Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Molecular and functional characterization of a novel splice
variant of ANKHD1 that lacks the KH domain and its role
in cell survival and apoptosis
Melissa C. Miles
1
, Michelle L. Janket
1
, Elizabeth D. A. Wheeler
1
, Ansuman Chattopadhyay
2
,
Biswanath Majumder
1
, Jeremy DeRicco
1
, Elizabeth A. Schafer
1
and Velpandi Ayyavoo
1
1 Department of Infectious Diseases & Microbiology, Graduate School of Public Health, University of Pittsburgh, PA, USA
2 Health Sciences Library System, University of Pittsburgh, PA, USA
The ankyrin repeat motif (ANK) is one of the most
common protein motifs found in the protein database.
The ankyrin repeat is a 33-amino acid motif present
in repeats of 12–24 and first identified in yeast and
Drosophila [1]. Ankyrin-repeat-containing proteins
regulate multiple cellular functions including transcrip-
tional regulation, cell-cycle regulation, ion channel, cell
survival, and cell signaling [2–4]. In addition, ankyrin
repeat proteins also participate in protein–protein

interactions via their repeat motifs [5,6]. Using yeast
two-hybrid system analysis, we identified a protein
containing a single ankyrin repeat that interacts with
HIV-1 viral protein R (Vpr) and we designated this
protein as Vpr-binding ankyrin repeat protein
(VBARP). This interaction was further confirmed by a
mammalian hybrid system as well as in vivo interaction
Keywords
ANKHD1; ankyrin repeats; apoptosis; cell
survival; HIV-1 Vpr
Correspondence
V. Ayyavoo, Department of Infectious
Diseases and Microbiology, Graduate School
of Public Health, University of Pittsburgh,
130 DeSoto Street, Pittsburgh,
PA 15261, USA
Fax: +1 412 624 5612
Tel: +1 412 624 3070
E-mail:
(Received 16 May 2005, revised 7 June
2005, accepted 14 June 2005)
doi:10.1111/j.1742-4658.2005.04821.x
Multiple ankyrin repeat motif-containing proteins play an important role
in protein–protein interactions. ANKHD1 proteins are known to possess
multiple ankyrin repeat domains and a single KH domain with no known
function. Using yeast two-hybrid system analysis, we identified a novel
splice variant of ANKHD1. This splice variant of ANKHD1, which we
designated as HIV-1 Vpr-binding ankyrin repeat protein (VBARP), does
not contain the signature KH domain, and codes for only a single ankyrin
repeat motif. We characterized VBARP by molecular and functional ana-

lysis, revealing that VBARP is ubiquitously expressed in different tissues as
well as cell lines of different lineage. In addition, blast searches indicated
that orthologs and homologs to VBARP exist in different phyla, suggesting
that VBARP might be evolutionarily conserved, and thus may be involved
in basic cellular function(s). Furthermore, biochemical analysis revealed the
presence of two VBARP isoforms coding for 69 and 49 kDa polypeptides,
respectively, that are primarily localized in the cytoplasm. Functional ana-
lysis using short interfering RNA approaches indicate that this gene prod-
uct is essential for cell survival through its regulation of caspases. Taken
together, these results indicate that VBARP is a novel splice variant of
ANKHD1 and may play a role in cellular apoptosis (antiapoptotic) and
cell survival pathway(s).
Abbreviations
ANK, ankyrin repeat motif; ANKHD1, ankyrin repeat and KH domain 1; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine
serum; HEK293, human embryonic kidney 293; hMASK, human multiple ankyrin repeats single KH domain; NLS, nuclear localization signal;
ORF, open reading frame; PBL, peripheral blood leukocytes; PBMC, peripheral blood mononuclear cells; RPLPO, ribosomal protein large
protein; RTK, receptor tyrosine kinase; siRNA, short interfering RNA; UTR, untranslated region; VBARP, Vpr-binding ankyrin repeat protein.
FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4091
studies. blast searches of VBARP revealed that this
protein has homology to human ankyrin repeat and
KH domain containing 1(ANKHD1) variants, and to
an unknown protein named PP2500 [7,8]. Although
ANKHD1 variants have been identified by several
human genome sequencing groups, no known function
has been identified for these proteins.
ANKHD1 is a large protein containing multiple
ankyrin repeats and a single KH domain. It is derived
from an 8 kb transcript, with a predicted molecular
mass of > 280 kDa. The gene is present in human
chromosome 5q31.3 as a single copy. To differentiate

the variants of ANKHD1, NCBI has classified three
transcript variants that code for three unique isoforms
of ANKHD1. Our clone, VBARP, codes for two open
reading frames (ORF) of 1.9 and 1.35 kb, each with
an identical poly(A) tail. These two cDNAs were desig-
nated VBARP-L (1.9 kb) and VBARP-S (1.35 kb),
respectively. Both VBARP-L and VBARP-S variants
have high homology to PP2500 and ANKHD1 vari-
ant 2. In this study we focus on the biochemical and
functional characterization of the novel VBARP-L and
VBARP-S transcripts. Bioinformatics analyses show
that VBARP-L and VBARP-S are comprised of 11
and 9 exons, respectively. However, although these
two variants utilize many of the same exons, VBARP-S
lacks a portion of exon 4 and a 5¢ untranslated region
(UTR) that can be found in VBARP-L. Results from
functional analyses indicate that these transcripts are
ubiquitously expressed in human tissues and cell lines
at different levels. Specific loss of the VBARP tran-
scripts induced by short interfering RNA (siRNA)
caused apoptosis via caspase activation, indicating a
potentially important role for these proteins in cell sur-
vival. Taken together, these results suggest that HIV-1
Vpr interaction with VBARP might disrupt the cell
survival pathway thus leading to host cell apoptosis.
Results
Identification of VBARP as HIV-1 Vpr-interacting
protein
The HIV-1 Vpr-interacting protein, VBARP, was iden-
tified using the yeast two-hybrid system as previously

