Báo cáo khoa học: The Saccharomyces cerevisiae orthologue of the human protein phosphatase 4 core regulatory subunit R2 confers resistance to the anticancer drug cisplatin pot

The Saccharomyces cerevisiae orthologue of the human
protein phosphatase 4 core regulatory subunit R2 confers
resistance to the anticancer drug cisplatin
C. James Hastie
1,
*, Cristina Va
´
zquez-Martin
1,
*, Amanda Philp
1
, Michael J. R. Stark
2
and
Patricia T. W. Cohen
1
1 Medical Research Council Protein Phosphorylation Unit, School of Life Sciences, University of Dundee, UK
2 Division of Gene Regulation and Expression, School of Life Sciences, University of Dundee, UK
Cisplatin and oxaliplatin are potent chemotherapeutic
agents currently used in the treatment of many can-
cers, including lung, gonadal, head, neck and bowel
neoplasias. However, the unpredictable resistance of
certain tumours to these platinum-based agents, which
bind to DNA, poses significant problems. The mechan-
ism by which resistance arises is obscure, and one
approach to dissecting it has been to examine the sen-
sitivity of lower organisms carrying different gene dele-
tions or disruptions to these drugs. In a recent
genome-wide screen of Saccharomyces cerevisiae dele-
tion strains, most of the genes identified as conferring
Keywords

cisplatin; platinum-based anticancer drugs;
Pph3; protein phosphatase 4; Psy4
Correspondence
P. T. W. Cohen, MRC Protein
Phosphorylation Unit, School of Life
Sciences, MSI ⁄ WTB ⁄ CIR, University of
Dundee, Dow Street, Dundee DD1 5EH, UK
Fax: +44 1382 223778
Tel. +44 1382 384240
E-mail:
*These authors contributed equally to this
work.
(Received 28 April 2006, revised 22 May
2006, accepted 24 May 2006)
doi:10.1111/j.1742-4658.2006.05336.x
The anticancer agents cisplatin and oxaliplatin are widely used in the treat-
ment of human neoplasias. A genome-wide screen in Saccharomyces cere-
visiae previously identified PPH3 and PSY2 among the top 20 genes
conferring resistance to these anticancer agents. The mammalian ortho-
logue of Pph3p is the protein serine ⁄ threonine phosphatase Ppp4c, which is
found in high molecular mass complexes bound to a regulatory subunit
R2. We show here that the putative S. cerevisiae orthologue of R2, which
is encoded by ORF YBL046w, binds to Pph3p and exhibits the same
unusually high asymmetry as mammalian R2. Despite the essential function
of Ppp4c–R2 in microtubule-related processes at centrosomes in higher
eukaryotes, S. cerevisiae diploid strains with homozygous deletion of
YBL046w and two or one functional copies of the TUB2 gene were viable
and no more sensitive to microtubule-depolymerizing drugs than the con-
trol strain. The protein encoded by YBL046w exhibited a predominantly
nuclear localization. These studies suggest that the centrosomal function of

Ppp4c–R2 is not required or may be performed by a different phosphatase
in yeast. Homozygous diploid deletion strains of S. cerevisiae, pph3D,
ybl046wD and psy2D, were all more sensitive to cisplatin than the control
strain. The YBL046w gene therefore confers resistance to cisplatin and was
termed PSY4 (platinum sensitivity 4). Ppp4c, R2 and the putative ortho-
logue of Psy2p (termed R3) are shown here to form a complex in
Drosophila melanogaster and mammalian cells. By comparison with the
yeast system, this complex may confer resistance to cisplatin in higher
eukaryotes.
Abbreviations
ERK, extracellular signal-regulated kinase; 5-FOA, 5-fluoro-orotic acid; HEK293, human embryonic kidney cell line 293; IRS4, insulin receptor
substrate 4; JNK, c-Jun N-terminal kinase; NF-jB, nuclear factor jB; MMS, methyl methanesulphonate; Pph, Saccharomyces cerevisiae
protein phosphatase; Ppp ⁄ PP, protein serine ⁄ threonine phosphatase in mammals and Drosophila; Ppp4c, protein phosphatase 4 catalytic
subunit (also termed PP4, PPX); Psy, platinum sensitivity; SMN, survival of motor neuron; TNF-a, tumour necrosis factor-a; TOR, target of
rapamycin.
3322 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS
sensitivity to oxaliplatin and cisplatin were in the
DNA damage and repair pathways. However, one
strain with a deletion of the protein serine ⁄ threonine
phosphatase, Pph3p, was ranked 10th and 14th in sen-
sitivity to oxaliplatin and cisplatin, respectively [1].
Suprisingly, Pph21p and Pph22p, the most closely rela-
ted protein phosphatases to Pph3p in the PPP family
(Table 1 [2]), were not found to be sensitive to these
drugs. Previous studies on Pph3p function had shown
that it was encoded by a nonessential gene and had
overlapping properties with Pph21p and Pph22p,
allowing limited growth in some genetic backgrounds
when the PPH21 and PPH22 genes were deleted [3,4].
In addition, Pph3p and the other Tap42p interacting

phosphatases (Sit4p, Pph21p and Pph22p) are involved
in the target of rapamycin (TOR) kinase-mediated
modification of Gln3p, a GATA-type transcription fac-
tor responsive to different nitrogenous nutrients and
starvation [5].
In higher organisms, the orthologue of Pph3p is
believed to be the protein phosphatase 4 catalytic sub-
unit (Ppp4c), and the Pph21 ⁄ 22 phosphatases are
othologous to PP2Ac ([2,6] Table 1). In contrast to
S. cerevisiae Pph3p, Ppp4c is encoded by an essential
gene in Drosophila melanogaster, where it is required
for the recruitment of c-tubulin to the centrosomes
and formation of the mitotic spindle [7]. In Caenorhab-
ditis elegans, Ppp4c is encoded by two genes, one of
which is similarly required for the maturation of cen-
trosomes and the formation of the spindle in mitosis
as well as for sperm meiosis and the formation of chi-
asmata during meiosis [8]. Recently, it has become
increasingly clear that Ppp4c may perform a multipli-
city of functions in higher eukaryotes. A Ppp4 com-
plex interacts with the survival of motor neuron
(SMN) complex and enhances the temporal localiza-
tion of the small nuclear ribonucleoproteins in human
cells, indicating a function in spliceosomal assembly
[9]. Ppp4c may participate in cellular signalling path-
ways, including the tumour necrosis factor-a (TNF-a)-
induced activation of c-Jun N-terminal kinase (JNK),
the hematopoietic progenitor kinase JNK pathway
[10,11] and the TNF-a downregulation of insulin
receptor substrate 4 (IRS4) [12]. Members of the nuc-

lear factor jB (NF-jB) family of transcription factors
associate with Ppp4c, which stimulates NF-jB-medi-
ated transcription and DNA binding [13]. Interest-
ingly, Ppp4c has recently been implicated in the
cisplatin-mediated activation and dephosphorylation of
NF-jB p65 (also termed RelA), which may underlie
the increased cisplatin resistance found in cell lines fol-
lowing suppression of the extracellular signal-regulated
kinase (ERK) pathway, which leads to the activation
of NF-jB [14].
The subunit composition of the Ppp4 complexes that
may be involved in cisplatin resistance are not delinea-
ted. Ppp4 holoenzymes isolated from mammalian tis-
sues have led to the identification of two regulatory
subunits of Ppp4c that do not interact with the closely
related PP2Ac, namely R1 (105 kDa) [15] and R2
(55 kDa) [16]. These regulatory subunits form inde-
pendent heterodimers with Ppp4c. A further regulatory
subunit, a4 (39 kDa, putative orthologue of Tap42p),
associates with protein phosphatase catalytic subunits
of Ppp4, PP2A and Ppp6 to form heterodimeric com-
plexes [17]. R2 is likely to be a core regulatory subunit,
such that the Ppp4c–R2 complex may then interact
with a variable third subunit, as observed for PP2A
complexes. Gemin3/gemin4 or gemin4 of the SMN
complex has been identified as a possible variable sub-
unit associating with the human Ppp4c–R2 complex
[9]. Putative orthologues of mammalian R2 were iden-
tified in several species from sequence similarities,
including D. melanogaster, C. elegans and S. cerevisiae

