Báo cáo khoa học: Reconstruction ofde novopathway for synthesis of UDP-glucuronic acid and UDP-xylose from intrinsic UDP-glucose inSaccharomyces cerevisiae pptx

Reconstruction of de novo pathway for synthesis of
UDP-glucuronic acid and UDP-xylose from intrinsic
UDP-glucose in Saccharomyces cerevisiae
Takuji Oka and Yoshifumi Jigami
Research Center for Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Japan
The d-glucuronic acid and d-xylose monosaccharides
are critically important for plants, fungi, vertebrates
and mammals [1–4]. In plants, d-xylose is mainly pre-
sent in the form of cell wall polysaccharides and
N-glycan [5]. In mammals, d-xylose is involved in link-
ing proteoglycans to proteins, and d-glucuronic acid
is involved in the elongation of various types of
glycosaminoglycans [6]. Some of the O-linked glycans,
including the Xyl-a1,3-Xyl-a1,3-Glc-b1-O-Ser chain,
have also been identified as d-xylose-containing oligo-
saccharides in bovine factor IX [7].
Glycosyltransferases make use of UDP-d-glucuronic
acid (UDP-GlcA) and UDP-d-xylose (UDP-Xyl) in the
synthesis of cell wall polysaccharides and for attachment
Keywords
Saccharomyces cerevisiae; UDP-glucuronic
acid; UDP-glucuronic acid decarboxylase;
UDP-glucose dehydrogenase; UDP-xylose
Correspondence
Y. Jigami, Research Center for
Glycoscience, National Institute of Advanced
Industrial Science and Technology (AIST),
AIST Tsukuba Central 6, Higashi 1-1,
Tsukuba 305-8566, Japan
Fax: +81 29 861 6161
Tel: +81 29 861 6160

E-mail:
(Received 27 February 2006, revised 6 April
2006, accepted 12 April 2006)
doi:10.1111/j.1742-4658.2006.05281.x
UDP-d-glucuronic acid and UDP-d-xylose are required for the biosynthesis
of glycosaminoglycan in mammals and of cell wall polysaccharides in
plants. Given the importance of these glycans to some organisms, the
development of a system for production of UDP-d-glucuronic acid and
UDP-d-xylose from a common precursor could prove useful for a number
of applications. The budding yeast Saccharomyces cerevisiae lacks an
endogenous ability to synthesize or consume UDP-d-glucuronic acid and
UDP-d-xylose. However, yeast have a large cytoplasmic pool of UDP-d-
glucose that could be used to synthesize cell wall b-glucan, as a precursor of
UDP-d-glucuronic acid and UDP-d-xylose. Thus, if a mechanism for con-
verting the precursors into the end-products can be identified, yeast may be
harnessed as a system for production of glycans. Here we report a novel
S. cerevisiae strain that coexpresses the Arabidopsis thaliana genes UGD1
and UXS3, which encode a UDP-glucose dehydrogenase (AtUGD1) and a
UDP-glucuronic acid decarboxylase (AtUXS3), respectively, which are
required for the conversion of UDP-d-glucose to UDP-d-xylose in plants.
The recombinant yeast strain was capable of converting UDP-d-glucose to
UDP-d-glucuronic acid, and UDP-d-glucuronic acid to UDP-d-xylose, in
the cytoplasm, demonstrating the usefulness of this yeast system for the
synthesis of glycans. Furthermore, we observed that overexpression of
AtUGD1 caused a reduction in the UDP-d-glucose pool, whereas coexpres-
sion of AtUXS3 and AtUGD1 did not result in reduction of the UDP-d-
glucose pool. Enzymatic analysis of the purified hexamer His-AtUGD1
revealed that AtUGD1 activity is strongly inhibited by UDP-d-xylose, sug-
gesting that AtUGD1 maintains intracellular levels of UDP-d-glucose in
cooperation with AtUXS3 via the inhibition of AtUGD1 by UDP-d-xylose.

Abbreviations
AtXT1, xylosyltransferase 1; GDP-Fuc, GDP-
L-fucose; GDP-Man, GDP-D-mannose; TEAA, triethylamine acetate; UDP-Glc, UDP-D-glucose;
UDP-GlcA, UDP-
D-glucuronic acid; UDP-Xyl, UDP-D-xylose; UGD, UDP-glucose dehydrogenase; UXS, UDP-xylose synthase.
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2645
of oligosaccharides to proteins in a variety of organisms.
For example, O-xylosyltransferase I can transfer d-xy-
lose to proteoglycan core proteins in humans, and
b1,2-xylosyltransferase can transfer d-xylose via a b1,2-
linkage to the b-linked mannose of N-linked oligosac-
charides in plants [5,8]. It has also been reported that in
plants, xylosyltransferase 1 (AtXT1) is involved in cell
wall a1,6-xyloglucan biosynthesis [9].
In higher eukaryotes, UDP-Xyl is synthesized from
UDP-d-glucose (UDP-Glc) by two enzymes. These are
UDP-glucose dehydrogenase (UGD, EC 1.1.1.22),
which catalyzes formation of UDP-GlcA from UDP-
Glc by a concomitant reduction of two molecules of
NAD
+
to NADH, and UDP-glucuronic acid decarb-
oxylase (UDP-xylose synthase; UXS, EC 4.1.1.35),
which catalyzes the formation of UDP-Xyl from UDP-
GlcA via decarboxylation of the C6-carboxylic acid
component of glucuronic acid (Fig. 1). Moreover,
UDP-GlcA can also be generated by oxidation of
myoinositol in plants; however, the biological signifi-
cance and quantitative contribution of this pathway
are not yet clear (Fig. 1) [10].

UGD is a key enzyme in the biosynthesis of UDP-
GlcA, and the genes that encode UGDs have been
cloned and characterized from bacteria, fungi, plants
and mammals [11–14]. It has been reported that during
developmental stages, UGD is highly expressed in
leaves and roots but not in the stems of Arabidopsis
thaliana [13,15]. Furthermore, UGD activity is strongly
inhibited by UDP-Xyl [13,16], suggesting that feedback
inhibition may regulate conversion of various UDP-
sugars in plants (Fig. 1).
The genes encoding UXSs that irreversibly convert
UDP-GlcA to UDP-Xyl have also been identified in
fungi, in mammals and in plants, including A. thaliana
[2,4,17,18]. In fact, six different UXS isoforms have
been identified in A. thaliana and they can be classified
into two types. AtUXS1 and AtUXS2 are type II
membrane proteins localized to the Golgi. AtUXS3
lacks an N-terminal transmembrane region and is a
soluble protein localized to the cytoplasm [17,18]. In
mammalian cells, only the membrane-type UXS
enzyme has been identified [4]. The reason for the
existence of multiple UXS isoforms in plants is
unclear, and the functional differences between the
membrane-bound and soluble UXSs is also not
known.
In plants, UDP-GlcA is converted into UDP-d-api-
ose, UDP-d-galacturonic acid, UDP-Xyl and UDP-
l-arabinose, which are substrates for many cell wall
carbohydrates, including hemicellulose and pectin
(Fig. 1). UDP-sugars make up approximately 40–50%

of the wall polysaccharide mass. However, the yeast cell
wall consists mostly of b-glucan, a-mannan and chitin,
and there are no synthetic or breakdown pathways for
UDP-GlcA and UDP-Xyl. In the budding yeast Sac-
charomyces cerevisiae, UDP-Glc, which is a substrate of
b1,3-glucan synthase and b1,6-glucan synthase in the
synthesis of cell wall b-glucan polysaccharides, is abun-
dant in the cytoplasm [19–21]. Therefore, yeast appears
to have the potential to produce large amounts of
UDP-GlcA and UDP-Xyl in the cytoplasm.
Recently, two groups, including our own, reported
the synthesis of GDP-l-fucose (GDP-Fuc) from
inherent cytoplasmic GDP-d-mannose (GDP-Man) by
expressing either Escherichia coli- or A. thaliana-
derived GDP-mannose-4,6-dehydratase and GDP-
4-keto-6-deoxymannose-3,5-epimerase-4-reductase in
UDP-glucose dehydrogenase
(UGD)
UDP-glucuronic acid decarboxylase
(UXS)
2 NAD
2 NADH
+
CO
2
UDP-D-glucose
UDP-
D-glucuronic acid
UDP-
D-xylose