described [9]. A 915-bp fragment was initially identified
and further confirmed through both repetitions of the
yeast two-hybrid assay and using a mammalian hybrid
system (Invitrogen, Carlsbad, CA) (EDA Wheeler &
V Ayyavoo, unpublished data). A blast search
revealed that the IMAGE clone, localized in chromo-
some 5q31.3, was fully homologous to the 915-bp
fragment and revealed a possible full-length clone
containing multiple variants. These variants, one mea-
suring 1881 bp (designated VBARP-L) and a second
1305 bp clone (designated VBARP-S), were construc-
ted and used to further confirm the Vpr and VBARP
interaction using in vitro and in vivo interaction stud-
ies. Ten microliters of
35
S-labeled in vitro translated
VBARP and Vpr or Nef (as control) products were
mixed and immunoprecipitated with VBARP-, Vpr- or
Nef-specific antibody and analyzed by autoradiogra-
phy (Fig. 1A). Results indicate that both Vpr and
VBARP were able to form a complex and the complex
was pulled by VBARP and Vpr antibodies, respect-
ively, whereas VBARP and Nef did not form a com-
plex, indicating that the interaction between VBARP
and Vpr is specific. The input panel represents the
amount of protein used in this assay indicating that an
equal amount of protein was used in all our samples
and that the lack of interaction between VBARP and
Nef is not due to the lack of input proteins.
To further confirm that a physical interaction exists

between Vpr and VBARP in vivo, we tested this inter-
action in HEK293 T cells expressing Vpr and VBARP
by cotransfecting Vpr and VBARP-His using calcium
phosphate transfection. Forty-eight hours post trans-
fection, the cells were lysed and the whole cell proteins
were extracted. One hundred micrograms of total pro-
tein were used for immunoprecipitation (IP) using
anti-Vpr (Fig. 1B, lanes 1–3) or anti-His (lanes 1–3)
IgG. The bound proteins were eluted and subjected to
western blot analysis using anti-His and anti-Vpr IgG.
As shown in Fig. 1B, interaction of Vpr with VBARP
was detected by the IP followed by immunoblotting,
further confirming the specificity of this interaction.
Based on these results we were able to demonstrate the
formation of a complex between Vpr and VBARP.
Characterization of VBARP variants
The two VBARP clones differed only in the 5¢-end
where VBARP-L consisted of a 576-bp fragment
absent from the shorter VBARP-S and contained a
114-bp UTR (Fig. 2A). Intron and exon analysis of
VBARP revealed that VBARP-L and VBARP-S con-
tain 11 and 9 exons, respectively (Fig. 2B). Interest-
ingly, both clones shared the latter eight exons with
corresponding splice donor and acceptor sites found in
the genomic clone. VBARP-L contained an additional
three exons totaling 576 bp with a 114 bp 5¢-UTR,
whereas VBARP-S started with a portion of exon 4
(41 bp) with no known 5¢-UTR. The NCBI Geneview
website predicted exons from the targeted full genomic
sequence attributing to the discrepancies in numbers

(i.e. exon 1, 2, 4, 6 ) observed in Fig. 2B, suggesting
Molecular characterization of ANKHD1 splice variant M. C. Miles et al.
4092 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS
that alternate exons, designated as 3, 5, and 11, may
code for additional splice variants. Analysis with spi-
dey software, another tool for intron ⁄ exon determina-
tion, generated an identical exon map, confirming
the data presented in Fig. 2B that VBARP-L and
VBARP-S are coded by these specific exons.
VBARP-L and VBARP-S code for precursor pro-
teins of 627 and 435 amino acids and with calculated
peptide masses of 69 and 49 kDa, respectively. Addi-
tional domain mapping revealed that the predicted
structure of VBARP does not contain signal peptide(s)
or transmembrane domains. phd software, available
from the Predict Protein server, suggested that the
structure of VBARP-L is predominantly helical with
multiple loops (helix, 55%; coil, 3%; loop, 42%).
Sequence analysis using prosite motif scan and
netphos software, also predicted the presence of
several potential serine, threonine, and tyrosine
phosphorylation sites (cAMP, PKC, and CK2), and
the presence of nine potential myristoylation sites in
the VBARP protein (Fig. 2C). psort software predic-
ted with high accuracy the subcellular localization of
VBARP, and indicated that it is a cytoplasmic protein.
The Expert Protein Analysis System predicted that
this protein belongs to the family of ankyrin repeat
proteins (Fig. 2C). Comparative analysis of VBARP
ankyrin repeats with other known ankyrin repeat

proteins, using the consensus established by Kohl et al.
[10] and Mosavi et al. [11], which contains ankyrin
repeats from over 4000 proteins, indicated that the
ankyrin repeat domains in VBARP exhibit a high
homology to those present in the consensus within the
conserved, semiconserved and the nonconserved
regions of the ankyrin motifs (data not shown).
Sequence homology searches indicated that VBARP
shares strong homology across many phyla, including
A
B
Fig. 1. Interaction of Vpr and VBARP pro-
teins in vitro and in vivo.(A)In vitro transla-
ted
35
S-labeled VBARP-His isoforms were
incubated with Vpr or Nef and immunopre-
cipitated using a-His (lanes 1–3), a-Vpr
(lanes 4–6) or a-Nef (lanes 7–9) antibodies
and resolved on SDS ⁄ PAGE. Arrows indi-
cate the respective protein size. (Inset)
In vitro translated products of VBARP iso-
forms, Vpr and Nef used in coimmunopre-
cipitation assay. (B) Total cell lysates were
prepared from HEK293T cells transfected
with Vpr, VBARP-L, VBARP-S or control
vector plasmids. One hundred micrograms
protein equivalent of cell lysates was used
in IP followed by western blot utilizing anti-
Vpr and anti-His IgG (A, B). In parallel, 50 lg

of total cell lysates from the same samples
were detected by western blot assay to
detect the input protein (Input). Arrows
depict the position of the VBARP-L,
VBARP-S and Vpr.
M. C. Miles et al. Molecular characterization of ANKHD1 splice variant
FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4093
proteins from mouse, rat, Drosophila and Anopheles.
Multiple sequence alignment of these orthologous pro-
teins revealed the presence of a conserved region of
human VBARP-L protein that shared 84% similarity
with mouse, 69% similarity with rat, 46% similarity
with Drosophila melanogaster and 48% similarity with
Anopheles gambiae. Interestingly, all the compared spe-
cies contained the 12 ankyrin repeat domains and
exhibited high homology between them, suggesting a
conserved function for this protein.
Identification of VBARP splice variants in normal
human tissue
To precisely quantitate the amount of VBARP in dif-
ferent tissues and cell lines, real time RT-PCR was
performed. Total RNA was extracted from the brain,
spleen, lymph node, liver, cervix, muscle and kidney,
and real-time RT-PCR was carried out in triplicate
using ANKHD1 ⁄ VBARP isoform primer and probe
sets. Based on human genome sequencing, ABI has
identified and constructed several primer probe sets at
multiple intron–exon junctions to quantitate the vari-
ants. We used three sets of primers ⁄ probe to distinctly
identify the 8.0 kb ANKHD1, 1.9 kb VBARP-L