[16]. Here we examine the properties of the putative
S. cerevisiae R2 orthologue, YBL046w, and show that
deletion of YBL046w, similarly to deletion of PPH3,
confers sensitivity to the anticancer drug cisplatin.
Table 1. Putative protein phosphatase subunit orthologues of S. cerevisiae, D. melanogaster and H. sapiens in the PP2A subfamily of the
PPP family. R1, R2 and a4 show mutually exclusive binding to Ppp4c.
Subunit type S. cerevisiae Drosophila Human
Catalytic subunit Pph3p Ppp4c ⁄ Pp4 ⁄ cmm Ppp4c ⁄ PP4 ⁄ PPX
Core regulatory subunit of Pph3 ⁄ Ppp4c YBL046w ⁄ Psy4p R2 R2
Regulatory subunit of Pph3 ⁄ Ppp4c Psy2p R3 ⁄ flfl R3
Core regulatory subunit of Ppp4c R1
Catalytic subunit Pph21p ⁄ Pph22p Pp2A ⁄ mts PP2Aca ⁄ b
Catalytic subunit Sit4p PpV Ppp6c ⁄ PP6c
Catalytic subunit Ppg1p
Common regulatory subunit of all the
above catalytic subunits
Tap42p Tap42 a4
C. J. Hastie et al. Resistance to cisplatin
FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3323
Results
Identification of the protein encoded by YBL046w
as a regulatory subunit of Pph3
The protein encoded by S. cerevisiae ORF YBL046w
(SPTREMBL P38193) was suggested to be a putative
orthologue of the mammalian R2 core regulatory sub-
unit of Ppp4c (Table 1) from an alignment of amino
acids 97–135 with amino acids 176–212 of the human
protein, which showed 46% identity [16]. However, out-
side this region, the proteins are difficult to align
because identity between the two proteins is low. Never-

theless, the alignment in Fig. 1 shows that the overall
similarity of the protein encoded by YBL046w to
human ⁄ Drosophila R2 sequences is 36%. We sought to
determine whether the properties of R2 and the protein
encoded by ORF YBL046w were also similar. Bacteri-
ally expressed human GST–R2 was shown to interact
with native Ppp4c and not with other protein phospha-
tase catalytic subunits in the PPP family [16]. S. cerevisi-
ae cells expressing YBL046w tagged at its C-terminus
with an MYC
13
epitope were independently transformed
with specific PCR-generated transformation modules
such that derivatives were generated in which either
Pph3p, Pph21p, Sit4p or Ppg1p was expressed with
a triple haemagglutinin (HA) tag at the N-terminus
(Tables 2 and 3). Figure 2 shows that when HA-tagged
Pph3p (the putative orthologue of Ppp4c) was immuno-
adsorbed from cell extracts, MYC
13
-tagged YBL046w
was also adsorbed together with the HA-tagged phos-
phatase. In contrast, even though Pph21p, Sit4p and
Ppg1p are the most closely related yeast protein phos-
phatases to Pph3p, MYC
13
-tagged YBL046w did not
coimmunoprecipitate with any of these other three
HA-tagged phosphatase catalytic subunits (Fig. 2).
A further characteristic of human R2 was that,

although its molecular mass calculated from its amino
acid sequence is 55 kDa, it eluted from Superose 6 with
an apparent molecular size of 450 kDa [16]. Bacterially
expressed S. cerevisiae Flag-tagged YBL046w (calcula-
ted molecular mass 51.6 kDa and 50.6 kDa with and
without the Flag tag, respectively) elutes from Superose
6 at the same anomalous position of  450 kDa as Dro-
sophila His
6
–R2 (Fig. 3) and human His
6
–R2 [16].
Examination of the phenotype of S. cerevisiae
strains carrying a deletion of the YBL046w gene
Haploid yeast strains carrying a null allele of YBL046w
in AY925 and AY926 backgrounds and diploid strains
homozygous for this allele in an AY927 background are
viable and showed no growth differences from wild-type
control cells on agar plates of rich medium (YPD), syn-
thetic medium (SC) containing either glucose or galac-
tose, or rich medium depleted in nitrogen. Cell size was
similar to that of the wild type in both log and station-
ary phases, as visualized by microscopy. Mating and
sporulation were normal. The YBL046w null mutants
did not show increased sensitivity to low or high temper-
atures in the range 14–37 °C, heat shock at 55 °C, caf-
feine (1.5–6 mm) or vanadate (2 mm). The sensitivity of
the YBL046w null mutants to calcofluor white (0.1–
0.2%), calcium chloride (100 mm), sorbitol (1 m) and
SDS (0.005–0.01%) indicated that the integrity of the

cell wall was not compromised compared with the wild
type. Sensitivities to reagents that block the cell cycle,
hydroxyurea (0.2 m), nocodazole (2–45 lgÆmL
)1
) and
benomyl (2–25 lgÆmL
)1
), were identical to those of the
wild-type cells.
Examination of the phenotype of S. cerevisiae
carrying deletions for both the YBL046w gene
and the TUB2 gene
Since decreased expression of Ppp4c in D. melanogaster
and C. elegans leads to aberrant growth and ⁄ or organ-
ization of microtubules at centrosomes, coupled with an
arrest during mitosis, it seemed likely that mutation of
the core regulatory subunit R2 and its orthologues in
lower eukaryotes would also lead to a similar pheno-
type. Although ybl046wD mutants of S. cerevisiae did
not show increased sensitivity to the microtubule-depo-
lymerizing drugs nocodazole and benomyl, we sought to
test whether compromising the function of TUB2 enco-
ding b-tubulin might uncover a role for YBL046w in
microtubule nucleation or organization in yeast. Since
homozygous deletion of TUB2 in diploid S. cerevisiae
strains is lethal, whereas heterozygous null TUB2
mutants are more sensitive to benomyl [18], S. cerevisiae
strains heterozygous for a TUB2 deletion in the Euro-
scarf background were created (Table 4). Figure 4
shows that there is an effect of TUB2 ⁄ tub2D::HISMX6