UDP-
D-glacturonic aci
d
UDP-D-apiose
UDP-
L-arabinose
myoinositol
D-glucuronic acid
D-glucuronic acid-1-P
Cell wall synthesis (hemicellulose, pectin etc.)
(UDP-Glc)
(UDP-GlcA)
(UDP-Xyl)
Fig. 1. Schematic representation of the
plant biosynthetic pathway for production of
UDP-sugars. UDP-xylose is produced by
UDP-glucose dehydrogenase (UGD) and
UDP-xylose synthase (UXS) activity via UDP-
glucuronic acid from UDP-glucose. The
various UDP-sugars are generated from sub-
strates by UDP-sugar-converting enzymes.
The UDP-sugars produced are then used in
cell wall synthesis. An alternative route for
the production of UDP-glucuronic acid via
myoinositol has also been identified and
characterized.
Synthesis of UDP-glucuronic acid and UDP-xylose T. Oka and Y. Jigami
2646 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS
S. cerevisiae [22,23]. Despite the biological importance
of UDP-Xyl, there is currently no affordable system

for production of large amounts of this nucleotide
sugar. Thus, we worked to develop a similar system
for in vivo production of UDP-Xyl by introducing
UDP-Xyl synthetic genes into yeast cells. Our system
facilitates efficient production of UDP-GlcA and
UDP-Xyl via conversion of a large precursor pool of
UDP-Glc into the derivative molecules. Here, we
report the generation of yeast strains capable of produ-
cing large amounts of the nucleotide sugars, and also
discuss the implications of our results in yeast for the
study of metabolic regulation in plants.
Results
Cloning and expression of AtUGD1 and AtUXS3
genes in yeast
In order to generate yeast strains capable of produ-
cing large amounts of the nucleotide sugars, we first
cloned and expressed UDP-Xyl synthetic genes in
yeast. The AtUGD1 gene, which encodes UGD, and
the AtUXS3 gene, which encodes UXS, were ampli-
fied by PCR from an A. thaliana cDNA library. Next,
we placed the AtUGD1 and AtUXS3 genes under the
control of the S. cerevisiae constitutive TDH3 promo-
ter (plasmid vectors pRS305-UGD1-VSV-G and
pRS304-UXS3-c-Myc, respectively). AtUGD1 was
N-terminally tagged with VSV-G and AtUXS3 was
C-terminally tagged with c-Myc. The constructs were
integrated into the leu2 locus of chromosome III of
S. cerevisiae strain W303a to yield the strain
TOY1, and into the trp1 locus of chromosome IV of
S. cerevisiae strain W303a to yield the strain TOY2.

The strain TOY3 coexpresses AtUGD1 and AtUXS3.
This strain was constructed by introducing the linea-
rized fragments of both pRS305-UGD1-VSV-G and
pRS304-UXS3-c-Myc into the S. cerevisiae strain
W303a. To confirm protein expression, cytoplasmic
fractions were prepared as described in Experimental
procedures, and protein production was analyzed with
antibodies to epitope tag. The AtUGD1 fusion con-
struct resulted in production of a protein of approxi-
mately 54 kDa in the TOY1 and TOY3 strains,
whereas the protein encoded by AtUXS3 was detected
as a 40-kDa band within the TOY2 and TOY3
strains (Fig. 2A).
In vitro activities of UGD and UXS
We next examined the activity of the hybrid enzymes
from cytoplasmic fractions of the recombinant TOY1
cells. UDP-GlcA synthetic activity was assayed by pro-
viding UDP-Glc as substrate and NAD
+
as a cofac-
tor. The cytoplasmic fraction of control W303a cells
showed no conversion of UDP-Glc to UDP-GlcA.
However, a cytoplasmic fraction from TOY1 cells
showed a clear UDP-GlcA peak, indicating that the
cells express an AtUGD1 gene product that is func-
tional in vitro (Fig. 2B).
6 7 8 9 1011121314
UDP-Glc
UDP-Glc
UDP-GlcA

6 7 8 9 10 11 12 13 14
Time (min)
Time (min)
W303a
TOY1
A260
B
67891011121314
UDP-Xyl
6 7 8 9 10 11 12 13 14
UDP-GlcA
UDP-GlcA
TOY2W303a
A260
C
1234 1234
AtUXS3
(40 kDa)
AtUGD1
A
(54 kDa)
Fig. 2. Expression of functional AtUGD1 and AtUXS3 in yeast. (A)
Immunoblotting analyses of AtUGD1 and AtUXS3. The presence of
the AtUGD1 enzyme was detected with VSV-G antibody. A 54-kDa
protein band was observed in the TOY1 and TOY3 strains (left
panel). The AtUXS3 enzyme was detectable as a 40-kDa band with
a c-Myc antibody in the TOY2 and TOY3 strains (right panel). Lane
1, Control W303a strain; lane 2, TOY1 strain; lane 3, TOY2 strain;
lane 4, TOY3 strain. (B) In vitro activities of UDP-glucose dehydrog-
enase. (C) In vitro activities of UDP-glucuronic acid decarboxylase.

Enzyme activities were assayed as described in Experimental pro-
cedures. Reaction samples were analyzed by HPLC using a
reverse-phase column (cosmosil 5C
18
-AR-II). The retention times of
UDP-
D-glucose (UDP-Glc), UDP-D-xylose (UDP-Xyl) and UDP-D-
glucuronic acid (UDP-GlcA) were 7.4 min, 7.8 min and 11.8 min,
respectively, under identical assay conditions.
T. Oka and Y. Jigami Synthesis of UDP-glucuronic acid and UDP-xylose
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2647
Similarly, we assayed UDP-Xyl synthesis by provi-
ding UDP-GlcA as substrate and NAD
+
as cofactor.
The cytoplasmic fraction from control W303a cells
showed no peak of UDP-Xyl, whereas that from
TOY2 cells, which express the AtUXS3 gene, showed a
prominent peak of UDP-Xyl, clearly indicating that
functional AtUXS3 can also be expressed in yeast
(Fig. 2C).
In vivo production of UDP-GlcA and UDP-Xyl
in yeast
To find whether the expression of AtUGD1 or AtUXS3
altered the intracellular levels of UDP-Glc, UDP-GlcA
and UDP-Xyl, we first analyzed the nucleotide sugars
present in W303a, TOY1 and TOY3 cells by ESI-MS.
Cells were grown in YPAD medium [1% Bacto-yeast
extract, 1% Bacto-pepton, 0.003% adenine sulfate, 2%
dextrose (glucose)] at 30 °C for 24 h and harvested by