and MASK-BP3 (splice variant of ANKHD fused
with BP3). Using RNA derived from multiple tissues
we quantitated the various transcripts of VBARP
using real-time PCR (Fig. 3A). Human ribosomal
large protein (RPLPO), a housekeeping gene, was
used as an internal control and all ratios are pre-
sented relative to RPLPO. Results indicate that
A
B
C
Fig. 2. (A) Schematic representation of
VBARP-L and VBARP-S in comparison with
ANKHD1 variant. (B) Exon–intron analysis of
VBARP isoforms. Exons and introns present
in VBARP-L and VBARP-S are represented
as boxes with numbers. The length in base
pairs of each exon is marked on top of the
boxes representing the exons. Exon
numbers are derived from the genomic
sequence, after designating the first coding
exon number 1 and counting all other exons
located at this site. (C) Predicted post-trans-
lational modification and domain distribution
of VBARP-L translated amino acid
sequences. The grayshade regions in the
amino acid sequence of VBARP-L protein
represent the presence of ankyrin (ANK)
repeats, amino acids underlined indicate
predicted phosphorylation sites, and dark
shaded regions represent the predicted

N-myristylation sites.
Molecular characterization of ANKHD1 splice variant M. C. Miles et al.
4094 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS
ANKHD1 isoform 1 (codes for an 8.0 kb transcript)
exhibits a high ratio in cervix tissue followed by
spleen, brain and lung. Other tissues such as kidney,
lymph node, and muscle expressed relatively low levels
of ANKHD1 isoform 1. In the case of VBARP-L iso-
forms, spleen showed the highest level (3.89 ratio) fol-
lowed by lung, lymph node and kidney. Interestingly,
muscle and brain were almost negative, indicating that
there is a differential expression of these transcripts
within different human tissues. Interestingly, MASK-
BP3 exhibits a different profile confirming the pres-
ence of these variants at different levels in multiple
tissues.
Next, we tested several human primary and esta-
blished cell lines of different lineages for the presence
of the above three isoforms (Fig. 3B). Results indica-
ted that VBARP-L is present in most of the tested cell
lines with varying amounts with the highest expression
level in dendritic cells (ratio of 8), followed by PBMC
and PBL. It is interesting to note that among the dif-
ferent cell lines tested, primary lymphocytes (PBL,
PBMC) express higher level compared with the immor-
talized T-cell line CEMx174. However, we have been
unable to identify a cell line that is negative for
VBARP-L transcript.
Expression and biochemical characterization
of VBARP

The predicted sizes of the proteins encoded by
VBARP-L and VBARP-S are 69 and 49 kDa, respec-
tively. To test this, C-terminal V5-tagged VBARP-L
and VBARP-S constructs were translated in vitro,
immunoprecipitated with anti-V5 IgG, and the protein
products were resolved on an 8% SDS ⁄ PAGE gel
(Fig. 4A). The VBARP constructs expressed the pre-
dicted molecular mass protein, however VBARP-S
expressed an additional, equally intense band slightly
higher than the predicted 49 kDa band. The addi-
tional protein resolved at  55 kDa, suggesting that
VBARP-S might be modified post-translationally.
Next, the expression of the VBARP clones was tested
in vivo using HEK293T cells. HEK293T cells were
transfected with VBARP-L, VBARP-S or pcDNA3.1
vector plasmids using calcium phosphate. Forty-eight
hours post transfection, cells were lysed and subjected
to western blot analysis using anti-V5 IgG, and devel-
oped using the ECL kit (Amersham Biosciences,
Piscataway, NJ) (Fig. 4B). Results indicated that both
VBARP-L and VBARP-S expressed the predicted
molecular mass of protein similar to the in vitro
A
B
Fig. 3. (A) RNA expression of VBARP in various human tissues using real-time RT-PCR. Total RNA was extracted from different human tis-
sues and reverse transcribed. Real-time PCR was carried out in triplicate. The expression level of VBARP was normalized to the level of
RPLPO control for each sample. (B) mRNA expression of VBARP in various cell lines using real-time RT-PCR. Total RNA was extracted from
different human cell lines and reverse transcribed. Real-time PCR was carried out in triplicate. The expression level of VBARP was normal-
ized to that of RPLPO control for each sample. Each panel represents primers and probes that were used to specifically detect ANKHD1,
VBARP-L and MASK-BP3 by Applied Biosystems. All analyses were performed in triplicate.

M. C. Miles et al. Molecular characterization of ANKHD1 splice variant
FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4095
translated product. Furthermore, VBARP-S exhibited
protein products of 49 and 55 kDa, further confirming
the possibility of post-translational modifications
and ⁄ or splice variants.
Subcellular distribution of VBARP
To determine the subcellular localization of VBARP
isoforms, His-tagged VBARP plasmids were transfect-
ed into HeLa cells, and the distribution was assessed
by indirect immunofluorescence using anti-His IgG
(Fig. 5). Both VBARP-L and VBARP-S exhibited a
distinct cytoplasmic pattern upon expression. Similar
cytoplasmic distribution was observed in 293 and
A172 cells upon transfection with VBARP constructs
(data not shown). This result was in agreement with
the structure prediction analysis that indicated that
VBARP is a cytoplasmic protein. Together, the transi-
ently expressed VBARP exhibited a distinct cytoplas-
mic arrangement, supporting the lack of any predicted
nuclear localization signal (NLS) sequences or trans-
membrane domains in VBARP. Also, the use of
unsynchronized cells in these analyses further con-
firmed that the cytoplasmic distribution of VBARP is
independent of the cycling stage of the cells.
Identification of biological function(s) of VBARP
using a siRNA assay
To examine the role of endogenous VBARP in the
regulation of normal cellular events such as cell cycle
and apoptosis, RNA interference studies were per-