heterozygosity on benomyl sensitivity in the BY4743
background, as expected (compare the growth of strains
BY4743 and BY4743 TUB2 ⁄ tub2D::HISMX6 on plates
containing 12 and 16 lgÆmL
)1
benomyl). However,
there is no clear effect of the homozygous deletion of
YBL046w on benomyl sensitivity with either two or one
functional copies of TUB2.
Effect of cisplatin on PPH3 (YDR075w), YBL046w
and PSY2 (YNL201c) deletion strains
A genome-wide screen of S. cerevisiae genes that,
when individually deleted, conferred sensitivity to the
Resistance to cisplatin C. J. Hastie et al.
3324 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS
anticancer agents cisplatin and oxaliplatin, identified
among the top 20 most sensitive genes PPH3 and a
gene of unknown function, YNL201c, which the
authors termed PSY2 (for
platinum sensitivity 2) [1].
Psy2p and YBL046w were among several proteins
found to associate with Pph3p in each of two separate
genome-wide screens for interacting proteins [19,20].
However, ybl046wD was not identified as sensitive to
cisplatin and oxaliplatin. We therefore decided to
compare the sensitivity of pph3D, ybl046wD and psy2D
diploid strains to increasing concentrations of cisplatin.
Figure 5A shows that all three homozygous diploid
deletion strains were more sensitive than the control
strain to 4 mm and 5 mm cisplatin, and that ybl046wD

was just as sensitive to cisplatin as pph3D and psy2D.
In order to corroborate the effects of cisplatin on the
ybl046wD strain, this strain was transformed with
YCplac111 YBL046w. We found that the growth of
Fig. 1. Alignment of the Saccharomyces cerevisiae protein encoded by ORF YBL046w with human (Hs) and Drosophila melanogaster (Dm)
R2. Identities between any two proteins are in black and similarities are in grey (GenEMBL accession numbers AJ271448 and AJ271449).
C. J. Hastie et al. Resistance to cisplatin
FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3325
this rescued strain on plates containing 4 mm and
5mm cisplatin was the same as that of the control
strain transformed with the vector YCplac111 (data
not shown). The YBL046w gene was therefore termed
PSY4 (for platinum sensitivity 4).
The primary target of cisplatin in cells is DNA.
Since interaction with DNA may impair the DNA and
activate the DNA damage response pathways, we
sought to examine whether Pph3p, YBL046w and
Psy2p are involved in cisplatin effects via participation
in the Rad53p pathways. In response to DNA damage
caused by treatment of cells with methyl methanesul-
phonate (MMS), Rad53p becomes phosphorylated, as
can be seen in Fig. 5B. However, cisplatin did not
elicit the Rad53p phosphorylation in control, pph3D,
ybl046wD or psy2D cells. Thus, we have no evidence
that cisplatin activates the Rad53p DNA damage path-
ways or that the Pph3p–Psy4p–Psy2p complex modu-
lates the phosphorylation of Rad53p in response to
cisplatin.
Ppp4c, R2 and R3 form a complex in human and
Drosophila cells

A putative human orthologue of YNL201c ⁄ Psy2p was
identified in the NCBI database from sequence similarit-
ies, and termed R3 (accession number BC02409).
Immunoadsorption of endogenous R2 from Drosophila
Kc and S2 cell lysates showed the presence of endog-
enous R3 and Ppp4c in the immunopellets (Fig. 6). Con-
versely, immunoadsorption of endogenous R3 from the
same cells showed the presence of R2 and Ppp4c in im-
munopellets. In addition, anti-FLAG immunopellets
from human cells (HEK293) cells expressing FLAG–R2
showed the presence of R3 and Ppp4c (Fig. 6). These
results demonstrate that Ppp4c, R2 and R3 form a com-
plex in higher eukaryotes.
Discussion
Diploid S. cerevisiae strains that are homozygous for
deletion of the protein phosphatase catalytic subunit
gene PPH3 are more sensitive to the anticancer drugs
cisplatin and oxaliplatin than wild-type yeast [1].
Pph3p is believed to be the orthologue of mammalian
Ppp4c, although it shows only marginally greater
sequence similarity to human Ppp4c than to human
PP2A or Ppp6c [2]. In mammalian cells, Ppp4c is
found in high molecular mass complexes, some of
which comprise Ppp4c bound to a regulatory subunit
R2 [16]. We show here that Pph3p specifically interacts
with YBL046w ⁄ Psy4p, a protein with sequence similar-
ity to R2. In addition, YBL046w ⁄ Psy4p shows
Table 2. Oligonucleotide primers used for amplification of transformation modules and subsequent gene deletion or tagging. Sequences corresponding to the gene to be deleted or tagged
are underlined and those specific to the transformation module are in italics. Transformation modules are described in Longtine et al. [24] and Schneider et al. [26]. Those specific to the
transformation module are not underlined.

Primer Gene modification Transformation module Primer sequence (5¢-to3¢)
F1 PSY4(YBL046w) deletion pFA6a-HIS3MX6
GTTGGTGTTCTCATCGATTGTCAAACCACAATAAAAAGCTCGGATCCCCGGGTTAATTAA
R1 PSY4(YBL046w) deletion pFA6a-HIS3MX6
CAAATGGGAAGTTGTTGGTAGAGAAGTCATCTCTCGATCAGAATTCGAGCTCGTTTAAAC
F2 PSY4 C-terminal 13MYC tag pFA6a-13Myc-HIS3MX6
CCGTGAGAATATTAGCAGTCCATTAGGCAAGAAGTCCAGACGGATCCCCGGGTTAATTAA
R2 PSY4 C-terminal 13MYC tag pFA6a-13Myc-HIS3MX6
CAAATGGGAAGTTGTTGGTAGAGAAGTCATCTCTCGATCAGAATTCGAGCTCGTTTAAAC
F3 PPH21 N-terminal 3HA tag pMPY-3xHA
CATAGTGGAAAGAGGGATATAAATTATCGCATAAAACAATAAACAAAAAGAAAAATG
AGGGAACAAAAGCTGGAG
R3 PPH21 N-terminal 3HA tag pMPY-3xHA
GGGAGTCAGCTGTTCGGTAACAGCATCTTGCATAGGCACATCTAAATCTGTATCCTGTAGGGCGAATTGGG
F4 PPH3 N-terminal 3HA tag pMPY-3xHA
GCAAAGTAAAACAGCACGAAAAAAGTGATTACAAATTTCAAGGGAGATATGATGAGGGAACAAAGGCTGGAG
R4 PPH3 N-terminal 3HA tag pMPY-3xHA
GGTTTCTTCAGGAATATGTTTTCCGTCTCTCAGTGATGCTATAATCTTATCTAAGTCCTGTAGGGCGAATTGGG
F5 PPG1 N-terminal 3HA tag pMPY-3xHA
GTATCCCCACTGTGTACTTTTATTTTTGGTTAGAGAATTGGCCCAGTAGAGATGGAA
AGGGAACAAAAGCTGGAG
R5 PPG1 N-terminal 3HA tag pMPY-3xHA
GTAACTTCAGGTAGTAACTGGGCCTTGTATAGCCTTTCTAAACATTCGTCCAACTGTAGGGCGAATTGGG
F6 SIT4 N-terminal 3HA tag pMPY-3xHA
GAAATACTATTGAAGCTCAAAAACATCCATAATAAAAGGAACAATAACAATGGTAAGGGAACAAAAGCTGGAG
R6 SIT4 N-terminal 3HA tag pMPY-3xHA
GCGCCTGGCATTTCTTTATTGTTTCAAGCCATTCGTCGGGGCCTCTAGACTGTAGGGCGAATTGGG
F13 TUB2 deletion pF6a-HIS3MX6
GGCAATTGGAGTGACATAGCAGCTACTACAACTACAAAAGCAAAATCTCCACAAAGTAAT
CGGATCCCCGGGTTAATTAA