centrifugation. Next, formic acid saturated with 1-buta-
nol was added to the cell pellets on ice, and sugar-
nucleotides were extracted from the cytoplasm (see
Experimental procedures). Finally, the extracts were
separated by C18 chromatography, and UDP-Glc,
UDP-GlcA and UDP-Xyl fractions were collected based
on the retention times with the standards. The purified
UDP-sugar fractions were analyzed by ESI-MS.
Our expectation was that the TOY1 cells would pro-
duce UDP-GlcA but be unable to convert it to UDP-
Xyl. Consistent with this, both UDP-Glc (m ⁄ z: 564.6)
and UDP-GlcA (m ⁄ z: 578.6) were detected in TOY1
cells (Fig. 3A). As TOY3 carries both enzymes, we
expected that not only UDP-Glc but also UDP-GlcA
and UDP-Xyl would be present in these cells. As expec-
ted, both UDP-Glc (m ⁄ z: 564.6) and UDP-Xyl (m ⁄ z:
534.6) were detected (Fig. 3A). However, UDP-GlcA
was not detected in the cytoplasm of the TOY3 strain.
This suggests that there was a complete conversion of
the UDP-GlcA intermediate generated by AtUGD1
activity to UDP-Xyl as a final product by AtUXS3
activity. To confirm the complete conversion of UDP-
GlcA to UDP-Xyl, we performed ESI-MS analyses on
cytoplasmic fractions of W303a, TOY1 and TOY3
cells. The assay revealed that UDP-GlcA was present
only in the cells of strain TOY1, whereas UDP-Xyl was
only present in the cells of strain TOY3, consistent with
the idea that the TOY1 and TOY3 cells are useful for
production of UDP-GlcA and UDP-Xyl, respectively.
In order to quantify the levels of UDP-sugars in the

various yeast cell strains that we constructed, purified
UDP-sugar fractions were analyzed by C30 chroma-
tography. UDP-Glc was detected in all strains, and
a reduction in the relative levels of UDP-Glc was
observed in TOY1 cells (Fig. 3B and Table 1). More-
over, UDP-GlcA accumulated in TOY1 cells at a level
of 5.71 lmolÆg
)1
(dry weight) and was not detected in
TOY3 cells (Fig. 3B and Table 1). The results indica-
ted that TOY1 could produce approximately 3.3 mg
of UDP-GlcAÆg
)1
(dry weight). As expected, UDP-Xyl
accumulated in the cytoplasm of TOY3 cells, in which
both the AtUGD1 and AtUXS3 expression vectors
were integrated into the yeast chromosome. UDP-Xyl
was expressed at a level of 1.69 lmolÆg
)1
(dry weight)
(Fig. 3B and Table 1). The results indicated that
TOY3 could produce approximately 0.9 mg of UDP-
XylÆg
)1
(dry weight). These observations are in good
agreement with what was observed by ESI-MS
(Fig. 3A).
AtUGD1 acts as a hexamer
It has been reported that mammalian UGD is active
as a hexamer (more specifically, as a trimer of dimers)

[14,24], whereas the UGDs from the virulent bacterial
strain Streptococcus pyogenes and the pathogenic yeast
strain Cryptococcus neoformans form dimers [25,26].
For plants, however, the active complex for UGD has
not previously been defined. To determine the oligo-
meric state of AtUGD1, we purified recombinant
AtUGD1 protein from yeast. To do this, we construc-
ted the TOY4 strain, which harbors an expression
plasmid that should produce a 6 · His-tagged form of
AtUGD1. Next, AtUGD1 was purified by FPLC
from a crude enzyme fraction. A single polypeptide of
approximately 54 kDa was visualized in the final
preparation following SDS ⁄ PAGE (Fig. 4A). The
molecular mass of the purified AtUGD1 was deter-
mined by HPLC analysis. The purified recombinant
AtUGD1 was eluted as a peak at a time of 26.9 min
from the gel filtration column (peak A). The inset
panel shows molecular mass determination for the
peaks with gel filtration standards. On the basis of
the elution of the molecular mass markers, this peak
corresponds to a molecular mass of approximately
328 kDa (Fig. 4B). Based on the predicted monomer
molecular mass of 53 925 Da, this indicates that
AtUGD1 is a hexamer protein. Since no peaks of
monomer AtUGD1 were detected in the purified
recombinant AtUGD1 fraction, the hexamer structure
of AtUGD1 is necessary to form an active enzyme.
AtUGD1 is involved in the maintenance of the
cytoplasmic pool of UDP-Glc in vivo
The quantitative analysis of UDP-sugars reveals that

the amount of UDP-Glc in the TOY1 strain was
Synthesis of UDP-glucuronic acid and UDP-xylose T. Oka and Y. Jigami
2648 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS
reduced to approximately 54% relative to that in
W303a strain (Fig. 3B and Table 1). In contrast, in the
TOY3 strain, the amount of UDP-Glc was comparable
to that in the W303a strain. To gain a better under-
standing of how the amount of UDP-sugars was
regulated in the cells, we analyzed several properties of
the recombinant AtUGD1. The substrate saturation
kinetics of AtUGD1 was determined by HPLC in
which the concentration of UDP-Glc was between 15
and 100 lm, and the apparent K
m
value was deter-
mined to be 15.3 lm (data not shown).
We also measured the inhibition constant (K
i
)of
AtUGD1. Inhibition by UDP-GlcA and UDP-Xyl was
measured with various concentrations of UDP-Glc and
saturating levels of NAD
+
. Double-reciprocal plots of
the data revealed a pattern consistent with competitive
inhibition when UDP-Glc was the varying substrate
(Fig. 5A,B; left panels). This kinetic pattern is entirely
W303a
TOY1
TOY3

578.6
534.6
564.6
500 510 520 530 540 550 560 570 580 590 600
(m/z)
intensity
A
UDP-Glc
UDP-GlcA
564.6
UDP-Glc
564.6
UDP-Glc
UDP-Xyl
W303a
TOY1
TOY3
A260
B
0255101520
Time (min)
UDP-Glc
UDP-Glc
UDP-Glc
UDP-Xyl
UDP-GlcA
Fig. 3. In vivo activities of UDP-glucose dehydrogenase and UDP-glucuronic acid decarboxylase. (A) ESI-MS analysis of UDP-sugars in yeast.
Nucleotide sugars were extracted as described in Experimental procedures. Ten A
600 nm
cells of UDPS-C18 fractions from W303a, TOY1

and TOY3 cells were analyzed by ESI-MS. The mass spectra are shown for the control strain W303a (upper panel), TOY1 (middle panel),
and TOY3 (bottom panel). The mass units for UDP-
D-xylose (UDP-Xyl), UDP-D-glucose (UDP-Glc) and UDP-D-glucuronic acid (UDP-GlcA) are
observable at 534.6, 564.6, and 578.6, respectively. (B) Production of UDP-GlcA and UDP-Xyl in vivo. UDP-sugars were extracted as des-
cribed in Experimental procedures. The UDPS-C30 fractions from W303a, TOY1, TOY2 and TOY3 cells were separated and detected by
HPLC. The column was equilibrated with 20 m
M triethylamine acetate (TEAA) buffer (pH 7.0) at a flow rate of 0.7 mLÆmin
)1
. UDP-sugars
were detected by UV
260 nm
absorbance. The retention times of UDP-Glc, UDP-Xyl and UDP-GlcA were 13.4 min, 14.6 min and 20.3 min,
respectively, under identical assay conditions. Experiments were performed in triplicate.
T. Oka and Y. Jigami Synthesis of UDP-glucuronic acid and UDP-xylose
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2649
consistent with both UDP-GlcA and UDP-Xyl being
competitive inhibitors for UDP-Glc binding. The
K
i
parameters 99 lm and 4.9 lm were calculated from
a replot of the slopes versus UDP-GlcA and UDP-Xyl
concentrations, respectively (Fig. 5A,B; right panels).
The results suggest that feedback inhibition occurs
when there is a low concentration of UDP-Xyl relative
to UDP-GlcA. This suggested that the UDP-GlcA gen-
erated in the cells could not strongly inhibit the
AtUGD1 activity in TOY1 cells, resulting in a 54%
reduction of the UDP-Glc pool in the TOY1 cells
relative to the amount of UDP-Glc pool in W303a
control cells. In the TOY3 strain, AtUXS3 activity