formed using VBARP siRNA and control siRNA. Sev-
eral VBARP siRNA duplexes were synthesized and
purified using the Qiagen siRNA Tool Kit. Based on
the initial results, siRNA spanning nucleotides 143–154
(from the ATG) was identified that blocked the
VBARP RNA synthesis in tested cell lines and this
siRNA was used in subsequent assays. Following
transfection of VBARP siRNA into HeLa and NT2
cells, physical observation revealed that cell death
occurred in a dose- and cell-dependent manner (data
not shown). To further quantitate this effect, NT2 cells
were transfected with different concentrations of
VBARP siRNA or control siRNA and assayed for
functional effects. First, to confirm that VBARP
A
B
Fig. 4. Expression of VBARP isoforms in vitro and in vivo:(A).
In vitro transcription ⁄ translation of VBARP-L and VBARP-S. One
microgram of VBARP-L, VBARP-S and vector plasmid was in vitro
transcribed ⁄ translated using
35
S-methionine as described in Experi-
mental procedures. In vitro translated products were immunopre-
cipitated with anti-V5 IgG, resolved in an 8% SDS ⁄ PAGE and
autoradiographed. (B) Expression of VBARP using transient trans-
fection system: HEK293T cells were transfected with 5 lgof
VBARP-L, VBARP-S and vector plasmids and immunoblotted with
anti-V5 IgG. Lanes are represented with the respective plasmid
used on the top and the markers are labeled on the left. Arrows
indicate specific gene products.

Fig. 5. Subcellular distribution of VBARP-L
and VBARP-S: HeLa cells were transiently
transfected with His-tagged VBARP-L and
VBARP-S. Post transfection cells were
stained with anti-His IgG and detected by
Alexaflour 594 (Red). Nuclei were stained
with Dapi (Blue). All images were captured
at 60· magnification using a Nikon micro-
scope.
Molecular characterization of ANKHD1 splice variant M. C. Miles et al.
4096 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS
expression is specifically blocked by treatment with
VBARP siRNA, siRNA transfections were performed
and total RNA was isolated from the cells, 36 h post
transfection, and used to amplify VBARP and b-actin
by RT-PCR (Fig. 6A). Results indicated that treat-
ment of VBARP siRNA inhibited the synthesis of
VBARP RNA in a dose dependent manner, whereas
the b-actin control was not altered, suggesting that
VBARP treatment is specific and does not alter the
global cellular transcription. Effect of VBARP siRNA
on cell viability was tested by the trypan blue exclusion
assay and cell viability assay. The cell viability results
of VBARP and control siRNA, compared with the
oligofectamine control (considered to be 100%), are
presented in Fig. 6B. Results indicated that NT2 cells
treated with 10 nm of VBARP siRNA exhibited 50%
cell death, whereas control siRNA at the same concen-
tration did not affect cell viability. However, at a con-
centration of 100 nm the percentage of cell viability in

VBARP and control siRNA-treated cells was 20 and
75, respectively. The number of viable cells in the
VBARP siRNA-treated group was reduced in a dose-
dependent manner. At the highest concentration
(200 nm), both control and VABRP siRNA complexes
became toxic to NT2 cells. Similar results were
observed in HeLa cells, also indicating that VBARP
might perform similar functions in cells of different
lineages.
Caspases involved in VBARP-mediated cell
survival
Caspases, a family of cysteine acid proteases, are cen-
tral regulators of apoptosis [12,13]. Caspases are rou-
tinely used as a measure of apoptosis, in contrast to
necrosis. Caspase 3 activation occurs at the intersec-
tion of all caspase-dependent pathways and is, there-
fore, an excellent marker of caspase-dependent
apoptotic death. We sought to identify whether
caspase 3 is activated during siRNA-mediated blocking
of VBARP gene expression. Cells treated with increas-
ing concentrations of VBARP or control siRNA were
assessed for caspase activity as described in Experi-
mental Procedures, and the results are presented in
Fig. 7. Results indicated that cells treated with
VBARP siRNA exhibit a higher amount of
caspase 3 ⁄ 7 activity when compared with the control
siRNA-treated cells in a dose-dependent manner. Also,
the effect of the siRNA was also measured against
time following transfection and the results indicated
that the effect of VBARP siRNA was also time

dependent (data not shown). Taken together, these
results suggest that VBARP isoforms may possess an
antiapoptotic effect and protect cells during normal
cell proliferation. Furthermore, the regulation of casp-
ases may be one of the pathway(s) by which VBARP
regulates cell survival. Further study is warranted to
B
A
Fig. 6. Functional analysis of VBARP using siRNA: (A) siRNA-specific knockdown of VBARP RNA. Cells (NT2) cells were transfected with
VBARP-specific siRNA or control siRNA. Thirty-six hours post transfection, total RNA was isolated from the cells and amplified with VBARP
or actin specific primers by RT-PCR. M, represents DNA marker, L, represents the lipofectamine control. Different concentrations of VBARP
and control siRNA used are indicated at the bottom of the respective lanes. (B) Effect of siRNA on cell viability. HeLa
1
and NT2
2
cells were
transfected with the various concentration of VBARP or control siRNA in triplicate. Forty-eight hours post transfection, cells were assayed
for cell viability. Percentage of viable cells in mock transfected (oligofectamine) was considered as 100%. Results represent an average of
three independent experiments.
M. C. Miles et al. Molecular characterization of ANKHD1 splice variant
FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4097
understand the pathway(s) and mechanism(s) involved
in VBARP and its regulation apoptosis.
Discussion
We identified and functionally characterized VBARP,
a novel splice variant of ANKHD1. Human
ANKHD1 gene is a large transcript containing 2 mul-
tiple ankyrin repeat motif domains and a single KH
domain similar to the MASK gene found in
Drosophila. Drosophila MASK (dMASK) has been

implicated in cell survival and may play a role in
promoting proliferation and preventing apoptosis [8].
dMASK mediates receptor tyrosine kinase (RTK) sign-
aling, independent of MAP kinase (MAPK) by either
functioning downstream of MAPK or by defining a
new pathway of RTK signaling [8]. RTKs play import-
ant roles in cell signaling during cell proliferation,
apoptosis, and cell survival upon stress [14–16].
Despite the fact that a homolog of dMASK is present
in the human genome, neither its function nor its
involvement in RTK signaling is established for
hMASK (ANKHDI). Poulin et al. [17] identified a
gene fusion between MASK and 4E-BP3 that occurs
rarely in the human genome. Although 4E-BP3 is a
member of the eukaryotic initiation factor family, the
role of this 4E-BP3–MASK fusion in transcription
regulation has yet to be defined.
VBARP, identified as an HIV-1 Vpr-interacting pro-
tein through yeast two-hybrid system analysis is a dis-
tinct splice variant of ANKHD1. blast search analysis
revealed that VBARP is located on chromosome
5q31.3, which has no known biological function(s).
Unlike hMASK, VBARP does not contain a KH
domain. RNA analysis and blast analysis indicated
that homologs and orthologs of VBARP exist, indica-
ting the presence of VBARP in diverse phyla such as
plants, yeast, and eukaryotes. These results suggest
that VBARP might be evolutionarily conserved, impli-
cating its involvement in basic cellular function(s).
Also, VBARP appears to be ubiquitously expressed in

