mammalian COS-7 cells were transfected with pUTK-
DR2 reporter plasmids, pRL4.74 and various expression plasmids
for pcDNA-3.1, SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1. Cells
were lysed and luciferase activities were measured 48 h after
transfection. Results are expressed in fold activation (relative to the
pcDNA-3.1 vector control). Each experiment was repeated at least
three times. The statistical significance of increase in luciferase
activities of cells transfected with SmNR1, SmRXR1 and
SmNR1 ⁄ SmRXR1 compared to cells transfected with pCDNA-3.1
was determined using Student’s t-test ( d.f. ¼ 9, *P < 0.05).
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 399
ted snails and harvested on ice. Schistosome worms of dif-
ferent ages (15–45 days old) were harvested from infected
Syrian golden hamsters. Single-sex worms were obtained by
separating adult worm pairs.
Isolation of SmNR1 cDNA
PCR was performed using S. mansoni female worm phage
cDNA library pool [pBluescript SK (+ ⁄ –) phagemid] as
template DNA. The PCR primers for one end (either the 5¢
or 3¢ end) were designed according to the cDNA sequence
of a short fragment previously cloned [22]. The primer for
the other end (either the 5¢ or 3¢ end) was a vector universal
primer (M13-Rev and T3, or M13-For and T7 primers).
The 5¢-UTR was extended by rapid amplification of cDNA
ends (RACE) using SMART
TM
RACE cDNA Amplifica-
tion Kit (BD Biosciences Clontech, Mountain View, CA
94043, USA). The sequence was confirmed as belonging to

a single mRNA species by sequencing the products of PCR
on single-stranded cDNA using primers within 5¢- and
3¢-UTR.
Sequence analysis and phylogenetic tree
construction
The phylogenetic tree was constructed using deduced
DBD and LBD sequences (after helix 2) aligned
with clustalw ( />Downloads/clustalw.html) (supplementary Fig. S3). Phylo-
genetic analysis of the data set was carried out using the
maximum likelihood method under the Jones–Taylor–
Thornton substitution model [48] with a gamma distribu-
tion of rates between sites (eight categories, parameter
alpha, estimated by the program) using phyml (v2.4.4)
[49]. Support values for the tree were obtained by boot-
strapping 100 replicates.
The same data set was also tested by Bayesian inference
[50] and neighbor-joining distance [51] methods. For
Bayesian inference, the data set was analyzed under the
Jones–Taylor–Thornton substitution model with a gamma
distribution of rates between sites using mrbayes v3.1.1
[50]. The trees were started randomly; four simultaneous
Markov chains were run for 3 million generations. The
trees were sampled every 100 generations. Bayesian poster-
ior probabilities were calculated using a Markov chain
Monte Carlo (MCMC) sampling approach implemented in
mrbayes v3.1.1, with a burn-in value setting at 7500 gener-
ations. For neighbor-joining distance analysis, the data set
was analyzed under Jones–Taylor–Thornton substitution
model with a gamma distribution of rates between sites
(eight categories, parameter alpha, estimated using

PHYML) using phylip package v3.62 (http://evolution.
genetics.washington.edu/phylip.html). Support values for
the tree were obtained by bootstrapping a 1000 replicates
with seqboot implemented in the phylip package v3.62.
BAC library screening, BAC DNA sequencing and
chromosomal fluorescent in situ hybridization
S. mansoni SmBAC1 library was screened as previously
described [21]. A SmNR1 specific probe of 497 bp was
produced by PCR amplification with TOPO 2.1-SmNR1 as
a template (forward primer: 5¢-ATTTCAGAAGTTGAAC
AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT
GAAGATGATGGTTGA-3¢), purified from agarose gel
using Gel Extraction kit (Qiagen, Valencia, CA, USA) and
randomly labeled with
32
P using a Metaprime kit (Amer-
sham Pharmacia Biotech Inc., Piscataway, NJ, USA). For
BAC DNA sequencing, the BAC clone was grown in
100 mL LB medium (12.5 lgÆmL
)1
choramphenicol), BAC
DNA was purified using Plasmid Midi kit (Qiagen) and se-
quenced on an ABI-377 automatic sequencing machine
(Applied Biosystems, Foster City, CA, USA).
Fluorescent in situ hybridization was performed on
S. mansoni sporocyst metaphase chromosome spreads with
BAC DNA using techniques previously described [52,53].
Genomic sequence analysis and gene
organization
Exon ⁄ intron boundaries of SmNR1 were determined by