concomitantly converted UDP-GlcA to UDP-Xyl.
UDP-Xyl strongly inhibited AtUGD1 activity, and
then the UDP-Glc pool of TOY3 cells recovered to a
level comparable to that in W303a cells. This result
indicates that AtUGD1 maintains the pool of UDP-
Glc of the cell in cooperation with AtUXS3 via inhibit-
ion of UDP-Xyl by AtUGD1 in vivo.
Discussion
Bioinformatic analysis of several genome sequences
has revealed the presence of many glycosyltransferase-
like genes in the genomes of diverse species, including
the plant A. thaliana [27]. In order to study these glyc-
osyltransferase-like genes, it would be advantageous to
have access to a ready supply of sugar nucleotide sub-
strates to be used in functional analyses. However,
UDP-GlcA and UDP-Xyl have until now been pre-
cious materials. It has been difficult to produce UDP-
GlcA and UDP-Xyl in plants or bacteria, because
UDP-GlcA or UDP-Xyl synthesized in those organ-
isms are further converted to the other UDP-sugars or
used in the synthesis of oligosaccharides and polysac-
charides of the cell wall. In S. cerevisiae, however,
d-glucuronic acid and d-xylose are not components of
the cell wall and are not attached to proteins, which
gives every indication that the yeast S. cerevisiae lacks
consumptive pathways for UDP-GlcA and UDP-Xyl.
13
250
150
100

75
50
37
25
20
15
(kDa)
0.000
0.200
0.400
0.600
0.800
1.000
1.200
1.400
0.0 200.0 400.0
600.0
800.0
(Kav)
(kDa)
A
15 20 25 30 351050
A220
Time (min)
His-AtUGD1
(54 kDa)
peak A
24
AB
Fig. 4. Analysis of 6 · His-tagged AtUGD1 protein. (A) Expression and purification of recombinant 6 · His-tagged AtUGD1 protein. The

AtUGD1 cDNA was expressed under the TDH3 promoter in W303a cells. The proteins extracted from the recombinant yeast cells were sep-
arated by 4–20% SDS ⁄ PAGE, and the gel was stained with Coomassie Brilliant Blue. Lane 2, crude protein fraction; lane 3, purified protein
fraction (54 kDa shown by His-AtUGD1); lanes 1 and 4, protein molecular mass markers. (B) Oligomeric form analysis of the 6 · His-tagged
AtUGD1 protein. Purified 6 · His-tagged AtUGD1 protein was fractionated by gel filtration HPLC at a flow rate of 0.20 mLÆmin
)1
. A single
AtUGD1 peak was detected (peak A). The molecular mass of the oligomeric form was estimated by comparison with molecular mass stand-
ards. Average retention time in the column was plotted versus the log of the molecular weight for each standard (inset panel). Standards
used were as follows: thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; ovalbumin, 43 kDa.
Table 1. Quantification of UDP-sugar levels in yeast. The amounts
of UDP-glucose, UDP-glucuronic acid and UDP-xylose were calcula-
ted from peak areas shown in Fig. 3B. The amounts of sugar-nucle-
otides are expressed as the amounts of UDP-glucose equivalent,
obtained in the triplicate experiments. ND, not determined.
Strain
UDP-glucose
(lmolÆg
)1
dry weight)
UDP-glucuronic
acid (lmolÆg
)1
dry weight)
UDP-xylose
(lmolÆg
)1
dry weight)
W303a 2.21 ± 0.28 ND ND
TOY1 1.20 ± 0.23 5.71 ± 1.06 ND
TOY3 2.53 ± 0.11 ND 1.69 ± 0.40

Synthesis of UDP-glucuronic acid and UDP-xylose T. Oka and Y. Jigami
2650 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS
Thus, we reasoned that yeast could be used to make
and provide a ready source of high-quality UDP-
sugars via introduction of exogenous genes that
produce the modified sugars from substrates that are
present in yeast.
To test this hypothesis, we expressed the AtUGD1
and AtUXS3 genes, which encode UGD and UXS of
A. thaliana, with the hope of producing UDP-GlcA
and UDP-Xyl in yeast. We found that introduction of
the transgenes resulted in detectable converting activity
that changed UDP-Glc to UDP-Xyl via UDP-GlcA.
The enzymatic activity could be observed both in vivo
and in vitro in cells (or cell extracts) that express both
transgenes. Our results provide strong evidence that
recombinant AtUGD1 is efficiently expressed and
enzymatically active in S. cerevisiae (Figs 2A and 3A).
Previously, Tenhaken and Thulke reported that a
recombinant soybean UGD that has significant amino
acid identity to AtUGD1 was expressed in an inactive
form in E. coli [13]. In addition, Laurence et al. have
reported that two orthologs of AtUGD1 from tobacco
can be expressed in an inactive form in E. coli [28].
Hinterberg et al. reported that the heterologous expres-
sion of soybean UGD was successful only under a nar-
row range of conditions using an E. coli expression
system, and, moreover, the recombinant protein was
somewhat unstable [29]. These studies suggested that
the E. coli expression system is not appropriate for

expression of active UGD-converting enzymes. It is
known that eukaryotic proteins expressed in E. coli
often form protein inclusion bodies, due to a difference
in the protein-folding system between prokaryotes and
eukaryotes.
As, like A. thaliana, the yeast S. cerevisiae is eukary-
otic, it is perhaps not surprising that AtUGD1 was
successfully expressed in yeast and that the recombin-
ant protein was stable and active. However, one can-
not exclude the possibility that expression levels of
protein are dependent on codon usage of the host. For
example, arginine codons (AGA, 18.9%; AGG,
10.9%) are used at a high frequency in A. thaliana, but
both codons are rarely used in E. coli (AGA, 2.1%;
-100
00
100
200
300
400
500
-100 10 20 30
-100
0
100
200
300
400
500
600

700
-200 -100 0 100 200 300 400
50
40
30
20
10
-0.050 0.150.05 0.10
-0.050 0.150.05 0.10
40
20
100
80
60
µM
UDP-Xyl
UDP-Xyl
2.5 µM
UDP-Xyl 7.5 µM
UDP-Xyl 17.5 µM
UDP-GlcA 0
0
µM
UDP-GlcA 100 µM
UDP-GlcA 200 µM
UDP-GlcA 300 µM
1/UGD activity
(µ
M [UDP-Glc]/min)
-1

1/UGD activity
(µ
M [UDP-Glc]/min)
-1
(Slope (v vs UDP-Glc
-1
)
-1
[UDP-Xyl] (µM)
[UDP-GlcA] (µ
M)
1/[UDP-Glc]
-1
1/[UDP-Glc] (µM)
-1
(Slope (v vs UDP-Glc
-1
)
-1
B
A
(µM)
Fig. 5. Inhibition of recombinant AtUGD1
protein. (A) Inhibition kinetics on UDP-
D-
xylose (UDP-Xyl) using UDP-
D-glucose (UDP-
Glc) as the variable substrate. (B) Inhibition
kinetics on UDP-
D-glucuronic acid (UDP-