multiple human tissues and primary and secondary cell
lines of various lineages. Taqman analysis further con-
firmed that VBARP is expressed at varying levels in
different tissue types such as spleen, cervix, heart,
brain, lung, liver, and skeletal muscle. Although
VBARP appears to be present in all the tested tissues,
the various expression levels and transcripts suggest
that differential or alternate splicing might be taking
place in these tissues. These findings were consistent
with a recent study by Poulin et al. [17], introducing a
novel 8.0 kb transcript called human MASK which
contains part of VBARP. Stringent real-time RT-PCR
analysis, using various cellular subsets, revealed expres-
sion of a range of ANKHD1 isoform 1 (human
MASK) among different cell types. This suggests a
specific role or requirement for VBARP in cells of
many different types. Because a large portion of
VBARP is present within ANKHD1 (hMASK), a simi-
lar conclusion can be drawn for VBARP using these
data. Therefore, owing to its ubiquitous expression, it
is possible that VBARP plays an important role in the
life cycle of various tissues in multiple organisms.
Functional analysis supports predictions that ubiqui-
tously expressed VBARP appears to play a role in cell
survival, because blocking the expression of VBARP
resulted in apoptosis. Human cells of different lineages
exposed to VBARP siRNA resulted in apoptosis in a
dose- and time-dependent manner when compared
with control siRNA-treated cells, confirming an
important role for VBARP in cell survival and antia-

poptotic pathway(s). However, our analysis focuses on
human cell types, and it was not extended to other
species. Based on the presence of VBARP in many
eukaryotes and the high level of homology, it is pos-
sible to propose that a similar phenomenon might
occur in cells of other species. In Drosophila, MASK is
shown to be critical for photoreceptor differentiation,
cell survival and proliferation [8]. Further studies are
in progress to address these pathways.
Several ankyrin repeat proteins are associated with
cell survival and are antiapoptotic. Interfering with the
normal expression of these proteins leads to cell death
and lethality during development [18]. These proteins
are also proposed to play important roles in neuronal
degeneration and apoptosis induced by chemical toxins
via degradation [19]. It is not clear whether VBARP
has a similar functional phenotype. Our results indi-
cate that expression of VBARP is essential for normal
cell function and knockout of VBARP expression leads
Fig. 7. VBARP siRNA induced caspase activity: NT2 cells (triplicate
wells) were transfected with VBARP or control siRNA. Thirty-six
hours post transfection cells were lyzed and assessed for
caspase 3 ⁄ 7 activity. Caspase activity was measured and represen-
ted in relative light units (RLU). Figure represents one of three inde-
pendent experiments.
Molecular characterization of ANKHD1 splice variant M. C. Miles et al.
4098 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS
to cell death in cells of different lineages. However, the
exact mechanism(s) by which this protein regulates cell
survival is not fully understood and requires further

study.
HIV-1 infection is characterized by the loss of
immune cells, specifically severe T-cell depletion. How-
ever, the direct cytopathic effects of virus infection on
infected cells alone cannot account for this severe loss
of T cells. Several viral and host cellular proteins are
known to play important roles in cell depletion in vivo
[20,21]. One of the HIV-1 virion-associated proteins,
Vpr, has been shown to dysregulate several host cellu-
lar functions including apoptosis in infected and unin-
fected bystander target cells through its interaction
with host cellular proteins [22–25]. However, it is not
clear at this point how interaction of Vpr and
VBARP leads to apoptosis but several scenarios exist.
One possibility is that redistribution or degradation of
VBARP in the presence of Vpr could abolish the
antiapoptotic function of VBARP or alter it from its
normal cell functions. Using these potential mecha-
nism(s), Vpr could exploit this pathway to induce apop-
tosis in the bystander-uninfected population, given the
fact that VBARP is abundantly present in many of
the tested human primary cells. Understanding the
functions and identifying the other regulatory proteins
involved in antiapoptotic functions regulated by
VBARP will shed new light on the function of this
novel protein as well as developing additional thera-
peutics for HIV-1.
Experimental procedures
Cell culture
Established cell lines HeLa, NT2, 293, HEK293T, and

CEMx174 were maintained in Dulbecco’s modified Eagle’s
medium (DMEM) containing 10% fetal bovine serum
(FBS) and 1% penicillin–streptomycin solution. Normal
human primary PBMC, PBL, macrophages and dendritic
cells were isolated from heparinized blood using the Ficoll-
Hypaque method. PBMC and PBL were blasted with
PHA-P (5 lgÆmL
)1
, Sigma, St Louis, MO) for 3 days and
cultured in RPMI containing 10% FBS, 1% penicillin–
streptomycin and interleukin-2 growth factor. Monocytes
were isolated using CD14 beads and differentiated
into macrophages and dendritic cells using GM-CSF
(500 UÆmL
)1
) ⁄ M-CSF (15 ngÆmL
)1
) and GM-CSF ⁄ IL-4,
respectively.
Yeast two-hybrid system
To identify Vpr-interacting host cellular protein(s), we used
a human cDNA library as described [9]. Briefly, full-length
Vpr was fused in-frame with a Gal4 DNA-binding domain
and used as bait in the yeast expression vector pGBT9. The
GAL-4 activation domain tagged brain cDNA library (gift
from Dr Srinivasan, Thomas Jefferson University, PA) was
used as prey. To eliminate the false-positive clones, cDNA
clones alone were transformed in yeast and screened on
high-stringency plates. Sequencing the remaining seven
clones identified a 915-bp fragment multiple times. Interac-