sequencing BAC DNA of SmBAC1 41A19 obtained by BAC
library screening. Primers were designed according to the
different regions of cDNA and the entire encoding regions
were sequenced. Intron sizes were determined by alignment
of cDNA with a genomic DNA contig (Contig_0012771)
obtained from WTSI database ( />databases/Trematode/S.mansoni/genome).
Quantitative real-time RT-PCR
mRNA expression of SmNR1 in eggs, secondary sporocysts
(in 30-day infected snail), cercariae, 15-day schistosomules,
21-day schistosomules, 28-day worms, 35-day worms, adult
worm pairs, adult female worms and adult male worms
were analyzed by quantitative real time RT-PCR. Total
RNA was extracted using TRIzol reagent (Invitrogen, Car-
lsbad, CA, USA), treated with RNase-free DNaseI (RQ1
DNase; Promega, Madison, WI, USA) and reverse tran-
scribed using a random hexamer and SuperScript Reverse
Transcriptase II (SSRTaseII; Invitrogen) [22]. Reverse-tran-
scribed cDNA samples were used as templates for PCR
amplification using SYBR Green Master Mix
Ò
(Invitrogen)
and BIO-RAD IQ
TM
5 Real-Time PCR Detection System
(Bio-Rad Laboratories, Hercules, CA 94547, USA). Primers
specific for SmNR1 (forward: 5¢-AAAAACATCCCCC-
ATTTCAGAA-3¢, reverse: 5¢-AACTACGCACATTCGGG-
TTGA-3¢) were designed by Primer Express Program
(Applied Biosystems
TM

) and primers specific for S. mansoni
a-tubulin (GenBank M80214) were designed according to
[54]. The efficiency for each primer set is evaluated and
S. mansoni NR1 W. Wu et al.
400 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
recorded during assay development by iQ5 application
(cDNA is diluted to ·1-, ·10-, ·100- and ·1000-fold; see
protocol of Bio-Rad iQ5 application). Normalized gene
expression [23] of SmNR1 was calculated and standardized
to the relative quantities of S. mansoni a-tubulin using Bio-
Rad IQ
TM
5 Optical System software v1.1 with the Normal-
ized Expression calculations implemented in iQ5 according
to the manufacturer’s protocol. For graphical representa-
tion of fold of expression, the normalized expression was
recalculated by dividing the expression level of each stage
by the lowest expression level by iQ5.
Yeast one-hybrid assay
cDNA encoding full-length, C-F domain (Cys267-Phe715)
and A ⁄ B domain (Met1-Met266) of SmNR1 were inserted
into the DNA binding domain vector pGBK-T7 to
form pGBK-SmNR1, pGBK-SmNR1(CF) and pGBK-
SmNR1(A ⁄ B), respectively. Yeast strain AH109 (with
LacZ ⁄ His reporter genes) was transformed with 1 lg
of pGBK-SmNR1, pGBK-SmNR1(CF) and pGBK-
SmNR1(A ⁄ B), respectively, spread on SD medium lacking
tryptophan (SD ⁄ –Trp) and SD medium lacking tryptophan
and histidine (SD ⁄ –Trp ⁄ –His) plus 3 mm 3-amino-1,2,4-
triazole (3-AT, an inhibitor to prevent the leaky expression