GlcA) using UDP-Glc as the variable sub-
strate. UDP-glucose dehydrogenase
(10.8 · 10
)6
Unit) was assayed at 25 °Cand
at pH 8.4 for 40 min. One unit of enzyme
activity is defined as the amount of enzyme
that resulted in production of 1 lmol UDP-
GlcAÆmin
)1
at 25 °C. For each substrate,
reactions were performed in duplicate.
T. Oka and Y. Jigami Synthesis of UDP-glucuronic acid and UDP-xylose
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2651
AGG, 1.2%). It has been suggested that differences in
codon usage could account for limited or poor protein
expression in E. coli. In contrast to what is true for
bacteria, codon usage in S. cerevisiae (AGA, 21.3%;
AGG, 9.3%) is similar to that in A. thaliana [30].
Therefore, expression in the yeast S. cerevisiae has the
potential to be a better system for the characterization
of many plant genes for which researchers do not
know and ⁄ or have not yet been able to test the bio-
chemical function of their gene products.
In this work, molecular mass determination
revealed that AtUGD1 acts as a hexamer. Previously,
a recombinant UGD1 from soybean expressed in
E. coli was reported to act as monomer [29]. How-
ever, as the recombinant protein in E. coli was some-
what unstable, it seems plausible that the exogenous

protein was misfolded in bacteria, thus clouding inter-
pretation of the experimental result. A hexameric
structure has been observed for the native soybean
UGD in gel filtration studies [31]. We confirmed the
results of the above studies. In this work, in no case
did we observe any data consistent with a monomer.
Instead, the most probable interpretation of the
results presented here is that the AtUGD1 protein is
active as a hexamer, just as has been found for sev-
eral other eukaryotic proteins of this type. In addi-
tion, Sommer et al. indicated that the Lys279 residue
of human UGD is likely to have a role in maintain-
ing the hexameric structure [24], and the Lys279 resi-
due is conserved in the amino acid sequence of
AtUGD1, consistent with our results.
The quantification of UDP-sugars in yeast cell
extracts revealed that in the TOY1 strain expressing
only AtUGD1, UDP-GlcA accumulated to a large
extent in the cytoplasm. In addition, the TOY3 strain
coexpressing AtUGD1 and AtUXS3 could produce
UDP-Xyl but we did not observe significant accumulat-
ion of the UDP-GlcA intermediate (Table 1). Recently,
Ernst and Klaffke reported the chemical synthesis of
UDP-Xyl [32]; however, their method had some poten-
tial problems, including low yield and contamination of
the final compound with a ⁄ b anomers (a ⁄ b ¼ 5 : 3). In
the case of enzymatic conversion of UDP-sugar, it is
not necessary to consider contamination with a ⁄ b ano-
mers. Furthermore, as our system is based on yeast,
which is essentially a renewable factory for protein

production, our system makes it at least theoretically
possible to scale up production levels dramatically.
There are many important and valuable UDP-sugars
in plants in addition to UDP-GlcA and UDP-Xyl,
such as UDP-l-arabinose, UDP-d-galacturonic acid,
UDP-l-rhamnose and UDP-d-apiose [1]. It is difficult
to isolate these UDP-sugars from the plant biomass,
because most of the sugars are incorporated into plant
structures. As these UDP-sugars can be produced
from UDP-Glc, valuable UDP-sugars can be synthes-
ized by expressing the responsible UDP-sugar-convert-
ing enzymes in yeast cells [33–37].
Our system for creating a UDP-Xyl synthesis path-
way in yeast provided clear evidence that UDP-Xyl
plays an important role in maintaining the cytoplasmic
pool of UDP-Glc in vivo, suggesting that the proposed
regulatory system for the UDP-Glc pool may also be
applicable in plant cells. UDP-Glc is important for
synthesis of the cell wall in plants. Thus, it is essential
for plants to maintain a constant pool of UDP-Glc,
which is accomplished by a regulatory system in the
cell. In TOY1 yeast cells (with AtUGD1), the UDP-
Glc pool was reduced due to the lack of a similar regu-
latory system. In contrast, in TOY3 yeast cells (with
both AtUGD1 and AtUXS3), the UDP-Glc pool was
maintained at levels comparable to the UDP-Glc pool
in W303a control cells. Many enzymatic and transcrip-
tional studies have suggested that the production of
UDP-GlcA may be rate-limiting in providing precur-
sors for synthesis of the cell wall [13,15,16]. However,

it has been impossible to obtain direct confirmation of
the hypothesis on the basis of the size of the UDP
pool in vivo, because of the complexity of the UDP-
sugar regulation system in plant cells. Our yeast sys-
tem, by contrast, made it possible to quantify changes
in the UDP-sugar pool in vivo, as these cells lack
endogenous UDP-sugar-converting enzymes, with the
exception of enzymes used in the synthesis of UDP-
Glc, UDP-d-galactose and UDP-N-d-acetylglucosa-
mine.
We previously reported that MUR1 and GER1
tightly associate to form a functional complex required
for the stable enzymatic activity that can produce
GDP-Fuc from GDP-Man [23]. However, interaction
between AtUGD1 and AtUXS3 was not observed in
immunoprecipitation experiments (data not shown),
suggesting that the regulation of the UDP-Glc pool is
not the result of direct protein interaction but is
instead mediated by an intermediary inhibition mech-
anism of UDP-Xyl. Thus, the yeast reconstruction sys-
tem will be useful to further understand the regulation
and interaction of UDP-sugar-converting enzymes.
Yeast can be used as a host for the expression of
valuable proteins modified by artificial glycosylation
[38,39]. Kainuma et al. indicated that protein glycosy-
lation remodeling can be carried out using intrinsic
sugar nucleotides in yeast via the introduction of
heterologous genes required for artificial glycosylation
[38]. Here, we built on that success by constructing
recombinant yeast strains that produce the sugar

Synthesis of UDP-glucuronic acid and UDP-xylose T. Oka and Y. Jigami
2652 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS
nucleotides UDP-GlcA and UDP-Xyl, similar to what
was done for production of recombinant yeasts that
make GDP-Fuc from GDP-Man [23]. In the future, it
will be interesting to explore the possibility of expand-
ing the approach to generate novel yeast strains that
can produce proteins that have been modified by gly-
cosylation with sugars not normally found in yeast,
such as gluruconic acid, xylose and fucose.
Experimental procedures
Microorganisms and growth conditions
The yeast strains used in this work are listed in Table 2.
S. cerevisiae W303a cells were used as the wild-type strain
for this study [40]. Strains were grown in synthetic minimal
medium containing 0.5% dextrose (glucose) (SD) or YPAD
medium [41]. Cell growth in submerged culture was done
by inoculating 0.1 D
600 nm
cells into 200 mL of growth
medium in a 1000-mL Erlenmeyer flask. The flasks were
then shaken at 120 r.p.m. at 30 °C. Standard transforma-
tion procedures for S. cerevisiae were used [42].
Construction of the expression vector
Plasmid vectors for expression of AtUGD1 and AtUXS3
(GenBank accession numbers AY143922 and AF387789)
were constructed as follows. The genes were amplified by
PCR from an A. thaliana lambda cDNA Library (Strata-
gene, La Jolla, CA) using the following oligonucleotide
primers: for UGD-VSV-G, UGD1-VSV-G-EcoRI-F

(5¢-AGAATTCATGTATACTGATATTGAAATGAATAG
ATTGGGTAAAATGGTGAAGATATGCTGCATAGGA
G-3¢) and UGD1-SalI-R (5¢ -AAAAAGTCGACTCATGCC
ACAGCAGGCATATCCTT-3¢); for UGD1-His, UGD1-
His-EcoRI-F (5¢-AGAATTCATGCATCACCATCACCAT
CACATGGTGAAGATATGCTGCATAG-3¢) and UGD1-
SalI-R, UXS3-EcoRI-F (5¢-AGATTCATGGCAGCTACA
AGTGAGAAACAGA-3¢); and for UXS-c-Myc, UXS3-c-
Myc-XhoI-R (5¢-TCTCGAGTTACAAATCTTCTTCAGAA
ATCAATTTTTGTTCGTTTCTTGGGACGTTAAGCCTT
AG-3¢). The PCR products were digested with the appro-
priate restriction enzymes and ligated into similarly digested
YEp352-GAP-II [23] to yield YEp352-GAP-II-UGD1-VSV-
G, Yep352-GAP-II-UGD1-His and YEp352-GAP-II-
UXS3-c-Myc. Next, BamHI fragments that included the
AtUGD1 and AtUXS3 gene expression cassettes from
YEp352-GAP-II-UGD1-VSV-G and YEp352-GAP-II-
UXS3-c-Myc were inserted into the BamHI sites of pRS305
and pRS304 to yield pRS305-UGD1-VSV-G and pRS304-
UXS3-c-Myc, respectively. The DNA sequence of the
expression constructs was confirmed using an ABI PRISM
3100 Genetic Analyzer (Applied Biosystems, Foster, CA).
Immunoblot analysis
Protein concentration was determined using the bicinchoni-
nic acid protein assay reagent (Pierce Biotechnology, Inc.,
Rockford, IL) with bovine serum albumin as a standard.
SDS ⁄ PAGE was performed on crude cell lysates
(D
600 nm
¼ 2.0). Proteins were then transferred to a polyv-