tion of this 915-bp fragment was further confirmed by yeast
two-hybrid system, as well as by using a Checkmate mam-
malian hybrid system as suggested by the manufacturer
(Promega, Madison, WI).
Construction of VBARP and Vpr expression
plasmids
Upon completion of the human genome project, the
VBARP cDNA construct was available through the Ameri-
can Tissue Type Collection (ATCC) as an IMAGE clone.
PCR primers were designed to amplify the original 915-bp
Vpr-interacting fragment, as well as the two VBARP iso-
forms, VBARP-L (1.9 kb) and VBARP-S (1.3 kb). The
PCR products (Table 1 for details on PCR primers) were
amplified and cloned into pcDNA3.1 CMV ⁄ T7 TOPO vec-
tor with a V5 ⁄ His epitope as per the manufacturer’s
instructions (Invitrogen) for use in further eukaryotic
expression studies. Positive clones were sequenced to verify
nucleotide integrity at the University of Pittsburgh Genom-
ics and Proteomics Core Laboratory. The resulting plas-
mids were designated as pVBARP-L and pVBARP-S. Vpr
expression clones were constructed as described previously
[9].
GenBank BLAST and computer analyses
The 915-bp fragment recognized as the Vpr-binding domain
was sequenced. The UCSC Genome Bioinformatics Blast
Table 1. Primers used to construct VBARP expression plasmids.
Isoform Size (kb) Primer sequence
VBARP-L 1.9 AACAATGCTGACTGATAGCGGAGGA (Forward)
TAAGCTACTACGTAAAGAATATATC (Reverse)
VBARP-S 1.3 GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward)

CATATATTCTTTACGTAGTAGCTTA (Reverse)
M. C. Miles et al. Molecular characterization of ANKHD1 splice variant
FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099
Like Alignment Tool ( />hgBlat) was used to find the location of this nucleotide
sequence in the human genome and also to identify the
intron ⁄ exon boundaries of its genomic sequence. spidey
software ( was also used to
generate the intron ⁄ exon maps. The nucleotide and deduced
amino acid sequences were subjected to homology searches
using the NCBI blast program (.
gov/BLAST) in order to identify homologous sequences
present in the sequence databases [26,27]. Invitrogen’s
alignx software was used for multiple sequence alignment
of VBARP homologous proteins. Databases of protein
families and domains including pfam (ger.
ac.uk/Software/Pfam/) prosite ( />prosite/) and NCBI’s Conserved Domain Database (CDD;
were
searched to identify the presence of conserved motifs and
domains [28,29]. Several sequence analysis programs avail-
able from the Expert Protein Analysis System (expasy;
proteomics server of the Swiss
Institute of Bioinformatics were used for in sillico character-
ization of VBARP, including prediction of its subcellular
localization (psort: ), prediction of
post-translational modification (netphos: .
dtu.dk/services/NetPhos), prediction of its topology and the
primary and secondary structure analysis (predictprotein:
/>RNA extraction and quantitative real-time
RT-PCR
Total RNA was extracted from human tissues and human

primary cells using Qiagen RNA purification kit (Qiagen,
Valencia, CA) and used in real-time PCR analysis for var-
ious VBARP isoforms. Two-step RT-PCR was performed
as follows: RNA (0.2–0.5 lg) was reverse transcribed using
Taqman reverse transcription reagents (Applied Biosystems,
Foster City, CA). Real-time PCR was carried out in tripli-
cate using an ABI Prism 7000 Detection System and ana-
lyzed using the included sequence detector software.
Commercially available primer ⁄ probe sets specific for the
ANKHD1 ⁄ VBARP isoforms and the ribosomal large pro-
tein (RPLPO) were used (Applied Biosystems, San Diego,
CA) to identify the different variants. The comparative C
T
method was used to determine the relative ratio of tran-
script between different samples as described [30]. RNA
levels were normalized to RPLPO.
Protein expression analysis
In vitro T7 transcription ⁄ translation
In vitro transcription ⁄ translation of VBARP plasmids was
accomplished using the TnTÒ Quick Coupled System as
per the manufacturer’s instructions (Promega). Briefly,
1–2 lg of VBARP-His were combined with 40 lLof
TnTÒ Master mix containing rabbit reticulocyte lysates,
2 lLof[
35
S]-methionine (MP Biomedicals, Irvine, CA)
and nuclease-free water to a total volume of 50 lL. The
reaction was incubated at 30 °C for 90 min and used in
subsequent experiments. For transient expression studies,
HEK293T cells (1 · 10

6
) were transfected with control vec-
tor, VBARP-L or VBARP-S expression constructs using
calcium phosphate as described previously [31]. Forty-eight
hours post transfection, cells were washed with cold
NaCl ⁄ P
i
and collected. Cell pellets were subsequently lysed
with RIPA buffer containing 50 mm Tris (pH 7.5), 150 mm
NaCl, 1% Triton X-100, 1 mm sodium orthovanadate,
10 mm sodium fluoride, 1 mm phenylmethylsulfonyl fluo-
ride 0.05% deoxycholate, 10% SDS, trypsin inhibitor
(0.07 unitÆmL
)1
) aprotinin, and protease inhibitors leupep-
tin, chymostatin, and pepstatin (1 lgÆmL
)1
; Sigma) as des-
cribed [14] for 15 min in ice. Cell lysates were centrifuged
at 22 000 g for 10 min at 4 °C to remove cell debris. Pro-
tein estimation of the cell lysates was carried out using
Bradford reagent (Bio-Rad Laboratories, Hercules, CA).
Total cell lysates (50 lg) were separated on an 8–12%
SDS ⁄ PAGE gel, transferred to poly(vinylidene difluoride)
membrane and immunoblotted with antialpha-Tubulin
(1 : 500) (NeoMarkers, Fremont, CA) and mouse mono-
clonal anti-His IgG (1 : 200) (Abcam, MA) followed by
horseradish peroxidase-conjugated goat anti-mouse IgG
(1 : 10000) and blots were developed using the ECL chemi-
luminescence detection kit (Amersham Biosciences).