R13 TUB2 deletion pF6a-HIS3MX6
CCAAGTGCTTCAATCCTAGAGAAGAAGAAAGGTAAGAAAAAGAAAGGAAAGCAACTTAAT
GAATTCGAGCTCGTTTAAAC
Resistance to cisplatin C. J. Hastie et al.
3326 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS
the same anomalous behaviour as both human and
Drosophila R2 on gel filtration, suggesting that
YBL046w ⁄ Psy4p, like human and Drosophila R2, is a
highly asymmetrical or unfolded protein.
The major phenotype seen in D. melanogaster and
C. elegans deficient in Ppp4c expression is defective
nucleation or growth of microtubules at centrosomes
leading to an arrest in the formation of the mitotic
spindle [7,8]. We therefore sought to examine whether
deletion of YBL046w ⁄ PSY4 in S. cerevisiae would lead
to any abnormalities in microtubule-related processes
by testing growth in the presence of the microtubule-
depolymerizing drug benomyl. We used strains hetero-
zygous for deletion of the TUB2 gene, which encodes
b-tubulin, in an attempt to make cells more sensitive
to any defects in tubulin-related processes. However,
this did not uncover a role for YBL046w ⁄ PSY4 in any
microtubule-related events. In accordance with these
studies, we found that C-terminally MYC
13
-tagged
YBL046w ⁄ Psy4p has a nuclear localization with no
evidence of localization at the spindle pole bodies
(data not shown). This contrasts with the situation in
human A431 and HeLa cells, where R2 has been

localized to centrosomes [16]. Ppp4c has been localized
to centrosomes in human, Drosophila and C. elegans
cells [7,8,21], but there are no reports of Pph3p being
present at spindle pole bodies, and pph3 deletion
strains are viable [3]. Thus it appears that the essential
function of Ppp4c–R2 in microtubule-related processes
at centrosomes in higher eukaryotes is not required or
may be performed by a different phosphatase in yeast.
Two different screens of the S. cerevisiae proteome
identified several proteins showing association with
Pph3p [19,20]. However, there were only two proteins
identified that were common to both screens; one was
YBL046w ⁄ Psy4p, the orthologue of R2, and the other
was an unknown protein YLN201c, later named Psy2p
because it was also found to be sensitive to cisplatin
and oxaliplatin [1]. Data from the proteome analysis
indicate that Psy2p, like YBL046w ⁄ Psy4p, is found in
acomplex with Pph3p. From sequence similarities, we
have identified putative human and Drosophila ortho-
logues (termed R3) of yeast Psy2p and shown that R3
forms a complex with R2 and Ppp4c in both higher
eukaryotes. These studies point to the existence of a
trimeric complex, indicating that Ppp4 and Pph3 sub-
unit structures may thus resemble those of PP2A and
Pph21 ⁄ Pph22, where a core regulatory subunit forms a
complex with the catalytic subunit to which a third
variable subunit may bind. Since YBL046w ⁄ Psy4p
would appear to be an obligatory core subunit of
Pph3p required for the binding of Psy2p, we examined
the sensitivity of the YBL046w ⁄ Psy4p deletion strain

to cisplatin. The comparable increased sensitivities to
cisplatin of the homozygous diploid deletion strains
pph3D, ybl046w ⁄ psy4D and psy2D compared to wild-
type yeast indicate a role for the Pph3p–(YBL046w ⁄
Psy4p)–Psy2p complex in conferring resistance to the
anticancer drug cisplatin and suggest that the Ppp4c–
R2–R3 complex in human cells may perform a similar
function.
Cisplatin and oxaliplatin are platinum-based drugs
that bind to DNA. The results suggest that Pph3p–
(YBL046w ⁄ Psy4p)–Psy2p and possibly the human
orthologue Ppp4c–R2–R3 may regulate processes
directly related to DNA function. The low pI of all
subunits (£ 5.1) indicates that the Pph3p and Ppp4c
complexes are unlikely to bind directly to DNA but are
more likely to modulate the function of transcription
factors or other DNA-binding proteins. In this respect,
it is relevant that Pph3p has been found to play a role
in the regulation of Gln3p, a transcription factor
Table 3. Oligonucleotide primers used for amplification of markers and ⁄ or genes subsequent to gene deletion or tagging. The numbers relat-
ive to the initiating ATG of the gene are indicated.
Primer Gene modification Primer sequence (5¢-to3¢)
F7 PSY4(YBL046w) deletion (1) ATGAGCTCGACGATGTGGGATG (22)
R7 PSY4(YBL046w) deletion (1323) TCTGGACTTCTTGCCTAATGGAC (1301)
F8 PSY4 C-terminal 13MYC tag () 26) CGATTGTCAAAGCACAATAAAAAGCT () 1)
R8 PSY4 C-terminal 13MYC tag (1346) GTAGAGAAGTCATCTCTCGATCA (1324)
F9 PPH21 N-terminal 3HA tag () 419) GTTACAGGTTCCTTTCGACGCAC () 397)
R9 PPH21 N-terminal 3HA tag (1409) CAAGCAGCCTGAAGAATGGAAGTTC (1385)
F10 PPH3 N-terminal 3HA tag () 695) GGTACGGTCGACCTGGATTCCAG () 673)
R10 PPH3 N-terminal 3HA tag (1422) GACCTTGCCTGGAATCCCAGG (1402)

F11 PPG1 N-terminal 3HA tag () 114) CAGCGAGTTGTAGGTAATTTGGAAC () 90)
R11 PPG1 N-terminal 3HA tag (1285) GGAAGATTATGAGGTACATGATCAG (1261)
F12 SIT4 N-terminal 3HA tag () 457) GCCGCGGGTAACATGAAGCGG () 437)
R12 SIT4 N-terminal 3HA tag (1048) GTGTATCGTATCGTAGCAAATGGCG (1024)
C. J. Hastie et al. Resistance to cisplatin
FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3327
AB
DC
E
Fig. 2. Analysis of the interaction between the YBL046w protein and several protein phosphatase catalytic subunits. Extracts were prepared
from Saccharomyces cerevisiae b derived from AY925 strains coexpressing YBL046w–MYC
13
and one of four different HA-tagged protein
phosphatase catalytic subunits. Supernatant and pellet fractions of the cell lysates were obtained by centrifugation following immunoadsorp-
tion from lysates with HA antibodies and protein G Sepharose. Ten micrograms of lysate protein and the equivalent relative loadings of
supernatant and pellet fractions were analysed by SDS ⁄ PAGE and immunoblotting with MYC antibodies. (A) YBL046w–MYC
13
and HA
3
–
Pph3p. (B) YBL046w–MYC
13
and HA
3
–Sit4p. (C) YBL046w–MYC
13
and HA
3
–Pph21p. (D) YBL046w–MYC
13

and HA
3
–Ppg1p. (E) Supernatant
and pellet fractions of the cell lysates were obtained by centrifugation following immunoadsorption from lysates with MYC antibodies and
protein G Sepharose; WT, AY925; MTAY925, YBL046w-MYC13, HA3PPA4. Twenty micrograms of lysate protein, 30 lg of protein from the
supernatant fraction and the pellet fraction from 1 mg of lysate protein were analysed by SDS ⁄ PAGE and immunoblotting with HA antibod-
ies. Arrows indicate the positions of YBL046w–MYC
13
,HA
3
–Pph3p and the IgG heavy chain. Molecular mass markers are indicated in kDa.
Resistance to cisplatin C. J. Hastie et al.
3328 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS
responsive to nitrogenous nutrients and starvation. In
humans, rapidly growing cancer cells may become
starved of certain nutrients and therefore more depend-
ent on the Ppp4-regulated systems. However, the sensi-
tivity of yeast to cisplatin was seen in optimal growth
conditions, suggesting a wider role of the Pph3p–
(YBL046w ⁄ Psy4p)–Psy2p complex in transcription
and ⁄ or other DNA-related processes.
Recent studies have suggested that Psy2p may play
a role in the DNA damage response [22], and a two-
hybrid study identified an interaction between Psy2p
and Rad53p [23], which lies on the DNA damage
response pathways. We therefore investigated whether
Rad53p is phosphorylated in response to cisplatin
treatment. Although we were able to show that
Rad53p is phosphorylated in response to MMS, which
causes DNA damage, we did not observe phosphoryla-

tion of Rad53p on treatment of control yeast strains
or those carrying deletions of PPH3, YBL046w ⁄ PSY4
and PSY2 with cisplatin. It is therefore unlikely that
the Pph3p–(YBL046w ⁄ Psy4p)–Psy2p complex confers
resistance to cisplatin through the Rad53p pathways.
We also found no evidence that the cell wall permeab-
ility was compromised in the YBL046w ⁄ PSY4 deletion
strain, suggesting that cisplatin resistance was unlikely
to be caused by increased entry of the drug. Thus,
other possibilities, such as a role for Pph3p–
(YBL046w ⁄ Psy4p)–Psy2p in DNA repair processes,
appear more likely to underlie the cisplatin sensitivity
Table 4. Saccharomyces cerevisiae strains. Accession numbers for the Euroscarf strains ( />data/) are given in parentheses. Diploid strain are indicated; all other strains are haploid. PPH3 is ORF YDR075w, PSY4 is ORF YBL046w,
and PSY2 is ORF YNL201c. Ac number, Accession number.
Strain Genotype Reference
AY925 MATa, ade2-1, his3-11, leu2-3, trp1-1, ura3-1, can1-100 Fernandez-Sarabia et al. [29]
AY926 MATa, ade2-1, his3-11, leu2-3, trp1-1, ura3-1, can1-100 Kim Arndt
AYS927 Diploid of AY925 and AY926 Black et al. [30]
AY925 psy4D AY925 psy4D::LEU2 This study
AY926 psy4D AY926 psy4D::LEU2 This study
AYS927 psy4D (diploid) AYS927 psy4D::LEU2 ⁄ psy4D::LEU2 This study
AY925 PSY4–MYC
13
AY925 PSY4–MYC
13
–HISMX6 This study
AY926 PSY4–MYC
13
AY926 PSY4–MYC
13

–HISMX6 This study
AY925 PSY4–MYC
13
, HA
3
–PPH21 AY925 PSY4–MYC
13
–HISMX6, HA
3
–PPH21 This study
AY925 PSY4–MYC
13
, HA
3
-PPH3 AY925 PSY4–MYC
13
–HISMX6, HA
3
–PPH3 This study
AY925 PSY4–MYC
13
, HA
3
–PPG1 AY925 PSY4–MYC
13
–HISMX6, HA
3
–PPG1 This study
AY925 PSY4–MYC
13

, HA
3
–SIT4 AY925 PSY4–MYC
13
–HISMX6, HA
3
–SIT4 This study
BY4743 (Y20000, diploid) MATa ⁄ MATa; his3D1 ⁄ his3D1; leu2D0 ⁄ leu2D0; MET15 ⁄ met15D0;
LYS2 ⁄ lys2D0; ura3D0 ⁄ ura3D0
Ac number
Y34010 (diploid) BY4743pph3D::kanMX4 ⁄ pph3D::kanMX4 Ac number
Y33072 (diploid) BY4743psy4D::kanMX4 ⁄ psy4D::kanMX4 Ac number
Y32011 (diploid) BY4743psy2D::kanMX4 ⁄ psy2D::kanMX4 Ac number
MSYD504 and MSYD505 (diploid) BY4743TUB2 ⁄ tub2D::HIS3MX This study
MSYD503 and MSYD508 (diploid) BY4743TUB2 ⁄ tub2D::HIS3MX, psy4D::kanMX4 ⁄ psy4D::kanMX4 This study
A
B
Fig. 3. Analysis of Flag–YBL046w and Drosophila His
6
–R2 by gel fil-
tration. Bacterially expressed Flag–YBL046w and Drosophila His
6
–
R2 were subjected to gel filtration on Superose 6. Column eluate
fractions were analysed by SDS ⁄ PAGE and stained for protein with
Coomassie blue: (A) Flag–YBL046w, (B) His
6
–DmR2. Column eluate
fraction numbers are indicated above each lane. Molecular mass
markers for SDS ⁄ PAGE are indicated in kDa. Arrows indicate the

elution position of the molecular mass markers for Superose 6 gel
filtration, thyroglobulin (670 kDa) and ferritin (450 kDa).
C. J. Hastie et al. Resistance to cisplatin
FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3329
of strains carrying deletions of PPH3, YBL046w ⁄ PSY4
and PSY2.
Experimental procedures
Yeast strains, plasmids, media and general
methods
Saccharomyces cerevisiae strains used in this study are des-
cribed in Table 4. The HIS3MX marker was employed as a
selective marker for deletion of the PSY4 ⁄ YBL046w gene
using a single-step PCR-based method [24] with plasmid
pFA6aHis3MX6 as template and source of the HIS3 gene
and primers F1 and R1 (Table 2). Single-step tagging of
YBL046w with sequences encoding MYC
13
at the C-termi-
nus was performed by an initial PCR [24] using primers F2
and R2 with the template pFA6a-13MYC-HisMX6, a pro-
tein-tagging module consisting of DNA encoding MYC
13
together with the S. cerevisiae ADH1 terminator. Transfor-
mation of yeast cells with the PCR products was carried
out using a lithium acetate method [25]. N-terminal HA
tagging of PPH21, PPH3, PPG1 and SIT4 was performed
by PCR with template pMPY-3xHA and primers F3 and
R3 to F6 and R6 (Table 2). The template contained the
URA3 gene flanked by three direct repeats of the HA epi-
tope tag [26]. After transformation with the PCR fragment

(selecting on Ura dropout plates to allow integration of the
PCR product), strains were grown on 5-fluoro-orotic acid
(5-FOA) plates to select for direct repeat mediated ‘pop-out’
of the URA3 gene, leaving behind the 3HA epitope. All
transformants were verified by PCR of genomic DNA using
gene-specific primers (Table 3). Oligonucleotides were syn-
thesized by K. Jarvie (School of Life Sciences, University of
Dundee).
YPD medium contained 1% yeast extract, 2% peptone
and 2% glucose. Synthetic complete medium (SC) contained
0.67% yeast nitrogen base (Difco Laboratories, Detroit,
MI, USA), 2% glucose and amino acids and bases as
described [27], omitting histidine as required for selection or
adding G418 (200 lgÆmL
)1
on agar plates) to select for
Fig. 4. Examination of the benomyl sensitiv-
ity of Saccharomyces cerevisiae strains
homozygous for ybl046wD ⁄ ybl046wD and
heterozygous for tub2D. Cultures of BY4743
(TUB2 ⁄ TUB2 YBL046w ⁄ YBL046w:1, 2),
Y33072 (TUB2 ⁄ TUB2 ybl046wD ⁄
ybl046wD: 3, 4), MSYD504 (TUB2 ⁄ tub2D
YBL046w ⁄ YBL046w: 5), MSYD505
(TUB2 ⁄ tub2D YBL046w ⁄ YBL046w:6),
MSYD503 (TUB2 ⁄ tub2D ybl046wD ⁄
ybl046wD: 7) and MSYD508 (TUB2 ⁄ tub2D
ybl046wD ⁄ ybl046wD: 8) were grown
overnight. Suitable 10-fold serial dilutions
were prepared and  5 lL samples of each

(containing  25 000,  2500,  250 and
 25 cells) were spotted in that order (from
left to right) on plates containing the indicated
concentrations of benomyl and grown at
26 °C for 2 days.
Resistance to cisplatin C. J. Hastie et al.
3330 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS
kanamycin resistance. Sporulation medium contained 1%
potassium acetate and 0.1% yeast extract. Medium deple-
ted in nitrogen was YPD without the yeast nitrogen base.
S. cerevisiae cells were grown at 28 °C unless otherwise
stated. To analyse the response to different media and
sensitivity to various compounds, S. cerevisiae cells were
grown from independent colonies overnight in YPD, cooled
to 4 °C, sonicated briefly and counted in a CASY1 cell
counter (Scha
¨
rfe Systems, Rentlingen, Germany), and dilu-
ted in YPD to 2–5 · 10
6
cellsÆmL
)1
; this was followed by
three serial 10-fold dilutions, and all dilutions were spotted
onto agar plates (5 lL per spot) using a multipronged
inoculation device (Dan-Kar Corp. St Woburn, MA, USA).
Benomyl was dissolved in DMSO and added to near-boiling
YPD agar. Plates for each concentration of benomyl were
poured from the same batch and so are directly comparable.
Cisplatin was dissolved in DMSO and diluted immediately

into YPD agar before pouring the plates. Plates were used
on the day of preparation and incubated at 26–30 °C for
2 days for colony growth.
Immunological analyses of S. cerevisiae protein
phosphatase complexes and Rad53
S. cerevisiae transformants expressing different 3HA-
tagged protein phosphatase catalytic subunits and Psy4p ⁄
YBL046w-MYC
13
were grown at 26 °C to a density of
10
7
cellsÆmL
)1
in selective media without histidine. Yeast
cells were harvested by centrifugation at 5000 g for 10 min
in a SX4750 rotor (Beckman Coulter, High Wycombe, UK),
washed in an equal volume of water, and suspended in lysis
buffer [50 mm Tris ⁄ HCl, pH 7.5, 100 mm MgCl
2
,5mm
EDTA, 0.1% (v ⁄ v) 2-mercaptoethanol, 1% (v ⁄ v) Triton
X-100, 1 · complete protease inhibitors (Roche Diagnostics,
Lewes, UK). Acid-washed glass beads (0.4 mm diameter;
0.7 gÆmL
)1
) were added and the cells were lysed by 20 cycles
of vortexing for 30 s followed by 30 s on ice. Extracts were
centrifuged in a F45-24-11 rotor (Eppendorff, Cambridge,
UK) for 5 min at 14 000 g at 4 °C and the supernatant

was removed. The glass beads were washed with one pellet
volume of lysis buffer and the supernatants were pooled.
A
B
Fig. 5. (A) Investigation of the effects of the
cisplatin sensitivity of Saccharomyces cere-
visiae homozygous for pph3D, ybl046wD
and psy2D. Serial dilutions of independent
colonies (WT 1, 2 and 3) on all plates are
from the control Y20000 (BY4743) strain.
Serial dilutions of independent colonies (MT
4, 5 and 6) are from strain Y32011 (BY4743
psy2D ⁄ psy2D, left panel), strain Y33072
(BY4743 ybl046wD ⁄ ybl046wD, middle
panel), and strain Y34010 (BY4743
pph3D ⁄ pph3D, right panel). The cisplatin
concentration in each row of plates is indica-
ted on the right. Plates were incubated at
30 °C for 2 days. The whole experiment
was repeated three times with similar
results (data not shown). (B) Comparison of
the effects of cisplatin and methyl methane-
sulphonate (MMS) on Rad53p. Control strain
Y20000 (BY4743), strain Y33072 (BY4743
ybl046wD ⁄ ybl046wD) and strain Y32011
(BY4743 psy2D ⁄ psy2D) were grown in YPD
in the absence and presence of 0.03%
MMS or 2 m
M cisplatin. Cell lysates were
prepared and the lysate proteins were sep-

arated by SDS ⁄ PAGE and immunostained
with antibodies to Rad53, which also recog-
nize phosphorylated Rad53 (Rad53-P).
C. J. Hastie et al. Resistance to cisplatin
FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3331
Two milligrams of lysate was precleared at 4 °C for 1 h
on a shaking platform with 80 lL of a 50% suspension of
protein G Sepharose, equilibrated in lysis buffer. Following
centrifugation for 1 min in a F45-24-11 rotor (Eppendorff,
Cambridge, UK) at 14 000 g, the supernatant was removed
and incubated for 2 h as above with 1 lg of rat HA high-
affinity antibodies and 40 lL of a 50% suspension of protein
G Sepharose, or with 30 lL of anti-c-MYC agarose conju-
gate (Sigma-Aldrich, Poole, UK). The immunopellets were
washed 10 times with lysis buffer and resuspended in Novex
sample buffer for analysis by SDS ⁄ PAGE on Novex 4–12%
Bis-Tris gels, followed by immunoblotting.
For analysis of Rad53p after treatment of S. cerevisiae
with MMS and cisplatin, yeast cultures were grown over-
night in YPD, diluted to D
600
of 1.0 and incubated for
60 min with shaking at 30 °C. Following addition of 0.03%
(v ⁄ v) MMS or 2 mm cisplatin, the cultures were incubated
similarly for 90 min. The cells were collected by centrifuga-
tion at 5000 g, in a SX4750 rotor (Beckman Coulter), and
the proteins from the cell lysates were prepared by extrac-
tion with trichloracetic acid [28]. Proteins were separated
by SDS ⁄ PAGE using Novex 4–12% Tris ⁄ glycine gels and
examined by immunoblotting with two Rad53p antibodies

(yN-19 and yC-19) used together (Santa Cruz Biotechno-
logy Inc., Santa Cruz, CA, USA).
Heterologous expression and gel filtration
of Flag-tagged Psy4p/YBL046w and human
His
6
-tagged R2
A construct for bacterial expression of N-terminally Flag-
tagged Psy4p ⁄ YBL046w was prepared by PCR using a yeast
DNA extract as a template and oligonucleotide primers 5¢-
GAATTCATGGACTACAAGGACGACGATGACAAG
ATGAGCTCGACGATGTTGGATGATG-3¢, which incor-
porated an EcoRI site (underlined) and encoded the FLAG
tag (DYKDDDDK), and primer 5¢-
AAGCTTTCATCTG
GACTTCTTGCCTAATGG-3¢, which incorporated a Hin-
dIII site (underlined). The resulting PCR product was ligated
into the pCR 2.1-TOPO vector and verified by sequencing,
and the EcoRI–HindIII fragment was subcloned into the
pET21a vector. DNA sequencing was performed on an
Applied Biosystems (Foster City, CA, USA) 373A automa-
ted DNA sequencer using Taq dye terminator cycle sequen-
cing, or on an Applied Biosystems model 3730 automated
capillary DNA sequencer using Big-Dye Ver 3.1 chemistry
(University of Dundee DNA sequencing service managed by
Dr Nick Helps, ).
FLAG-tagged Psy4p ⁄ YBL046w was expressed in Escheri-
chia coli from pET21a, immunoadsorbed from cell lysates
using anti-FLAG M2 Affinity gel (Sigma-Aldrich), and spe-
cifically eluted from the resin using FLAG peptide (Sigma-

Aldrich). His
6
–R2 was expressed in insect cells as described
previously [16]. FLAG-tagged Psy4p ⁄ YBL046w or His
6
–R2
was subjected to gel filtration analysis on an HR10 ⁄ 30
Superose 6 column (Amersham Biosciences, Chalfont St
Giles, UK) equilibrated in 50 mm Tris ⁄ HCl, pH 7.5,
200 mm NaCl, 0.03% (v ⁄ v) Brij-35, 1 mm EDTA, 0.1 mm
EGTA, 5% (v ⁄ v) glycerol, and 0.1% (v ⁄ v) 2-mercaptoetha-
nol. The column was run at 0.4 mLÆmin
)1
, with 0.2 mL
fractions being collected.
A
B
C
Fig. 6. Analysis of Ppp4 complexes in human and Drosophila cells.
(A) Drosophila S2 cell lysate (1 mg of protein) was used to immuno-
adsorb endogenous Drosophila R2 using Drosophila R2 antibody
coupled to protein G Sepharose. Lysate (L, 50 lg), supernatant
(SN, 50 lg) and pellet (P) fractions were obtained by centrifugation
following the immunoadsorption. Sheep preimmune IgG was used
for the control in place of the Drosophila R2 antibody. Proteins in
the lysate, supernatant and pellet fractions were analysed by
SDS ⁄ PAGE and subsequent immunoblotting with Drosophila R3
antibodies and Ppp4c antibodies. (B) Drosophila S2 cell lysate was
similarly used to immunoadsorb endogenous Drosophila R3 using
Drosophila R3 antibody coupled to protein G Sepharose. Proteins in

the lysate, supernatant and pellet fractions were immunoblotted
with Drosophila R2 antibodies and Ppp4c antibodies. (C) Human
HEK293 cells were transfected with a vector expressing Flag–R2
(human). Cell lysate (1 mg of protein) was used to immunoadsorb
Flag–R2 using Flag antibody coupled to protein G Sepharose. Pro-
teins in the lysate (L, 50 lg), supernatant (SN, 50 lg) and pellet (P)
fractions immunoblotted with human R3 antibodies and Ppp4c anti-
bodies.
Resistance to cisplatin C. J. Hastie et al.
3332 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS
Human and Drosophila cell culture and
immunological techniques
Human 293 cells were cultured and transfected with Flag–
R2 as described in Hastie et al. [16]. Drosophila S2 and
Kc167 cells were propagated at room temperature (22 °C)
in Schneider’s Drosophila medium (Gibco BRL, Paisley,
Scotland, UK) supplemented with 10% (v ⁄ v) FBS. Cells
were lysed in 50 mm Tris ⁄ HCl, pH 7.5, 150 mm NaCl,
2mm EDTA, 0.1 mm EGTA, 5% glycerol, 0.03% Brij-35,
0.1% (v ⁄ v) 2-mercaptoethanol and ‘Complete’ protease
inhibitors (Roche Diagnostics). After centrifugation at
16 000 g for 10 min in a S40 rotor (Jouan B4i, Waltham,
MA, USA), the supernatants were used for immunoadsorp-
tion analyses using antibodies coupled to protein-G-
Sepharose as described in Hastie et al. [16]. Immunoblotting
was performed following fractionation of proteins by
SDS ⁄ PAGE on 4–12% Bis-Tris gels (Novex Invitrogen,
Paisley, Scotland, UK) and transference of the proteins to
nitrocellulose membranes (Schleicher and Shull, Dassel,
Germany). The blots were probed with affinity-purified

antibodies, and antibody binding was detected either using
anti-sheep or anti-mouse IgG conjugated to horseradish
peroxidase, followed by enhanced chemiluminescence
(Amersham Biosciences), or using donkey anti-sheep
IgG[H + L] conjugated to an IRDye800 fluorphore
(Rockland Immunochemicals, Inc., Gilbertsville, PA, USA)
followed by analysis of the immunoblots with the Li-Cor
Odyssey system. Ppp4 antibodies were raised against the
N-terminal 57 amino acids of human Ppp4 as described in
Helps et al. [7]. Human R3 antibodies were raised against
amino acids 819–833, Drosophila R3 antibodies against
amino acids 860–873, and Drosophila R2 antibodies against
amino acids 591–610. Mouse MYC (9E10) antibodies,
mouse HA (12CA5) antibodies and rat HA (3F10) high-
affinity antibodies were obtained from Roche Diagnostics.
FLAG antibodies were obtained from Sigma-Aldrich.
Mouse and sheep secondary antibodies were purchased
from Pierce, Chester, UK.
Acknowledgements
The studies were funded by the Medical Research
Council, UK.
References
1 Wu HI, Brown JA, Dorie MJ, Lazzeroni L & Brown
JM (2004) Genome-wide identification of genes confer-
ring resistance to the anticancer agents cisplatin, oxali-
platin and mitocin C. Cancer Res 64, 3940–3948.
2 Cohen PTW (2004) Overview of protein serine ⁄ threon-
ine phosphatases. In Topics in Current Genetics: Protein
Phosphatases (Arino J & Alexander DR, eds), pp. 1–20.
Springer-Verlag, Berlin, Heidelberg.

3 Ronne H, Carlberg M, Hu G-Z & Nehlin JO (1991)
Protein phosphatase 2A in Saccharomyces cerevisiae:
effects on cell growth and bud morphogenesis. Mol Cell
Biol 11, 4876–4884.
4 Sneddon AA, Cohen PTW & Stark MJR (1990) Sac-
charomyces cerevisiae protein phosphatase 2A performs
an essential cellular function and is encoded by two
genes. EMBO J 9, 4339–4346.
5 Bertram PG, Choi JH, Carvalho J, Ai W, Zeng C, Chan
T-F & Zheng XFS (1993) Tripartite regulation of Gln3p
by TOR, Ure2p and phosphatases. J Biol Chem 275 ,
35727–35733.
6 da Cruz e Silva OB, da Cruz e Silva EF & Cohen PTW
(1988) Identification of a novel protein phosphatase
catalytic subunit by cDNA cloning. FEBS Lett 242,
106–110.
7 Helps NR, Brewis ND, Lineruth K, Davis T, Kaiser K
& Cohen PTW (1998) Protein phosphatase 4 is an
essential enzyme required for organisation of microtu-
bules at centrosomes in Drosophila embryos. J Cell Sci
111, 1331–1340.
8 Sumiyoshi E, Sugimoto A & Yamamoto M (2002) Pro-
tein phosphatase 4 is required for centrosome matura-
tion in mitosis and sperm meiosis in C. elegans.
J Cell Sci 115, 1403–1410.
9 Carnegie GK, Sleeman JE, Morrice N, Hastie CJ,
Peggie MW, Philp A, Lamond AI & Cohen PTW
(2003) Protein phosphatase 4 interacts with the survival
of motor neurons complex and enhances the temporal
localisation of snRNPs. J Cell Sci 116, 1905–1913.

10 Zhou GS, Mihindukulasuriya KA, MacCorkle-Chosnek
RA, Van Hooser A, Hu MCT, Brinkley BR & Tan TH
(2002) Protein phosphatase 4 is involved in tumor
necrosis factor-alpha-induced activation of c-Jun
N-terminal kinase. J Biol Chem 277, 6391–6398.
11 Zhou G, Boomer JS & Tan T-H (2004) Protein phos-
phatase 4 is a positive regulator of hematopoietic pro-
genitor kinase 1. J Biol Chem 279, 49551–49561.
12 Mihindukulasuriya KA, Zhou G, Qin J & Tan T-H (2004)
Protein phosphatase 4 interacts with and down-regulates
insulin receptor substrate 4 following tumour necrosis fac-
tor-a stimulation. J Biol Chem 279, 46588–46594.
13 Hu MC-T, Tang-Oxley Q, Qiu WR, Wang Y-P,
Mihindukulasuriya KA, Afshari R & Tan T-H (1998)
Protein phosphatase X interacts with c-Rel and stimu-
lates c-Rel ⁄ Nuclear Factor j B activity. J Biol Chem
273, 33561–33565.
14 Yeh PY, Yeh K-H, Chuang S-E, Song YC & Cheng
A-L (2004) Suppression of MEK ⁄ ERK signalling path-
way enhances cisplatin-induced NF-jB activation by
protein phosphatase 4-mediated NF-jB p65 Thr dep-
hosphorylation. J Biol Chem 279, 26143–26148.
15 Kloeker S & Wadzinski BE (1999) Purification and
identification of a novel subunit of protein serine ⁄ thre-
onine phosphatase 4. J Biol Chem 274, 5339–5347.
C. J. Hastie et al. Resistance to cisplatin
FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS 3333
16 Hastie CJ, Carnegie GK, Morrice N & Cohen PTW
(2000) A novel 50 kDa protein forms complexes with
protein phosphatase 4 and is located at centrosomal

microtubule organizing centres. Biochem J 347, 845–855.
17 Chen J, Peterson RT & Schreiber SL (1998) a4 associ-
ates with protein phosphatases 2A, 4 and 6. Biochem
Biophys Res Commun 247, 827–832.
18 Giaever G, Shoemaker DD, Jones TW, Liang H,
Winzeler EA, Astromoff A & Davis RW (1999) Geno-
mic profiling of drug sensitivities via induced haploin-
sufficiency. Nat Genet 21, 278–283.
19 Gavin A-C, Bo
¨
sche M, Krause R, Grandi P, Marzioch
M, Bauer A, Schultz J, Rick JM, Michon A-M, Cruciat
C-M et al. (2002) Functional organisation of the yeast
proteome by systematic analysis of protein complexes.
Nature 415, 141–147.
20 Ho Y, Gruhler A, Heilbut A, Bader GD, Moore L,
Adams S-L, Millar A, Taylor P, Bennet K, Boutilier K
et al. (2002) Systematic identification of protein com-
plexes in Saccharomyces cerevisiae by mass spectrome-
try. Nature 415, 180–183.
21 Brewis ND, Street AJ, Prescott AR & Cohen PTW
(1993) PPX, a novel protein serine ⁄ threonine phospha-
tase localized to centrosomes. EMBO J 12, 987–996 and
2231 (correction).
22 O’Neill BM, Hanway D, Winzeler EA & Romesberg
FE (2004) Coordinated functions of WSS1, PSY2 and
TOF1 in the DNA damage response. Nucleic Acids Res
32, 6519–6530.
23 Hazbun TR, Malmstro
¨

m L, Anderson S, Graczyk BJ,
Fox B, Riffle M, Sundin BA, Aranda JD, McDonald
WH, Chiu C-H et al. (2003) Assigning function to yeast
proteins by integration of technologies. Mol Cell 12,
1353–1365.
24 Longtine MS, McKenzie A III, Demarini DJ, Shah
NG, Wach A, Brachat A, Philippsen P & Pringle JR
(1998) Additional modules for versatile and economical
PCR-based gene deletion and modification in Saccharo-
myces cerevisiae . Yeast 14, 953–961.
25 Gietz D, St Jean A, Woods RA & Schiestl RH (1992)
Improved method for high efficiency transformation of
intact yeast cells. Nucleic Acids Res 20, 1245.
26 Schneider BL, Suefert W, Steiner B, Yang QH &
Futcher AB (1995) Use of polymerase chain reaction
epitope tagging for protein tagging Saccharomyces cere-
visiae. Yeast 11, 1265–1274.
27 Kaiser C, Michaelis S & Mitchell A (1994) Methods in
Yeast Genetics. A Cold Spring Harbour Laboratory
Course Manual. Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY.
28 Foiani M, Marini F, Gamba D, Lucchini G & Plevani
P (1994) The B subunit of the DNA polymerase a-pri-
mase complex in Saccharomyces cerevisiae executes an
essential function at the initial stage of DNA replica-
tion. Mol Cell Biol 14, 923–933.
29 Fernandez-Sarabia MJ, Sutton A, Zhong T & Arndt
KT (1992) SIT4 protein phosphatase is required for
the normal accumulation of SWI4, CLN1, CLN2
and HSC26 RNAs during late G1. Genes Dev 6,

2417–2428.
30 Black S, Andrews PD, Sneddon AA & Stark MJR
(1995) A regulated MET3–GLC7 gene fusion provides
evidence of a mitotic role for Saccharomyces cerevisiae
protein phosphatase 1. Yeast 11, 747–759.
Resistance to cisplatin C. J. Hastie et al.
3334 FEBS Journal 273 (2006) 3322–3334 ª 2006 The Authors Journal compilation ª 2006 FEBS