inylidene fluoride membrane filter using an electroblotter
(ATTO, Tokyo, Japan) at 100 mA for 1 h. After incubation
of the membrane filter for 1 h in blocking buffer (3% skim-
med milk, 10 mm phosphate buffer pH 7.4, 0.9% NaCl),
the membrane was incubated in 2 mL of blocking buffer
with a 1 : 1000 dilution of affinity-purified goat VSV-G
polyclonal antibody (Bethyl, Inc., Montgomery, TX) or
c-Myc monoclonal antibody 9E10 (CRP, Inc., Cumberland,
VA). The membrane was next incubated for 1 h at the
room temperature, washed three times with 10 mm phos-
phate buffer (pH 7.4) and 0.9% (w ⁄ v) NaCl (NaCl ⁄ P
i
buffer) for a total of 30 min, and then incubated for 1 h
with a 1 : 1000 dilution of anti-goat IgG conjugate horse
radish peroxidase (Santa Cruz Biotechnology, Inc., Santa
Cruz, CA) or anti-mouse IgG conjugate horse radish per-
oxidase (Valeant Pharmaceuticals International, Costa
Mesa, CA).
Preparation of crude enzyme fractions
First, yeast were grown in YPAD medium at 30 °C for 24 h.
Next, cells were harvested (D
600 nm
¼ 150), resuspended in
5mLof10mm Tris ⁄ HCl buffer (pH 7.8) in the presence of
a protease inhibitor, and finally lysed with glass beads. The
extract was subjected to 100 000 g centrifugation to remove
the membrane fraction and the supernatant was used in sub-
sequent enzymatic assays.
Table 2. Yeast strains.
Yeast strains Genotype or description Source or reference

W303a MATa leu2-3, his3-11, trp1-1, can1-100, ade2-1, ura3-1 [40]
TOY1 As in W303a and leu2-3::pRS-305-UGD1-VSV-G This study
TOY2 As in W303a and trp1-1::pRS-304-UXS3-c-Myc This study
TOY3 As in W303a and leu2-3::pRS-305-UGD1-VSV-G, trp1–1::pRS-304-UXS3-c-Myc This study
TOY4 As in W303a harboring expression plasmid YEp352-GAP-II-UGD1-His This study
T. Oka and Y. Jigami Synthesis of UDP-glucuronic acid and UDP-xylose
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2653
UGD assay
The in vitro assay for UGD was performed using the follow-
ing reaction mixture (total volume 100 lL): 5 mm UDP-
glucose; 0.5 mm NAD
+
; protease inhibitor (one tablet of
Complete ⁄ 50 mL; Roche, Mannheim, Germany); 50 mm
Tris ⁄ HCl (pH 8.6); and S. cerevisiae cell extract supernatant
(see above) at D
600 nm
¼ 10. Reaction mixtures were incuba-
ted at 30 °C for 60 min and the reaction was stopped by
vortex mixing with 100 lL of ice-cold phenol ⁄ chloroform ⁄
isoamyl alcohol (25 : 24 : 1). Next, 5 lL of the reacted cell
supernatants were analyzed by HPLC with cosmosil 5C
18
-
AR-II (250 · 4.6 mm; Nacalai Tesque, Kyoto, Japan). The
column was equilibrated with 20 mm triethylamine acetate
(TEAA) buffer (pH 7.0) at a flow rate of 1 mLÆmin
)1
. UDP-
sugars were detected by UV

260 nm
absorbance [13].
UDP-glucuronic acid decarboxylase assay
The assay for in vitro UGD was adapted for detection of
UDP-glucuronic acid decarboxylase activity by replacing
5mm UDP-Glc and 50 mm Tris ⁄ HCl (pH 8.6) with 5 mm
UDP-GlcA and 50 mm Tris ⁄ HCl (pH 6.8), respectively [2].
Extraction of sugar nucleotides from yeast cells
Extraction of sugar nucleotides from yeast cells was done
as follows. Briefly, yeast cells were cultivated and harvested
(D
600 nm
¼ 150). Next, 15 mL of ice-cold 1 m formic acid
saturated with 1-butanol was added to the cells and incuba-
ted for 1 h at 4 °C [23]. The samples were then centrifuged
at 13 000 g for 5 min to remove cell debris. Next, superna-
tants were lyophilized and redissolved in 300 lL of water.
Finally, samples were filtered using a filter with a pore size
of 0.2 lm (Millipore, Billerica, MA). Dry weight of the
yeast cells was measured after lyophilization.
Independent experiments were done in triplicate. Dry
weight of the yeast cells (g weight per D
600 nm
) was measured
after lyophilization of the aliquot of cells (D
600 nm
¼ 160–
180).
Mass spectrometry
Sugar nucleotide fractions were separated on a cosmosil

5C
18
-AR-II column (Nacalai Tesque). The column was
equilibrated with 20 mm TEAA buffer (pH 7.0) at a flow
rate of 1 mLÆmin
)1
. UDP-sugars were detected by UV
260 nm
absorbance. The peaks of UDP-Glc, UDP-GlcA and UDP-
Xyl activity that were detected were collected based on the
retention times of the standards. UDP-Glc, UDP-Xyl and
UDP-GlcA fractions from the W303a, TOY1 and TOY3
strains were harvested and mixed, respectively. The mixed
fractions were designated ‘UDPS-C18’. The UDPS-C18
fractions were analyzed by ESI-MS. Mass spectra were
acquired on an Esquire 3000-plus instrument (Bruker
Daltonik GmbH, Bremen, Germany) in the negative-ion
mode. Conditions for ESI-MS were as follows: 68.95 kPa
nebulizer flow, 300 °C nozzle temperature, and 5.0 LÆmin
)1
flow of drying gas (N
2
). Negative-ion spectra were gener-
ated by scanning the m ⁄ z range 500–600.
Analysis and quantification of UDP-sugar
nucleotides
The UDPS-C18 fractions were reseparated on a Develosil
RPAQUEOUS column (250 · 4.6 mm; Nomura Chemical
Co., Ltd, Seto, Japan). The column was equilibrated with
20 mm TEAA buffer (pH 7.0) at a flow rate of 0.7 mLÆ

min
)1
. UDP-sugars were detected by UV
260 nm
absorbance.
The peaks of UDP-Glc, UDP-GlcA and UDP-Xyl that
were detected were collected based on the retention times of
the standards. The combined fractions were designated
‘UDPS-C30’. The structures of the UDP-sugars were identi-
fied by the molecular mass, according to the ESI-MS
results. Sugar-nucleotides were quantified by absorbance
intensity and expressed as UDP-Glc equivalents. Independ-
ent experiments were done in triplicate.
Purification of UGD
The 6 · His-tagged AtUGD1 protein was purified from
yeast cell extracts using the AKTA explorer 10S FPLC Sys-
tem (GE Healthcare Bio-Sciences Corp., Piscataway, NJ).
All steps were performed at 4 °C unless otherwise stated. To
prepare the cell extracts, yeast cells were grown in SD
(– uracil) medium at 30 °C for 24 h. Cells were harvested
(D
600 nm
¼ 800), resuspended in approximately 100 mL of
10 mm Tris ⁄ HCl buffer (pH 8.0) containing protease inhib-
itor, and then lysed with glass beads. Cell debris was
removed by centrifugation at 15 000 g for 15 min and the
supernatant was loaded onto a 1-mL HisTrap HP column
(GE Healthcare Bio-Sciences Corp.) that had been equili-
brated with buffer A (10 mm Tris ⁄ HCl, pH 8.0). The col-
umn was washed with buffer A until the breakthrough peak

of protein had been eluted. The enzyme was then eluted by a
gradient up to 500 mm imidazole. The fractions containing
6 · His-tagged AtUGD1 protein were pooled and concen-
trated with a YM30 membrane (Millipore), applied to a Hi-
Load 16 ⁄ 60 Superdex 200-pg column (1.6 cm · 60.0 cm;
GE Healthcare Bio-Sciences Corp.), and equilibrated in buf-
fer B (10 mm Tris ⁄ HCl, pH 8.0, and 150 mm NaCl). The
sample was eluted at a rate of 1 mLÆmin
)1
in buffer B. Act-
ive fractions were concentrated to 1 mL by ultrafiltration
over a YM30 membrane (Millipore), and stored at 4 °C.
The purified enzymes were analyzed by SDS ⁄ PAGE. Protein
concentrations were determined with the bicinchoninic acid
protein assay reagent (Pierce Biotechnology, Inc., Rockford,
IL) using bovine serum albumin as a standard.
Synthesis of UDP-glucuronic acid and UDP-xylose T. Oka and Y. Jigami
2654 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS
Kinetic studies
The level of activity of UGD was estimated by determining
the amount of UDP-GlcA. Reaction mixtures contained
Tris ⁄ HCl (50 mm, pH 8.6), NAD
+
(0.5 mm), UDP-Glc and
10.8 · 10
)6
Units of purified AtUGD1 in a total volume
of 50 lL. Variations in the reaction mixture are noted in
the text. Reactions were started by the addition of NAD
+

.
One unit of enzyme activity is defined as the amount of
enzyme resulting in the production of 1 lmol UDP-GlcAÆ
min
)1
at 25 °C. Assay mixtures were incubated for 40 min,
and the reaction was stopped by vortex mixing with 50 lL
of ice-cold phenol ⁄ chloroform ⁄ isoamyl alcohol (25 : 24 : 1);
this was followed by centrifugation (15 000 g for 5 min at
4 °C). Next, 30 lL of each supernatant was applied to a
Develosil RPAQUEOUS column (250 · 4.6 mm; Nomura
Chemical Co.). The column was equilibrated with 20 mm
TEAA buffer (pH 7.0) at a flow rate of 0.7 mLÆmin
)1
.
UDP-sugars were detected by UV
260 nm
absorbance, and
sugar nucleotides were quantified against UDP-Glc as a
standard. Linearity (r
2
¼ 0.99) was maintained between 0
and 10 lm of UDP-Glc per 30 lL of injection volume. The
K
m
value was determined using the Michaelis–Menten
equation. For further mechanistic analysis, double-recipro-
cal plots and secondary replots were constructed. The
K
i

parameter was determined by replot analysis.
Molecular mass determination of protein
complex
The functional molecular mass of active 6 · His-tagged
AtUGD1 enzyme complex was determined on a PROTEIN
KW-803 column (Showa Denko K. K., Tokyo, Japan). The
column was equilibrated with buffer B (10 mm Tris ⁄ HCl,
pH 8.0, and 150 mm NaCl). The protein complex was
detected by UV
220 nm
absorbance. Purified recombinant
AtUGD1 was loaded onto the column with an HPLC sys-
tem (Shimadzu Co., Kyoto, Japan) at a flow rate of
0.2 mLÆmin
)1
. Size determination was performed by com-
parison with molecular mass standards (GE Healthcare
Bio-Sciences Corp.) loaded onto the column under the same
conditions. The molecular mass standards used were as fol-
lows: thyroglobulin, 669 kDa; ferritin, 440 kDa; catalase,
232 kDa; ovalbumin, 43 kDa.
Acknowledgements
This work was supported by grants from the New
Energy and Industrial Technology Development
Organization of Japan (NEDO). We thank Dr Shige-
yasu Ito and Minako Takashiba for ESI-MS analysis,
Toshihiko Kitajima for protein purification, and
Dr Takehiko Yoko-o for critical reading of the manu-
script. We are indebted to Drs Ken-ichi Nakayama,
Yasunori Chiba, Xiao-Dong Gao, Yoh-ichi Shimma

and the members of our laboratory for stimulating dis-
cussions.
References
1 Seifert GJ (2004) Nucleotide sugar interconversions and
cell wall biosynthesis: how to bring the inside to the
outside. Curr Opin Plant Biol 7, 277–284.
2 Bar-Peled M, Griffith CL & Doering TL (2001) Func-
tional cloning and characterization of a UDP-glucuronic
acid decarboxylase: the pathogenic fungus Cryptococcus
neoformans elucidates UDP-xylose synthesis. Proc Natl
Acad Sci USA 98, 12003–12008.
3 Hwang HY & Horvitz HR (2002) The SQV-1 UDP-glu-
curonic acid decarboxylase and the SQV-7 nucleotide-
sugar transporter may act in the Golgi apparatus to
affect Caenorhabditis elegans vulval morphogenesis and
embryonic development. Proc Natl Acad Sci USA 99,
14218–14223.
4 Moriarity JL, Hurt KJ, Resnick AC, Storm PB,
Laroy W, Schnaar RL & Snyder SH (2002) UDP-glu-
curonate decarboxylase, a key enzyme in proteoglycan
synthesis: cloning, characterization, and localization.
J Biol Chem 277, 16968–16975.
5 Strasser R, Mucha J, Mach L, Altmann F, Wilson IB,
Glossl J & Steinkellner H (2000) Molecular cloning and
functional expression of beta1,2-xylosyltransferase cDNA
from Arabidopsis thaliana. FEBS Lett 472, 105–108.
6 Wilson IB (2004) The never-ending story of peptide
O-xylosyltransferase. Cell Mol Life Sci 61, 794–809.
7 Hase S, Nishimura H, Kawabata S, Iwanaga S & Ike-
naka T (1990) The structure of (xylose) 2glucose-O-ser-

ine 53 found in the first epidermal growth factor-like
domain of bovine blood clotting factor IX. J Biol Chem
265, 1858–1861.
8 Gotting C, Kuhn J, Zahn R, Brinkmann T & Kleesiek
K (2001) Molecular cloning and expression of human
UDP-d-xylose: proteoglycan core protein beta-d-xylosyl-
transferase and its first isoform XT-II. J Mol Biol 304,
517–528.
9 Faik A, Price NJ, Raikhel NV & Keegstra K (2002) An
Arabidopsis gene encoding an alpha-xylosyltransferase
involved in xyloglucan biosynthesis. Proc Natl Acad Sci
USA 99, 7797–7802.
10 Kanter U, Usadel B, Guerineau F, Li Y, Pauly M &
Tenhaken R (2005) The inositol oxygenase gene family
of Arabidopsis is involved in the biosynthesis of nucleo-
tide sugar precursors for cell-wall matrix polysacchar-
ides. Planta 221, 243–254.
11 Sieberth V, Rigg GP, Roberts IS & Jann K (1995)
Expression and characterization of UDP-Glc dehydro-
genase (KfiD), which is encoded in the type-specific
region 2 of the Escherichia coli K5 capsule genes.
J Bacteriol 177, 4562–4565.
T. Oka and Y. Jigami Synthesis of UDP-glucuronic acid and UDP-xylose
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2655
12 Griffith CL, Klutts JS, Zhang L, Levery SB &
Doering TL (2004) UDP-glucose dehydrogenase plays
multiple roles in the biology of the pathogenic fungus
Cryptococcus neoformans. J Biol Chem 279, 51669–
51676.
13 Tenhaken R & Thulke O (1996) Cloning of an enzyme

that synthesizes a key nucleotide-sugar precursor of
hemicellulose biosynthesis from soybean: UDP-glucose
dehydrogenase. Plant Physiol 112, 1127–1134.
14 Lind T, Falk E, Hjertson E, Kusche-Gullberg M &
Lidholt K (1999) cDNA cloning and expression of
UDP-glucose dehydrogenase from bovine kidney. Glyco-
biology 9, 595–600.
15 Seitz B, Klos C, Wurm M & Tenhaken R (2000) Matrix
polysaccharide precursors in Arabidopsis cell walls are
synthesized by alternate pathways with organ-specific
expression patterns. Plant J 21, 537–546.
16 Turner W & Botha FC (2002) Purification and kinetic
properties of UDP-glucose dehydrogenase from sugar-
cane. Arch Biochem Biophys 407, 209–216.
17 Harper AD & Bar-Peled M (2002) Biosynthesis of
UDP-xylose. Cloning and characterization of a novel
Arabidopsis gene family, UXS, encoding soluble and
putative membrane-bound UDP-glucuronic acid decar-
boxylase isoforms. Plant Physiol 130, 2188–2198.
18 Pattathil S, Harper AD & Bar-Peled M (2005) Biosynth-
esis of UDP-xylose: characterization of membrane-
bound AtUxs2. Planta 221, 538–548.
19 Douglas CM, Foor F, Marrinan JA, Morin N,
Nielsen JB, Dahl AM, Mazur P, Baginsky W, Li W,
el-Sherbeini M, Clemas JA, Mandala SM, Frommer BR
& Kurtz MB (1994) The Saccharomyces cerevisiae FKS1
(ETG1) gene encodes an integral membrane protein
which is a subunit of 1,3-beta-D-glucan synthase. Proc
Natl Acad Sci USA 91, 12907–12911.
20 Mazur P, Morin N, Baginsky W, el-Sherbeini M, Clemas

JA, Nielsen JB & Foor F (1995) Differential expression
and function of two homologous subunits of yeast 1,3-
beta-D-glucan synthase. Mol Cell Biol 15, 5671–5681.
21 Shahinian S & Bussey H (2000) beta-1,6-Glucan synthesis
in Saccharomyces cerevisiae. Mol Microbiol 35, 477–489.
22 Mattila P, Rabina J, Hortling S, Helin J & Renkonen R
(2000) Functional expression of Escherichia coli enzymes
synthesizing GDP-L-fucose from inherent GDP-D-man-
nose in Saccharomyces cerevisiae. Glycobiology 10,
1041–1047.
23 Nakayama K, Maeda Y & Jigami Y (2003) Interaction
of GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reduc-
tase with GDP-mannose-4,6-dehydratase stabilizes the
enzyme activity for formation of GDP-fucose from
GDP-mannose. Glycobiology 13, 673–680.
24 Sommer BJ, Barycki JJ & Simpson MA (2004)
Characterization of human UDP-glucose dehydrogen-
ase. CYS-276 is required for the second of two succes-
sive oxidations. J Biol Chem 279, 23590–23596.
25 Campbell RE, Mosimann SC, van De Rijn I,
Tanner ME & Strynadka NC (2000) The first structure
of UDP-glucose dehydrogenase reveals the catalytic resi-
dues necessary for the two-fold oxidation. Biochemistry
39, 7012–7023.
26 Bar-Peled M, Griffith CL, Ory JJ & Doering TL (2004)
Biosynthesis of UDP-GlcA, a key metabolite for capsu-
lar polysaccharide synthesis in the pathogenic fungus
Cryptococcus neoformans. Biochem J 381, 131–136.
27 Scheible WR & Pauly M (2004) Glycosyltransferases
and cell wall biosynthesis: novel players and insights.

Curr Opin Plant Biol 7, 285–295.
28 Bindschedler LV, Wheatley E, Gay E, Cole J, Cottage
A & Bolwell GP (2005) Characterisation and expression
of the pathway from UDP-glucose to UDP-xylose in
differentiating tobacco tissue. Plant Mol Biol 57, 285–
301.
29 Hinterberg B, Klos C & Tenhaken R (2002) Recombi-
nant UDP-glucose dehydrogenase from soybean. Plant
Physiol Biochem 40, 1011–1017.
30 Nakamura Y, Gojobori T & Ikemura T (2000) Codon
usage tabulated from the international DNA sequence
databases: status for the year. Nucleic Acids Res 28,
292.
31 Stewart DC & Copeland L (1998) Uridin 5¢-diphos-
phate-glucose dehydrogenase from soybean nodules.
Plant Physiol 116, 349–355.
32 Ernst C & Klaffke W (2003) Chemical synthesis of uri-
dine diphospho-D-xylose and UDP-L-arabinose. J Org
Chem 68, 5780–5783.
33 Seifert GJ, Barber C, Wells B, Dolan L & Roberts K
(2002) Galactose biosynthesis in Arabidopsis: genetic evi-
dence for substrate channeling from UDP-D-galactose
into cell wall polymers. Curr Biol 12, 1840–1845.
34 Burget EG, Verma R, Molhoj M & Reiter WD (2003)
The biosynthesis of l-arabinose in plants: molecular
cloning and characterization of a Golgi-localized UDP-
D-xylose 4-epimerase encoded by the MUR4 gene of
Arabidopsis. Plant Cell 15, 523–531.
35 Molhoj M, Verma R & Reiter WD (2004) The bio-
synthesis of D-galacturonate in plants: functional clon-

ing and characterization of a membrane-anchored
UDP-D-glucuronate 4-epimerase from Arabidopsis.
Plant Physiol 135, 1221–1230.
36 Molhoj M, Verma R & Reiter WD (2003) The biosynth-
esis of the branched-chain sugar d-apiose in plants: func-
tional cloning and characterization of a UDP-d-
apiose ⁄ UDP-d-xylose synthase from Arabidopsis. Plant J
35, 693–703.
37 Usadel B, Kuschinsky AM, Rosso MG, Eckermann N
& Pauly M (2004) RHM2 is involved in mucilage pectin
synthesis and is required for the development of the
seed coat in Arabidopsis. Plant Physiol 134, 286–295.
38 Kainuma M, Ishida N, Yoko-o T, Yoshioka S, Takeu-
chi M, Kawakita M & Jigami Y (1999) Coexpression of
Synthesis of UDP-glucuronic acid and UDP-xylose T. Oka and Y. Jigami
2656 FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS
alpha1,2 galactosyltransferase and UDP-galactose trans-
porter efficiently galactosylates N- and O-glycans in
Saccharomyces cerevisiae. Glycobiology 9, 133–141.
39 Chiba Y, Suzuki M, Yoshida S, Yoshida A, Ikenaga H,
Takeuchi M, Jigami Y & Ichishima E (1998) Production
of human compatible high mannose-type (Man5-
GlcNAc2) sugar chains in Saccharomyces cerevisiae.
J Biol Chem 273, 26298–26304.
40 Thomas BJ & Rothstein R (1989) The genetic control
of direct-repeat recombination in Saccharomyces: the
effect of rad52 and rad1 on mitotic recombination at
GAL10, a transcriptionally regulated gene. Genetics 123,
725–738.
41 Sherman F (1991) Getting started with yeast. Methods

Enzymol 194, 3–21.
42 Gietz D, St Jean A, Woods RA & Schiestl RH (1992)
Improved method for high efficiency transformation of
intact yeast cells. Nucleic Acids Res 20, 1425.
T. Oka and Y. Jigami Synthesis of UDP-glucuronic acid and UDP-xylose
FEBS Journal 273 (2006) 2645–2657 ª 2006 The Authors Journal compilation ª 2006 FEBS 2657