Subcellular localization studies by indirect
immunofluorescence
HeLa cells (1 · 10
4
) were seeded in a four-well chamber
slide (Falcon, Franklin Lakes, NJ) and transfected with
VBARP-L and VBARP-S expression plasmid DNA using
Lipofectamine (Invitrogen) according to the manufacturer’s
instructions. Forty-eight hours post transfection, cells were
washed with 1· NaCl ⁄ P
i
, fixed in 2% paraformaldehyde at
room temperature for 10 min, then washed and permeabi-
lized with 0.05% Triton X-100 for 10 min. After washing
three times with 1· NaCl ⁄ P
i
, fixed cells were incubated at
room temperature for 90 min with anti-His IgG (1 : 200)
(Abcam), washed three times with 1· NaCl ⁄ P
i
, and then
incubated with goat anti-(mouse epitope) IgG Alexafluor
594 (1 : 400) (Molecular Probes, Eugene, OR) for 60 min
at room temperature. Following several washes with
1· NaCl ⁄ P
i
, cells were dried and mounted with VECTA-
SHIELD mounting media containing DAPI (Vector
Laboratories, Burlingame, CA). Immunofluorescence was
detected using a fluorescence microscope with Nikon SPOT

camera (Fryer, Huntley, IL) and images were processed
using metamorph software (Universal Imaging Corp.,
Downington, PA).
Molecular characterization of ANKHD1 splice variant M. C. Miles et al.
4100 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS
In vitro interaction studies
HIV-1 Vpr expression plasmids, VBARP plasmids and
pNef expression plasmid (as control protein) were in vitro
transcribed and translated using T7 TNT system as
suggested by the manufacturer (Promega) and coimmuno-
precipitated using specific antibodies. In the coimmunopre-
cipitation assay, equal amounts of
35
S-radiolabeled in vitro
translated VBARP isoforms were incubated with either Vpr
or Nef protein on ice for 90 min. The protein complex
was immunoprecipitated with anti-Vpr (gift from Dr John
Kappes, University of Alabama), anti-His (Invitrogen) or
anti-Nef (ARRRP, NIH) IgG and then subjected to
SDS ⁄ PAGE. All complexes were subjected to extensive
washings with stringent wash buffers. Eluted proteins were
subjected to SDS ⁄ PAGE in 8–12% gels and processed for
autoradiography.
In vivo interaction studies
HEK293T cells (1 · 10
6
) cotransfected with pVpr-Flag and
pVBARP-His ⁄ V5 were lysed in a nondenaturing, nonionic
lysis buffer containing 50 mm Tris (pH 7.5), 150 mm NaCl,
0.5% Triton X-100, 1 mm sodium othovanadate, 10 mm

sodium fluoride, 1 mm phenylmethylsulfonyl fluoride, tryp-
sin inhibitor (0.07 unitÆmL
)1
) aprotinin, with protease
inhibitor mixture (Sigma). The cellular fraction was isolated
by centrifugation (4 °C, 15 min, 14 000 g) and incubated
with magnetic anti-His TALONÒ beads (Dynal Biotech,
Oslo, Norway) by rotating for 30 min at 4 °C in nonreduc-
ing buffer. Immune complexes were washed four times in
wash buffer, before being eluted from beads using 5· SDS
sample buffer and analyzed on SDS ⁄ PAGE and immuno-
blotted for Vpr using anti-Vpr (1 : 250) or anti-Nef IgG
(NIH ARRRP) and detected by enhanced chemilumines-
cence kit.
Gene expression knockout assay using siRNA
Three targeted sequences of VBARP were selected that
met the following criteria: (a) nucleotide sequence was
unique and not homologous to another sequence within
the human genome; (b) targeted sequence achieved a
high compatibility value using QIAGEN siRNA design
software (siRNA tool kit program) available on their
website (); (c) sequence did not
contain a run of the same type of nucleotide; and (d)
positive and negative strands were not palindromes.
Primers that fit the above criteria were synthesized and
RNA sequences were generated using the siRNA synthe-
sis kit (Ambion, Austin, TX) according to the manufac-
turer’s protocol. Control siRNA (AATTCTCCGAAC
GTTGTCACGT) targeting a sequence specific to
Thermotoga maritimia was purchased from Qiagen and

used as nonspecific control.
RNA extraction and RT-PCR
RNA was extracted from different cell lines using a
QIAGEN RNeasymini RNA extraction kit (Qiagen). RNA
concentration was determined by spectrophotometry and
the integrity was assessed by 260 ⁄ 280 ratio and agarose gel
electrophoresis. Total RNA extracted from cultured cells
was reverse transcribed to cDNA and PCR amplified using
One Step RT-PCR Superscript II (Invitrogen) and primers
specific for VBARP and b-actin (housekeeping gene) mole-
cules. The following VBARP primers were designed:
forward 5¢-GATAAGGTACCTGCACTGACACGGATG
AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT
TTATATTTGCTCCTTGTGC-3¢. b-Actin primers were
designed as follows: forward 5¢-CTACAATGAGCTGCG
TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3 ¢.
Cell survival and apoptosis analysis
For viability testing, HeLa and NT2 cells were cultured in
12-well plates and transfected with oligofectamine reagent
(Invitrogen) with various concentrations of VBARP siRNA
or control siRNA in duplicates. Forty-eight hours post
transfection, cells were collected and counted using trypan
blue staining and ⁄ or cell viability assay kit (Promega).
Caspase (3 ⁄ 7) activity was measured according the manu-
facturer’s instructions using the Caspase-Glo3 ⁄ 7 assay kit
(Promega). Briefly, HeLa and NT2 cells were plated in
96-well plates and transfected with VBARP and control
siRNA. Cells were incubated for 24, 36 and 48 h time inter-
vals. Following post transfection cells were lysed in 100 lL
Caspase-Glo3 ⁄ 7 substrate (Promega) and incubated for

30 min in the dark at room temperature. Caspase 3 ⁄ 7
activity was measured as relative light units (RLU) by a
Veritas
TM
microplate luminometer (Turner Biosystems,
Sunnyvale, CA).
Acknowledgements
We thank Dr Martinson for critical reading of the
manuscript. This work was supported in part by the
United States Army to MCM for career advancement.
References
1 Mosavi LK, Cammett TJ, Desrosiers DC & Peng ZY
(2004) The ankyrin repeat as molecular architecture for
protein recognition. Protein Sci 13, 1435–1448.
2 Lubman OY, Korolev SV & Kopan R (2004) Anchor-
ing notch genetics and biochemistry; structural analysis
of the ankyrin domain sheds light on existing data. Mol
Cell 13, 619–626.
3 Hryniewicz-Jankowska A, Czogalla A, Bok E &
Sikorsk AF (2002) Ankyrins, multifunctional proteins
M. C. Miles et al. Molecular characterization of ANKHD1 splice variant
FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4101
involved in many cellular pathways. Folia Histochem
Cytobiol 40, 239–249.
4 Bork P (1993) Hundreds of ankyrin-like repeats in func-
tionally diverse proteins: mobile modules that cross
phyla horizontally? Proteins 17, 363–374.
5 Peifer M, Berg S & Reynolds AB (1994) A repeating
amino acid motif shared by proteins with diverse cellu-
lar roles. Cell 76, 789–791.