of HIS3 gene in host cell), and then incubated at 30 °C.
Transformations were performed using Frozen-EZ transfor-
mation II kit (Zymo Research, Orange, CA, USA). The col-
onies from SD ⁄ –Leu medium were streaked on SD ⁄ –Trp ⁄
–His medium plus 3 mm 3-AT to confirm the result. Yeasts
transformed with p53, pLamin C, pSV40, pLaminc C ⁄ pSV40
and p53 ⁄ pSV40 (Stratagene, La Jolla, CA, USA) were used
as positive or negative controls, respectively.
Yeast two-hybrid assay
cDNA encoding SmNR1 was inserted into the activation
domain vector pGAD-T7 to form pGAD-SmNR1. pGBK-
SmNR1(CF) was the same as for the yeast one-hybrid ana-
lysis. cDNA encoding full-length and the C-F domain of
SmRXR1 (GenBank AF094759) and SmRXR2 (GenBank
AF129816) were previously ligated into activation domain
vector pACT2 to form pACT-SmRXR1 and pACT-
SmRXR2, and ligated into DNA binding domain vector
pAS2 to form pAS-SmRXR1(CF) and pAS-SmRXR2 pre-
viously [7,9,10,55]. Yeast strain AH109 was transformed
with 1 lg of the following plasmids: pAS-SmRXR1(CF),
pAS-SmRXR2, pGBK-SmNR1(CF), pACT-SmRXR1,
pACT-SmRXR2, pGAD-SmNR1, and control plasmids
pLamin C, pSV40 and p53. The following cotransfor-
mations were performed: pGBK-SmNR1(CF) ⁄ pACT-
SmRXR1, pGAD-SmNR1 ⁄ pAS-SmRXR1(CF), pGBK-
SmNR1(CF) ⁄ pACT-SmRXR2, pGAD-SmNR1 ⁄ pAS-
SmRXR2, pGBK-SmNR1(CF) ⁄ pGAD-SmNR1, pSV40 ⁄
p53 and pSV40 ⁄ pLamin C. Transformations were
performed using Frozen-EZ transformation II kit (Zymo
Research). Yeast from single transformations of DNA

binding domain constructs were spread on SD ⁄ –Trp med-
ium and SD ⁄ –Trp ⁄ –His medium plus 3 mm 3-AT. Yeasts
from single transformations of activation domain constructs
were spread on SD ⁄ –Leu medium and SD ⁄ –Leu ⁄ –His med-
ium plus 3 mm 3-AT. All cotransformed yeasts were plated
on SD ⁄ –Trp ⁄ –Leu medium and SD medium lacking trypto-
phan, leucine, histidine HCl monohydrate and adenine
hemisulfate salt (SD ⁄ –Trp ⁄ –His ⁄ –Leu ⁄ –Ade) medium plus
3mm 3-AT.
GST pull-down assay
cDNA encoding SmRXR1 was inserted into pCITE-4a
vector to form pCITE-SmRXR1. cDNA inserts were tran-
scribed and translated using Single Tube Protein System
(Novagen, Madison, WI, USA). The manufacturer’s pro-
tocol for
35
S-methionine incorporation was followed.
cDNA encoding full-length and the E-F domain (Leu433-
Phe715) of SmNR1 were inserted into pGEX-4T-1 vector
to form pGEX-SmNR1 and pGEX-SmNR1(EF). Escheri-
chia coli ad 494 (DE3) pLys S competent cells (Novagen)
were transformed with pGEX-SmNR1 and pGEX-
SmNR1(EF), respectively, and induced with isopropyl
thio-b-d-galactoside to produce GST fusion proteins that
were subsequently affinity purified over a glutathione-seph-
arose column all by standard techniques. For pull-down
assays, 50 lL of binding mixture containing binding buffer
(50 mm Tris ⁄ HCl, pH 7.5, 100 mm NaCl, 10% glycerol,
0.15% Nonidet P40), GST-SmNR1 or GST-SmNR1(EF)
fusion protein affixed to glutathione-sepharose beads

(about 2 lg) and 2 lLofin vitro translation reaction was
used. The reaction was incubated overnight at 4 °C and
washed three times with binding buffer [56]. The bound
proteins were analyzed by running on 10% SDS ⁄ PAGE
and autoradiography.
Electrphoretic mobility shift assay
cDNAs encoding SmNR1, SmNR1(CF) (Cys267-Phe715),
SmNR1(Ile247-Ser372) (containing 20 amino acids at the
5¢ end of DBD, DBD and 40 amino acids at the 3¢ end
of DBD), SmRXR1 and SmRXR1(Glu251-Asn376) (con-
taining 20 amino acids at the 5¢ end of DBD, DBD and
40 amino acids at the 3¢ end of DBD) were inserted
into pCITE-4a vector to form pCITE-SmNR1, pCITE-
SmNR1(CF), pCITE-SmNR1(Ile247-Ser372), pCITE-
SmRXR1 and pCITE-SmRXR1(Glu251-Asn376). The
proteins were produced in vitro using the TNT quick
coupled transcription ⁄ translation system (Promega). The
following complementary single-stranded oligonucleotides
containing consensus half-sites AGGTCA [40,57,58] were
synthesized: half-site: 5¢-GTACCGTAAGGTCACTCGC
GT-3¢, DR0: 5¢-CCGTAAGGTCAAGGTCACTCG-3¢,
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 401
DR1: 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2:
5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCG
TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA
GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG
TCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGT
CATGACCTCG-3¢. One strand of each oligonucleotide was
annealed after incubation at 100 °C for 3 min to its comple-

mentary oligonucleotide and then labeled with T4 polynucle-
otide kinase and [c-
32
P]adenosine triphosphate. The binding
reactions were incubated on ice for 40 min in 15 lL reaction
mixture containing 40 000 cpm probes, 3 lL in vitro transla-
tion reaction, 3 lL5· buffer [20% glycerol, 5 mm MgCl
2
,
2.5 mm EDTA, 2.5 mm dithiothreitol, 250 mm NaCl, 50 mm
Tris ⁄ HCl (pH 7.5), 0.25 mg mL
)1
poly(dI-dC)Æpoly(dI-dC)],
and then separated on 6% (v ⁄ v) native polyacrylamide gel
containing 2.5% glycerol in 1· TBE buffer at 4 °C. Gel was
dried, exposed to X-ray film and autoradiographed.
Mammalian cell culture and transfection
cDNAs coding SmNR1 and SmRXR1 were amplified by
PCR, cloned into pENTR ⁄ SD ⁄ D-TOPO vector (Invitro-
gen) and transferred into pcDNA-3.1 destination vectors
using Gateway LR Clonase enzyme (Invitrogen). pUTK-
3xDR2 was constructed by inserting oligonucleotides con-
taining three copies of DR2 (ACGCTCACTGGAACACT
GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG
GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG
GAATGCCTCTAG) upstream of the thymidine-kinase
promoter of reporter plasmid pUTK-Luc vector, which
contains a firefly luciferase encoding sequence under the
control of a Herpes simplex virus thymidine-kinase promo-
ter [59]. pRL4.74 (Promega, containing a renilla luciferase

reporter gene under the control of a cytomegalovirus pro-
moter) was used as an internal control. Mammalian COS-7
cells were maintained in Dulbecco’s modified Eagle’s med-
ium supplemented with 10% (V ⁄ V) fetal bovine serum. For
transfection, cells were plated at a density of 1.5 · 10
5
cell-
s ⁄ per well in 24 well culture plates with Dulbecco’s modified
Eagle’s medium supplemented with 10% (V ⁄ V) fetal bovine
serum. Transfection was done following the instruction of
Lipofectamine
TM
2000 (Invitrogen), the mix containing
1 lL Lipofectamine
TM
2000 (Invitrogen), 0.4 lg expression
plasmids, 0.375 lg reporter plasmids and 0.025 lg pRL4.74
(Promega). Forty-eight hours after transfection, COS-7 cells
were lysed and the luciferase activity was measured by Dual
Luciferase Reporter Assay system (Promega) and Veritas
TM
Microplate Luminometer (9100–001, Turner BioSystems,
Sunnyvale, CA, USA). Expression of the firefly luciferase
was normalized by expression of Renilla luciferase. Fold
activation of the reporter gene was calculated by dividing
the normalized firefly luciferase value of each expression
plasmid by that of the control vector pcDNA-3.1. The sta-
tistical significance of increase in luciferase activities of cells
transfected with SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1
compared to cells transfected with pcDNA-3.1 was deter-

mined using Student’s t-test (d.f. ¼ 9).
Acknowledgements
The authors thank R. Pierce, Institut Pasteur de Lille for
valuable suggestions. This research was supported by
NIH grant AI046762. Schistosome infected snails were
obtained from Fred Lewis (Biomedical Research Insti-
tute), through NIH supply contract no. AI30026.
Genomic DNA sequence (Contig_0012771) was pro-
duced by Schistosoma mansoni Genome Project at the
Sanger Institute and can be obtained from ger.
ac.uk/pub/databases/Trematode/S.mansoni/genome.
References
1 Gronemeyer H & Laudet V (1995) Transcription factors
3: nuclear receptors. Protein Profile 2, 1173–1308.
2 Laudet V & Gronemeyer H (2001) The Nuclear Recep-
tor Factsbook. Academic Press, New York, NY.
3 Berrodin TJ, Marks MS, Ozato K, Linney E & Lazar
MA (1992) Heterodimerization among thyroid hormone
receptor, retinoic acid receptor, retinoid X receptor,
chicken ovalbumin upstream promoter transcription fac-
tor, and an endogenous liver protein. Mol Endocrinol 6,
1468–1478.
4 Leid M, Kastner P, Lyons R, Nakshatri H, Saunders M,
Zacharewski T, Chen JY, Staub A, Garnier JM, Mader S
et al. (1992) Purification, cloning, and RXR identity of
the HeLa cell factor with which RAR or TR heterodimeri-
zes to bind target sequences efficiently. Cell 68, 377–395.
5 Mangelsdorf DJ, Thummel C, Beato M, Herrlich P,
Schutz G, Umesono K, Blumberg B, Kastner P, Mark
M, Chambon P et al. (1995) The nuclear receptor super-

family: the second decade. Cell 83, 835–839.
6 Zhang XK, Hoffmann B, Tran PB, Graupner G &
Pfahl M (1992) Retinoid X receptor is an auxiliary pro-
tein for thyroid hormone and retinoic acid receptors.
Nature 355, 441–446.
7 Freebern WJ, Osman A, Niles EG, Christen L &
LoVerde PT (1999) Identification of a cDNA encoding
a retinoid X receptor homologue from Schistosoma
mansoni. Evidence for a role in female-specific gene
expression. J Biol Chem 274, 4577–4585.
8 de Mendonca RL, Escriva H, Bouton D, Zelus D,
Vanacker JM, Bonnelye E, Cornette J, Pierce RJ &
Laudet V (2000) Structural and functional divergence of
a nuclear receptor of the RXR family from the trema-
tode parasite Schistosoma mansoni. Eur J Biochem 267,
3208–3219.
9 Freebern WJ, Niles EG & LoVerde PT (1999) RXR-2,
a member of the retinoid x receptor family in Schisto-
soma mansoni. Gene 233, 33–38.
S. mansoni NR1 W. Wu et al.
402 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
10 Fantappie MR, Freebern WJ, Osman A, LaDuca J,
Niles EG & LoVerde PT (2001) Evaluation of Schisto-
soma mansoni retinoid X receptor (SmRXR1 and
SmRXR2) activity and tissue distribution. Mol Biochem
Parasitol 115, 87–99.
11 de Mendonca RL, Bouton D, Bertin B, Escriva H, Noel
C, Vanacker JM, Cornette J, Laudet V & Pierce RJ
(2002) A functionally conserved member of the FTZ-F1
nuclear receptor family from Schistosoma mansoni. Eur

J Biochem 269, 5700–5711.
12 Hu R, Wu W, Niles EG & LoVerde PT (2006) SmTR2 ⁄ 4,
a Schistosoma mansoni homologue of TR2 ⁄ TR4 orphan
nuclear receptor. Int J Parasitol 36, 1113–1122.
13 Hu R, Wu W, Niles EG & LoVerde PT (2006) Isolation
and characterization of Schistosoma mansoni constitu-
tive androstane receptor. Mol Biochem Parasitol 148,
31–43.
14 Lu C, Wu W, Niles EG & LoVerde PT (2006) Identifi-
cation and characterization of a novel fushi tarazu
factor 1 (FTZ-F1) nuclear receptor in Schistosoma
mansoni. Mol Biochem Parasitol 150, 25–36.
15 Wang LH, Tsai SY, Cook RG, Beattie WG, Tsai MJ &
O’Malley BW (1989) COUP transcription factor is a
member of the steroid receptor superfamily. Nature 340 ,
163–166.
16 Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon
P, Moras D & Gronemeyer H (1996) A canonical struc-
ture for the ligand-binding domain of nuclear receptors.
Nat Struct Biol 3, 206.
17 Zhang Z, Burch PE, Cooney AJ, Lanz RB, Pereira FA,
Wu J, Gibbs RA, Weinstock G & Wheeler DA (2004)
Genomic analysis of the nuclear receptor family: new
insights into structure, regulation, and evolution from
the rat genome. Genome Res 14, 580–590.
18 Vivat-Hannah V, Bourguet W, Gottardis M & Grone-
meyer H (2003) Separation of retinoid X receptor
homo- and heterodimerization functions. Mol Cell Biol
23, 7678–7688.
19 Perissi V, Staszewski LM, McInerney EM, Kurokawa

R, Krones A, Rose DW, Lambert MH, Milburn MV,
Glass CK & Rosenfeld MG (1999) Molecular determi-
nants of nuclear receptor–corepressor interaction. Genes
Dev 13, 3198–3208.
20 Nagy L, Kao HY, Love JD, Li C, Banayo E, Gooch
JT, Krishna V, Chatterjee K, Evans RM & Schwabe
JW (1999) Mechanism of corepressor binding and
release from nuclear hormone receptors. Genes Dev 13 ,
3209–3216.
21 Le Paslier MC, Pierce RJ, Merlin F, Hirai H, Wu W,
Williams DL, Johnston D, LoVerde PT & Le Paslier D
(2000) Construction and characterization of a Schisto-
soma mansoni bacterial artificial chromosome library.
Genomics 65, 87–94.
22 Wu W, Niles EG, El-Sayed N, Berriman M & LoVerde
PT (2006) Schistosoma mansoni (Platyhelminthes,
Trematoda) nuclear receptors: sixteen new members and
a novel subfamily. Gene 366, 303–315.
23 Livak K & Schmittgen T (2001) Analysis of relative
gene expression data using real-time quantitative PCR
and the 2 (-Delta Delta C(T)) Method. Methods 25,
402–408.
24 IJpenberg A, Jeannin E, Wahli W & Desvergne B (1997)
Polarity and specific sequence requirements of peroxi-
some proliferator-activated receptor (PPAR) ⁄ retinoid X
receptor heterodimer binding to DNA. A functional
analysis of the malic enzyme gene PPAR response
element. J Biol Chem 272, 20108–20117.
25 Predki PF, Zamble D, Sarkar B & Giguere V (1994)
Ordered binding of retinoic acid and retinoid-X recep-

tors to asymmetric response elements involves determi-
nants adjacent to the DNA-binding domain. Mol
Endocrinol 8, 31–39.
26 Wilson TE, Paulsen RE, Padgett KA & Milbrandt J
(1992) Participation of non-zinc finger residues in DNA
binding by two nuclear orphan receptors. Science 256,
107–110.
27 Andersson ML, Nordstrom K, Demczuk S, Harbers M
& Vennstrom B (1992) Thyroid hormone alters the DNA
binding properties of chicken thyroid hormone receptors
alpha and beta. Nucleic Acids Res 20, 4803–4810.
28 Antoniewski C, Mugat B, Delbac F & Lepesant JA
(1996) Direct repeats bind the EcR ⁄ USP receptor and
mediate ecdysteroid responses in Drosophila melanogas-
ter. Mol Cell Biol 16, 2977–2986.
29 Desvergne B (1994) How do thyroid hormone receptors
bind to structurally diverse response elements? Mol Cell
Endocrinol 100, 125–131.
30 Schaefer F, Yoon SA, Nouri P, Tsao T, Tummala P,
Deng E & Rabkin R (2004) Growth hormone-mediated
janus associated kinase-signal transducers and activators
of transcription signaling in the growth hormone-resis-
tant potassium-deficient rat. J Am Soc Nephrol 15,
2299–2306.
31 Schrader M & Carlberg C (1994) Thyroid hormone and
retinoic acid receptors form heterodimers with retinoid
X receptors on direct repeats, palindromes, and inverted
palindromes. DNA Cell Biol 13 , 333–341.
32 Kostrouch Z, Kostrouchova M, Love W, Jannini E,
Piatigorsky J & Rall JE (1998) Retinoic acid X receptor

in the diploblast, Tripedalia cystophora. Proc Natl Acad
Sci USA 95, 13442–13447.
33 Bouton D, Escriva H, de Mendonca RL, Glineur C,
Bertin B, Noel C, Robinson-Rechavi M, de Groot A,
Cornette J, Laudet V et al. (2005) A conserved retinoid
X receptor (RXR) from the mollusk Biomphalaria glab-
rata transactivates transcription in the presence of reti-
noids. J Mol Endocrinol 34, 567–582.
34 Shea C, Hough D, Xiao J, Tzertzinis G & Maina CV
(2004) An rxr ⁄ usp homolog from the parasitic nema-
tode, Dirofilaria immitis. Gene 324, 171–182.
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 403
35 Oro AE, McKeown M & Evans RM (1990) Relation-
ship between the product of the Drosophila ultraspiracle
locus and the vertebrate retinoid X receptor. Nature
347, 298–301.
36 Guo X, Xu Q, Harmon MA, Jin X, Laudet V, Mangels-
dorf DJ & Palmer MJ (1998) Isolation of two functional
retinoid X receptor subtypes from the Ixodid tick,
Amblyomma americanum (L.). Mol Cell Endocrinol 139,
45–60.
37 Chambon P, Mader S, Garnier J-M, Staub A, Chen J-Y,
Zacharewsi T, Saunders M, Nakshatri H, Lyons R, Kast-
ner P et al. (1992) Purification, cloning, and RXR iden-
tity of the HeLa cell factor with which RAR or TR
heterodimerizes to bind target sequences efficiently. Cell
71, 887.
38 Mangelsdorf DJ, Ong ES, Dyck JA & Evans RM
(1990) Nuclear receptor that identifies a novel retinoic

acid response pathway. Nature 345, 224–229.
39 Shulemovich K, Dimaculangan DD, Katz D & Lazar
MA (1995) DNA bending by thyroid hormone receptor:
influence of half-site spacing and RXR. Nucleic Acids
Res 23, 811–818.
40 Umesono K, Murakami KK, Thompson CC & Evans
RM (1991) Direct repeats as selective response elements
for the thyroid hormone, retinoic acid, and vitamin D3
receptors. Cell 65, 1255–1266.
41 Shaffer PL & Gewirth DT (2004) Vitamin D receptor–
DNA interactions. Vitam Horm 68, 257–273.
42 Cherbas L, Lee K & Cherbas P (1991) Identification of
ecdysone response elements by analysis of the Droso-
phila Eip28 ⁄ 29 gene. Genes Dev 5, 120–131.
43 Bertin B, Caby S, Oger F, Sasorith S, Wurtz JM &
Pierce RJ (2005) The monomeric orphan nuclear recep-
tor Schistosoma mansoni Ftz-F1 dimerizes specifically
and functionally with the schistosome RXR homologue,
SmRXR1. Biochem Biophys Res Commun 327, 1072–
1082.
44 Hadzic E, Habeos I, Raaka BM & Samuels HH (1998)
A novel multifunctional motif in the amino-terminal
A ⁄ B domain of T3Ralpha modulates DNA binding
and receptor dimerization. J Biol Chem 273, 10270–
10278.
45 de Moraes Maciel R, de Silva Dutra DL, Rumjanek
FD, Juliano L, Juliano MA & Fantappie MR (2004)
Schistosoma mansoni histone acetyltransferase GCN5:
linking histone acetylation to gene activation. Mol
Biochem Parasitol 133, 131–135.

46 Mansure JJ, Furtado DR, de Oliveira FM, Rumjanek
FD, Franco GR & Fantappie MR (2005) Cloning of a
protein arginine methyltransferase PRMT1 homologue
from Schistosoma mansoni: evidence for roles in nuclear
receptor signaling and RNA metabolism. Biochem
Biophys Res Commun 335, 1163–1172.
47 Bertin B, Oger F, Cornette J, Caby S, Noel C, Capron
M, Fantappie MR, Rumjanek FD & Pierce RJ (2006)
Schistosoma mansoni CBP ⁄ p300 has a conserved domain
structure and interacts functionally with the nuclear
receptor SmFtz-F1. Mol Biochem Parasitol 146, 180–191.
48 Jones DT, Taylor WR & Thornton JM (1992) The
rapid generation of mutation data matrices from protein
sequences. Comput Appl Biosci
8, 275–282.
49 Guindon S & Gascuel O (2003) A simple, fast, and
accurate algorithm to estimate large phylogenies by
maximum likelihood. Syst Biol 52, 696–704.
50 Huelsenbeck JP & Ronquist F (2001) mrbayes: Baye-
sian inference of phylogenetic trees. Bioinformatics 17,
754–755.
51 Saitou N & Nei M (1987) The neighbor-joining method:
a new method for reconstructing phylogenetic trees.
Mol Biol Evol 4, 406–425.
52 Hirai H & LoVerde PT (1995) FISH techniques for con-
structing physical maps on schistosome chromosomes.
Parasitol Today 11, 310–314.
53 Hirai H & Hirai Y (2004) FISH mapping for helminth
genome. Methods Mol Biol 270, 379–394.
54 Oger F, Bertin B, Caby S, Dalia-Cornette J, Adams M,

Vicogne J, Capron M & Pierce RJ (2006) Molecular
cloning and characterization of Schistosoma mansoni
Ftz-F1 interacting protein-1 (SmFIP-1), a novel core-
pressor of the nuclear receptor SmFtz-F1. Mol Biochem
Parasitol 148, 10–23.
55 Fantappie MR, Osman A, Ericsson C, Niles EG &
LoVerde PT (2003) Cloning of Schistosoma mansoni
Seven in Absentia (SmSINA) (+) homologue cDNA, a
gene involved in ubiquitination of SmRXR1 and
SmRXR2. Mol Biochem Parasitol 131, 45–54.
56 Osman A, Niles EG & LoVerde PT (2001) Identifica-
tion and characterization of a Smad2 homologue
from Schistosoma mansoni, a transforming growth
factor-beta signal transducer. J Biol Chem 276,
10072–10082.
57 Kliewer SA, Umesono K, Mangelsdorf DJ & Evans
RM (1992) Retinoid X receptor interacts with nuclear
receptors in retinoic acid, thyroid hormone and vitamin
D3 signalling. Nature 355, 446–449.
58 Umesono K & Evans RM (1989) Determinants of target
gene specificity for steroid ⁄ thyroid hormone receptors.
Cell 57, 1139–1146.
59 Prost E & Moore DD (1986) CAT vectors for analysis of
eukaryotic promoters and enhancers. Gene 45, 107–111.
60 Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P,
Gronemeyer H & Moras D (1995) Crystal structure of
the RAR-gamma ligand-binding domain bound to
all-trans retinoic acid. Nature 378, 681–689.
Supplementary material
The following supplementary material is available

online:
S. mansoni NR1 W. Wu et al.
404 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS
Table S1. Exon ⁄ intron organization of SmNR1 gene.
Table S2. GenBank accession numbers of the sequences
used to construct phylogenetic trees.
Fig. S1. Bayesian phylogenetic tree of SmNR1.
Fig. S2. Neighbor Joining distance tree of SmNR1.
Fig. S3. Alignment of peptide sequences of DBD and
LBD (after helix 2).
This material is available as part of the online article
from
Please note: Blackwell Publishing is not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corres-
ponding author for the article.
W. Wu et al. S. mansoni NR1
FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 405