6 Binz HK, Amstutz P, Kohl A, Stumpp MT, Briand C,
Forrer P, Grutter MG & Pluckthun A (2004) High-affi-
nity binders selected from designed ankyrin repeat pro-
tein libraries. Nat Biotechnol 22, 575–582.
7 Qin WX, Zhou XM, Zhang PP, Jiang HQ, Hunang Y,
Wan DF & Gu JR (2000) Direct Submission to National
Laboratory for Oncogenes and Related Genes. Shanghai
Cancer Institute, Shanghai, China.
8 Smith RK, Carroll PM, Allard JD & Simon MA (2000)
MASK, a large ankyrin repeat and KH domain-con-
taining protein involved in Drosophila receptor tyrosine
kinase signaling. Development 129, 71–82.
9 Mahalingam S, Ayyavoo V, Patel M, Kieber-Emmons
T, Kao GD, Muschel RJ & Weiner DB (1998) HIV-1
Vpr interacts with a human 34-kDa mov34 homologue,
a cellular factor linked to the G2 ⁄ M phase transition of
the mammalian cell cycle. Proc Natl Acad Sci USA 95,
3419–3424.
10 Kohl A, Binz HK, Forrer P, Stumpp MT, Pluckthun A
& Grutter MG (2003) Designed to be stable: crystal
structure of a consensus ankyrin repeat protein. Proc
Natl Acad Sci USA 100, 1700–1705.
11 Mosavi LK, Minor DL Jr & Peng ZY (2002) Consen-
sus-derived structural determinants of the ankyrin
repeat motif. Proc Natl Acad Sci USA 99, 16029–16034.
12 Riedl SJ & Shi Y (2004) Molecular mechanisms of cas-
pase regulation during apoptosis. Nat Rev Mol Cell Biol
5, 897–907.
13 Shi Y (2004) Caspase activation: revisiting the induced
proximity model. Cell 117, 855–858.

14 Schlessinger J (2000) Cell signaling by receptor tyrosine
kinases. Cell 103, 211–225.
15 Noonberg SB & Benz CC (2000) Tyrosine kinase
inhibitors targeted to the epidermal growth factor
receptor subfamily: role as anticancer agents. Drugs 59,
753–767.
16 Saltiel AR (1994) The paradoxical regulation of protein
phosphorylation in insulin action. FASEB J 8, 1034–
1040.
17 Poulin F, Brueschke A & Sonenberg N (2003) Gene
fusion and overlapping reading frames in the mamma-
lian genes for 4E-BP3 and MASK. J Biol Chem 278,
52290–52297.
18 Hamada Y, Kadokawa Y, Okabe M, Ikawa M,
Coleman JR & Tsujimoto Y (1999) Mutation in ankyrin
repeats of the mouse Notch2 gene induces early embryo-
nic lethality. Development 126, 3415–3424.
19 Sakaue M, Takanaga H, Adachi T, Hara S &
Kunimoto M (2003) Selective disappearance of an
axonal protein, 440-kDa ankyrin
B
, associated with
neuronal degeneration induced by methylmercury.
J Neurosci Res 73, 831–839.
20 Gougeon ML (2005) To kill or be killed: how HIV
exhausts the immune system. Cell Death Differ 12,
845–854.
21 Alimonti JB, Ball TB & Fowke KR (2003) Mechanisms
of CD4+ T lymphocyte cell death in human immuno-
deficiency virus infection and AIDS. J Gen Virol 84,

1649–1461.
22 Muthumani K, Choo AY, Premkumar A, Hwang DS,
Thieu KP, Desai BM & Weiner DB (2005) Human
immunodeficiency virus type 1 (HIV-1) Vpr-regulated
cell death: insights into mechanism. Cell Death Differ
12, 962–970.
23 Andersen JL, Zimmerman ES, DeHart JL, Murala S,
Ardon O, Blackett J, Chen J & Planelles V (2005) ATR
and GADD45alpha mediate HIV-1 Vpr-induced apop-
tosis. Cell Death Differ 12, 326–334.
24 Roumier T, Vieira HL, Castedo M, Ferri KF, Boya P,
Andreau K, Druillennec S, Joza N, Penninger JM,
Roques B et al. (2002) The C-terminal moiety of HIV-1
Vpr induces cell death via a caspase-independent
mitochondrial pathway. Cell Death Differ 9, 1212–
1219.
25 Gaynor EM & Chen IS (2001) Analysis of apoptosis
induced by HIV-1 Vpr and examination of the pos-
sible role of the hHR23A protein. Exp Cell Res 267,
243–257.
26 Madden TL, Tatusov RL & Zhang J (1996) Applica-
tions of network BLAST server. Methods Enzymol 266,
131–141.
27 Pearson WR & Lipman DJ (1988) Improved tools for
biological sequence comparison. Proc Natl Acad Sci
USA 85, 2444–2448.
28 Hulo N, Sigrist CJA, Le Saux V, Langendijk-Genevaux
PS, Bordoli L, Gattiker A, De Castro E, Bucher P &
Bairoch A (2004) Recent improvements to the
PROSITE database. Nucleic Acids Res 32, D134–D137.

29 Blom N, Gammeltoft S & Brunak S (1999) Sequence-
and structure-based prediction of eukaryotic protein
phosphorylation sites. J Mol Biol 294, 1351–1362.
30 Janket ML, Manickam P, Majumder B, Thotala D,
Wagner M, Schafer EA, Collman RG, Srinivasan A &
Ayyavoo V (2004) Differential regulation of host cellu-
lar genes by HIV-1 viral protein R (Vpr): cDNA micro-
array analysis using isogenic virus. Biochem Biophys Res
Commun 314, 1126–1132.
31 Miura-Shimura Y, Duan L, Rao NL, Reddi AL,
Shimura H, Rottapel R, Druker BJ, Tsygankov A,
Band V & Band H (2003) Cbl-mediated ubiquitinylation
and negative regulation of Vav. J Biol Chem 278,
38495–38504.
Molecular characterization of ANKHD1 splice variant M. C. Miles et al.
4102 FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS