Báo cáo khoa học: Sequences downstream of the transcription initiation site are important for proper initiation and regulation of mouse ribonucleotide reductase R2 gene transcription ppt

Sequences downstream of the transcription initiation site are
important for proper initiation and regulation of mouse ribonucleotide
reductase R2 gene transcription
Irina Kotova, Anna L. Chabes*, Sergei Lobov, Lars Thelander and Stefan Bjo¨ rklund
Department of Medical Biochemistry and Biophysics, Umea
˚
University, Sweden
Ribonucleotide reductase is essential for the synthesis of all
four dNTPs required for DNA replication. The enzyme is
composed of two proteins, R1 and R2, which are both
needed for activity. Expression of the R1 and R2 mRNAs is
restricted to the S-phase of the cell cycle, but the R1 and R2
promoters show no obvious sequence homologies that could
indicate coordination of transcription. Here we study initi-
ation of transcription at the natural mouse R2 promoter,
which contains an atypical TATA-box with the sequence
TTTAAA, using a combination of in vivo reporter gene
assays and in vitro transcription. Our results indicate that in
constructs where sequences from the R2 5¢-UTR are present,
the mouse R2 TATA-box is dispensable both for unregu-
lated, basal transcription from the R2 promoter and for
S-phase specific activity. Instead, initiation of R2 transcrip-
tion is directed by sequences downstream from the tran-
scription start. We report that this region contains a
conserved palindrome sequence that interacts with TAF
II
s.
This interaction down-regulates basal transcription from the
R2 promoter, both in the absence and in the presence of the
TATA-box.
Keywords: in vitro transcription; ribonucleotide reductase;

TAFs; TATA-box; transcription regulation.
Efficient transcription initiation at a eukaryotic protein-
encoding gene requires assembly on promoter DNA of a
protein complex containing RNA polymerase II and five
general transcription factors (GTFs) IIB, IID, IIE, IIF, and
IIH (reviewed in [1–3]). TFIID refers to a multiprotein
complex composed of the TATA-binding protein (TBP)
and a set of proteins called TBP-associated factors (TAFs).
Transcription of most eukaryotic genes is initiated around
20–30 base pairs downstream from a conserved sequence
called the TATA-box, which binds TBP as a first step in a
sequence of events leading to formation of a functional
preinitiation complex [4]. The TATA-box sequence is
conserved through evolution [consensus sequence:
TATA(A/T)A(A/T)] but it is known that TBP can interact
with sequences that differ considerably from this consensus
sequence. However, at most natural promoters, TBP is not
solely responsible for promoter recognition. Rather, a more
extended sequence around the TATA-box interacts with
both TAFs and other GTFs, such as TFIIB. Mapping of
interactions between the human TFIID subunits and the
adenovirus major late promoter using a photocrosslinking
method showed that TFIID interacts with promoter
sequences both upstream and downstream of the TATA-
box, but also that TFIID–DNA interactions are formed
downstream from the position for transcription initiation
[5]. In contrast to the TATA-box, these upstream and
downstream sequences show no obvious homology when
different promoters are compared.
Regulation of transcription is normally explained by

signaling from regulatory proteins binding to specific
promoters DNA sequences located upstream from the
TATA-box. These signals are then transferred to the
general transcription machinery via coactivators or core-
pressors such as the Mediator complex [6,7]. However,
considering that the sequences surrounding the TATA-
box, which interact with components of the general
transcription machinery, show little or no homology
between different promoters, it is likely that transcription
is also regulated at this level. This type of regulation would
then both be dependent on the strength of interactions
between different promoter DNA and the GTFs depend-
ing on the sequence surrounding the TATA-box, but also
by formation of preinitiation complexes that contain
different general transcription factors. For example, it is
known that TAF-complexes exist in multiple forms, some
even lacking TBP [8,9]. It is therefore not surprising that
expression from specific promoters is regulated by recruit-
ment of different TAF-complexes for example in different
tissues, at different developmental stages or at different
phases of the cell cycle [reviewed in 10]. Furthermore, the
fact that TBP is also required for transcription of genes
that lack a TATA-box, shows that the requirement of TBP
for initiation is uncoupled from the requirement of a
consensus TATA-box.
Correspondence to S. Bjo
¨
rklund, Department of Medical Biochemistry
and Biophysics, Umea
˚

University,SE-90187Umea
˚
,Sweden.
Fax: +46 907869795, Tel.: + 46 907866788,
E-mail:
Abbreviations:5¢-UTR, 5¢-untranslated region; GTFs, general trans-
cription factors; TBP, TATA-binding protein; TAFs, TBP associated
factors; DPE, downstream promoter element; Py, pyrimidine;
Im, imidazole.
*Present address: Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York 11724, USA.
(Received 23 December 2002, revised 21 February 2003,
accepted 26 February 2003)
Eur. J. Biochem. 270, 1791–1801 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03541.x
Ribonucleotide reductase catalyzes the formation of
deoxyribonucleotides from the corresponding ribonucleo-
tides, which is the rate-limiting step in the production of
precursors forDNA synthesis[11]. The mouseribonucleotide
reductase is composed of two subunits, proteins R1 and R2.
Both subunitsare required for enzymeactivity and itcould be
reasonable to assume that the expression of the R1 and R2
mRNAs should be coordinated at the transcription level.
Accordingly, both the R1 and R2 mRNAs show an S-phase
specific expression with low or undetectable levels in G1 cells,
and a synchronized increase as cells enter the S-phase of the
cell cycle [12]. However, analysis of the mouse R1 and R2
promoter sequences show that they differ, not only from each
other, but also from the common promoter structure found
in the majority of eukaryotic genes. The mouse R1 promoter
lacks TATA-box and instead contains an initiator sequence

that has been shown to interact with the transcription factor
TFII-I [13], and a downstream sequence called c that shows
no homology to previously identified downstream promoter
elements [14]. The protein(s) that interacts with the c se-
quence is so far unidentified. In contrast, the mouse R2
promoter contains no initiator element-sequence or c ele-
ment, but instead has an atypical TATA-box with the
sequence TTTAAA, located approximately 30 base pairs
upstream from the mapped major transcription start sites in
the R2 promoter [15]. The transcriptional efficiency for this
variant of the TATA-box has been studied in the adenovirus
major late promoter context [16]. Compared to the consensus
TATA-box sequence, the R2-type sequence resulted in a
75% reduction in transcriptional efficiency. However, no
analysis of how these mutations affected the transcription
start position was presented.
Here we examine the mouse ribonucleotide reductase R2
TATA-box and sequences downstream of it for their
function in transcription from the R2 promoter. Our data
indicate that the R2 TATA-box is dispensable for basal and
S-phase-specific expression from the R2 promoter, but that
it is important for the position of transcription initiation.
However, the R2 TATA-box is required for maximal
promoter strength in the presence of sequences downstream
from the R2 transcription start and the availability of
proteins binding to these sequences.
Experimental procedures
Plasmids
The internal control plasmid pML311 contains a shorter
(311 bp) G-less cassette fused with the adenovirus major late

promoter. It was created from pML(CAT)19 [17] by PCR
using one primer complementary to the polylinker upstream
from the AdML promoter and a second primer comple-
mentary to nucleotide 311–292 bp downstream from the
start of the G-less sequence, followed by cleavage of the
PCR product with EcoRIandBamHI and ligation into
pML(CAT)19 digested with the same enzymes. The
R2-luciferase reporter construct (pAC 10, here also called
TATA
Wt
UTR
Wt
) and the R2 promoter construct with
mutation in the CCAAT box have been described previously
[18]. The R2 TATA
mut
UTR
Wt
-luciferase reporter construct
is analogous to the pAC10/TATA
Wt
UTR
Wt
except that the
TATA-box (TTTAAA) at the position )29 bp relative to
the mouse R2 transcription start site was substituted by the
sequence GCGCGC by overlap extension PCR.
The TATA
Wt
UTR

mut
and the TATA
mut
UTR
mut
constructs fused to the G-cassette were made by overlap
extension PCR using pML(CAT)19 and the pAC10/
TATA
Wt
UTR
Wt
or the TATA
mut
UTR
Wt
-luciferase repor-
ter constructs as templates. Creation of a TATA
Wt
UTR
Wt
-
G-less cassette construct with exactly the same 5¢-UTR
sequence as the analogous luciferase construct failed prob-
ably because primers specific for the mouse R2 5¢-UTR
sequence must include a 10-bp perfect palindrome which
might cause secondary primer structures. Instead we used
primers further downstream from the R2 transcription start
site, nucleotides +43 to +22 relative to the major transcrip-
tion start site and introduced an NcoI site between the end of
the R2 5¢-UTR and the G-less cassette. The TATA

mut
UTR
Wt
-G-less cassette construct was created from the
TATA
mut
UTR
Wt
-luciferase construct in the same way as
the TATA
Wt
UTR
Wt
-G-less cassette construct. Therefore,
these constructs contain a longer sequence from the R2 5¢-
UTR compared to the corresponding luciferase constructs
(42 instead of 17 nucleotides). The TATA
Wt
UTR
mut
-and
the TATA
mut
UTR
mut
-luciferase reporter constructs were
made from the corresponding G-less cassette constructs. As
these constructs, in contrast to the corresponding G-less
constructs need to be efficiently translated, we decided to
replace the R2 5¢-UTR with a nonrelated 5¢-UTR instead of

deleting it. Therefore, these constructs were made by
amplification of the R2 promoter from corresponding G-less
cassettes constructs using a downstream primer that included
23 nucleotides from the luciferase 5¢-UTR.
Synthesis of the mouse R2-specific polyamide
The R2 TATA-specific Py-Im polyamide (Fig. 1A) was
synthesized by solid-phase methods as described [19]. The
purity and identity of the polyamide was verified by
analytical high-pressure liquid chromatography,
1
H nuclear
magnetic resonance, and matrix-assisted laser desorption
ionization-time of flight mass spectrometry. The polyamide
was dissolved in distilled water and the concentration of the
stock solution was calculated using an extinction coefficient
of e ¼ 78 000
M
)1
Æcm
)1
at 310 nm. The binding affinity of
the polyamide to the R2 promoter was determined to
K
d
¼ 1 nm by quantitative DNase footprinting under
equilibrium conditions [20].
Treatment of stably transformed cells with polyamide
Balb/3T3 cells (5 · 10
5
per 10 cm dish) stably transformed

with the pAC10 full-length R2 promoter-luciferase reporter
gene construct [21] were grown overnight in 10 mL
Dulbecco’s modified Eagle’s medium (DMEM) + 10%
heat-inactivated horse serum. After 24 h, 5 and 50 l
M
R2
polyamide (in DMEM) was added to the plates. After 6 h,
cells were harvested and assayed for luciferase activity as
described [21].
Gel shift experiments
Nuclear extracts used in gel shift experiments with TBP
were prepared from logarithmically growing Balb/3T3 cells
1792 I. Kotova et al.(Eur. J. Biochem. 270) Ó FEBS 2003
[22]. Gel shift experiments were made using the oligonu-
cleotides 5¢-GCGGTTGGGTGGCTCTTTAAAGGGCG
CG-3¢ and 5¢-CGCGCCCTTTAAAGAGCCACCCAA
CCGC-3¢. In oligonucleotides with mutated TATA-box
the sequence TTTAAA (shown in bold) is substituted by
GCGCGC. Single-stranded oligonucleotides were end-
labeled using T4 polynucleotide kinase and [c-
32
P]ATP
(specific activity 3000 CiÆpmol
)1
, Amersham Biosciences)
as previously described [23], annealed by heating to 65 °C
followed by cooling down slowly to the room temperature
and purified by gel filtration on Sephadex G-50 (Amer-
sham Biosciences).
A typical binding reaction contained 5 fmol labeled

oligonucleotide and 10 ng (26 fmol) recombinant human
TBP (Promega) in 10 lL of binding buffer [10% glycerol,
20 m
M
Tris/HCl (pH 8.0), 80 m
M
KCl, 10 m
M
MgCl,
2m
M
dithiothreitol]. After 15 min incubation at room
temperature, 5 lL loading buffer [40% glycerol, 250 m
M
Tris/HCl (pH 8.0)] was added to the reactions and DNA-
protein complexes were resolved by electrophoresis through
6% polyacrylamide gels in electrophoresis buffer
(0.5 · Tris/borate/EDTA, 4 m
M
MgCl
2
, 0.02% NP-40).
The gels were run at +4 °C, dried and subjected to
autoradiography.
Nuclear extracts used in gel shift experiments with the
palindrome sequence in the R2 5¢-UTR were prepared from
Ehrlich–Lettre ascites mouse carcinoma cells (ATCC No
CCL77) as previously described [24] The gel shift experi-
ments were performed essentially as described in [25] using
the oligonucleotides: wild-type: 5¢-CAGTCGG

CGGTGC
ACCGGATTCCAGCTGTTT-3¢;mutation1:5¢-CAGT
CGG
CTGTCAACCGGATTCCAGCTGTTT-3¢;muta-
tion 2: 5¢-CAGTCGG
CGGTGCACCGTAATCCAGCT
GTTT -3¢;mutation3:5¢-CAGTCGG
CGGTGCACCG
GATTCCGAGTGTTT-3¢. Nucleotides in bold represent
mutated nucleotides and the palindrome sequence is
underlined. After labeling and annealing, the probes were
Fig. 1. A polyamide specific for the mouse R2 TATA-box interferes with
TBP-binding to the R2 promoter in vitro but has no effect in vivo. (A)
Structure of the Im-b-ImPyPy-c-ImImPyPyPy-b-Dp R2 TATA-spe-
cific polyamide and the sequence in the mouse R2 promoter to which it
binds. Im-Py targets GÆC base pairs and Py-Im targets CÆGbasepairs
and the Py-b-alanine pair recognizes both AÆTandTÆA base pairs [38].
The boxed sequence represents the atypical R2 TATA-box. Black and
white circles, Im and Py rings, respectively; curved line, hairpin junc-
tion, which is formed with c-aminobutyric acid; diamonds, b-alanine;
parenthesis with plus sign, 3-(dimethylamino)propylamine. (B) Gel
shift experiments with a
32
P-labeled oligonucleotide representing the
R2 TATA-box. Lane 1, only labeled oligonucleotide; lane 2, labeled
oligonucleotide incubated with 10 ng (26 fmol) recombinant human
TBP; lanes 3–6, as in lane 2 but with decreasing amounts (0.15 pmol,
0.075 pmol, 0.03 pmol, 0.0075 pmol respectively) of unlabeled R2
TATA-box oligonucleotide added to the binding reactions. Lanes 7
and 8, as lanes 1 and 2, respectively; lanes 9–11, as lane 8 but with

increasing amounts of polyamide (540 fmol, 3.38 pmol, 33.8 pmol,
which is a 20-, 130-, and 1300-fold excess compared to TBP, respect-
ively) added to the binding reactions. Arrows to the right indicate the
position for free probe (lower) and the TBP-probe complex (upper).
Numbers below the figure represent quantifications of the TBP-probe
complexesineachlane.ThequantificationsweremadeusingtheScion
Image software. (C) Addition of the R2-polyamide to Balb/3T3 cells,
which are stably transfected with a reporter gene construct where the
wild-type R2 promoter controls the luciferase gene (TATA
Wt
UTR
Wt
-
luciferase).
Ó FEBS 2003 Role of RNR2 5¢-UTR in transcription initiation (Eur. J. Biochem. 270) 1793
purified by electrophoresis in 5% polyacrylamide gel under
nondenaturing conditions. In competition assays, the
annealed unlabeled oligonucleotides were mixed with labe-
led probe prior to the addition of nuclear extracts. In
experiments with antibodies, antibodies were preincubated
with nuclear extracts for 15 min on ice in the binding buffer
before adding the labeled probe.
Transfection of cells, serum starvation and luciferase
assays
Transient transfection, isolation of stably transformed cells,
synchronization of Balb/3T3 cells by serum starvation and
luciferase assays were done as described previously [18]. The
relative luciferase value was determined as firefly luciferase
activity normalized against Renilla luciferase activity mul-
tiplied by 1000.

Preparation of nuclear extracts and
in vitro
transcription assays
Nuclear extracts were prepared from logarithmically grow-
ing Ehrlich–Lettre ascites cells as previously described [24].
In vitro transcription assays with purified transcription
factors were performed as described in [18]. In vitro
transcription assays with crude nuclear extracts were made
in a similar way but with the following modifications. Each
transcription reaction contained a total amount 35–45 lgof
nuclear extract. For experiments using templates containing
the mutated 5¢-UTR upstream from the G-less cassette, the
2 · transcription mixture contained 1.6 m
M
GTP in addi-
tion to the other three nucleotides. Stop mixture contained
10 m
M
Tris/HCl (pH 7.5), 0.3
M
NaCl, 5 m
M
EDTA,
0.1 mgÆmL
)1
glycogen (Boerhinger Mannheim) and
130 UÆmL
)1
T1 ribonuclease. After incubation for 30 min
at 25 °C the reaction was stopped by addition of 200 lL

stop mixture and incubated for 30 min at 37 °Cpriorto
proteinase K treatment. When an internal control was
included in the reactions, each reaction contained 60 fmol of
the DNA template to be studied, and 60 fmol of pML 311.
In the experiments with TAF
II
135 antibodies, the antibodies
were added to the reaction mixtures at different concentra-
tions and the reactions were incubated on ice for 15 min
prior to addition of the 2· transcription mixture.
Primer extension
Primer extension reactions were carried out essentially as
described in [26]. Avian myeloblastosis virus reverse tran-
scriptase, T4 polynucleotide kinase and /X174 DNA/HinfI
dephosphorylated marker were purchased from Promega.
RNAs to be used as template for the primer extension
reactions were synthesized by in vitro transcription reactions
using nuclear extracts and the different R2 promoter-
luciferase constructs. The oligonucleotide used for primer
extension was complementary to the nucleotides 65–90 in
the coding strand of the luciferase cDNA (5¢-CTCTTCATA
GCCTTATGCAGTTGCTCTCCAG-3¢). The labeled
oligonucleotide (0.1 pmol, specific activity  2 · 10
6
cpmÆpmol
)1
) was added to the in vitro transcribed RNA,
the volume was adjusted to 20 lLwithwaterandthe
oligonucleotide was annealed to the RNA by heating to
65 °C followed by slow cooling to room temperature. After

the primer extension reaction, the products where denatured
for 5 min at 95 °C the reaction products were resolved by
electrophoresis on 7
M
urea, 10% polyacrylamide gels and
subjected to autoradiography.
Results
TBP binding to the mouse R2 promoter TATA-box
is not required for transcription from the R2 promoter
in vivo
In order to study initiation of transcription from the R2
promoter, we obtained a polyamide specific for a sequence
at the 5¢-end of, and immediately upstream from, the
atypical mouse R2 TATA-box (TTTAAA; Fig. 1A).
DNase1 footprinting analysis showed that the synthesized
polyamide bound specifically to this sequence with a K
d
of
1n
M
. Gel shift experiments using an end-labeled oligo-
nucleotide corresponding to the region around the R2
TATA-box (Experimental procedures), recombinant
human TBP and the polyamide showed that human TBP
binds specifically to the mouse R2 TATA-box and that the
polyamide interferes with this binding (Fig. 1B). To study if
the polyamide also inhibits transcription from the R2
promoter in vivo, polyamide was added to Balb/3T3 cells
stably transfected with a reporter gene construct where the
luciferase gene is under the control of the full-length mouse

R2 promoter [21]. To our surprise we found that the
polyamide had no effect on R2-promoter-luciferase expres-
sion even when cells are incubated with high concentrations
(50 l
M
) of polyamide (Fig. 1C).
Importance of the R2 TATA-box and TBP binding
to the R2 promoter
We next studied the importance of TBP and the R2
TATA-box in an in vitro transcription system reconstituted
from recombinant mouse TBP, TFIIB, TFIIE, TFIIF and
highly purified mouse TFIIH and RNA polymerase II [18].
As templates for these experiments we used constructs
where a G-less cassette is ligated directly downstream from
the nucleotide that has been mapped as the major
transcription initiation site in the mouse R2 gene. The only
difference between the two templates is that they either
contain the natural R2 TATA-box or a mutation of it to
GCGCGC (Fig. 3D; G-less templates TATA
Wt
UTR
mut
and TATA
mut
UTR
mut
). We found that both TBP (Fig. 2A,
compare lanes 4 and 5) and the R2 TATA-box (Fig. 2A,
compare lanes 2 and 3) were absolutely required for
transcription from the R2 promoter in this system. As a

positive control for these experiments, we included a
reaction using a template where the G-less cassette is
controlled by the adenovirus major late (AdML) promoter
(lane 1). We found that the activity of the natural R2
promoter is 64% of the AdML promoter strength in this
basal, unregulated in vitro transcription system (Fig. 2A,
compare lanes 1 and 2).
In contrast to the results obtained in vitro, analysis of the
importance of the R2 TATA-box in vivo using the
R2-luciferase reporter genes showed that a mutation of
the R2 TATA-box only resulted in a limited decrease of the
1794 I. Kotova et al.(Eur. J. Biochem. 270) Ó FEBS 2003
R2 promoter strength (Fig. 2B). Finally, we also performed
transient transfection experiments in synchronized
Balb/3T3 cells using full-length R2 promoter-luciferase
constructs with wild-type or mutated TATA-box (Fig. 2C;
TATA
Wt
UTR
Wt
and TATA
mut
UTR
Wt
). These results
showed that a mutation of the R2 TATA-box does not
effect the S-phase specific expression from the mouse R2
promoter.
The discrepancy between the in vitro results described in
Fig. 2A, which show that the R2 promoter is dependent

both of TBP and its TATA-box, and the in vivo results
presented in Figs 1C and 2B, which indicate that the R2
TATA-box has a very limited effect on transcription from
the R2 promoter, could possibly be explained by the lack of
an essential transcription factor in the reconstituted in vitro
transcription system. In order to study transcription from
themouseR2promoterin vitro in a more complex context,
we therefore used an in vitro transcription system based on a
crude nuclear extract. In line with the results obtained using
the defined in vitro transcription system reconstituted from
pure general transcription factors, also this crude system
showed that the mouse R2 promoter is highly dependent on
its TATA-box for full transcription (Fig. 3A, compare
lanes 1 and 2). As indicated, transcription from the TATA-
mutated R2-promoter construct is fourfold lower compared
to the natural R2 promoter.
Sequences downstream of the R2 transcription
initiation site are important for proper initiation
of mouse R2 transcription
Our results so far indicate a difference in the requirement of
the R2 TATA-box when comparing results obtained in vitro
and results obtained in vivo. This could still reflect a
difference between the two systems, either because the
in vitro systems lack an essential transcription factor or
because of interactions between the template and chromatin
components in the in vivo system. However, also the
templates used for the in vitro transcription and in vivo
luciferase experiments differed from each other. Our wild-
type R2-luciferase template (TATA
Wt

UTR
Wt
-luciferase)
contains a sequence from the mouse R2 5¢-UTR while the
corresponding wild-type R2 promoter G-less template
(TATA
Wt
UTR
mut
-G-less) lacks this sequence. In order to
study if this difference was important, we made additional
luciferase reporter gene constructs where the native or
TATA-mutated R2 promoters were fused to an unrelated
5¢-UTR (Fig. 3D summarizes all template constructs).
We then tested the new luciferase constructs in vivo in
transient transfection experiments. Comparison of these
two new R2-luciferase constructs, which contain a mutated
5¢-UTR, shows that they differ in expression levels in a way
that indicates a requirement for the R2 TATA-box also
in vivo (Fig. 3B). As shown, a mutation of the TATA-box in
combination with a mutated 5¢-UTR causes a threefold
reduction in transcription also in vivo. In conclusion, the
experiments presented show that the R2 TATA-box is
important for initiation both in vitro (Fig. 3A) and in vivo
(Fig. 3B) when the R2 5¢-UTR is either deleted or mutated.
In contrast, the in vivo results suggest that when the R2
5¢-UTR is included in the template, the R2 TATA-box
becomes redundant.
Fig. 2. Both the R2 TATA-box and TBP are required for transcription
fromtheR2promoterinadefinedbasalin vitro transcription system but

the R2 TATA-box is dispensable for basal and S-phase specific trans-
cription from the R2 promoter in vivo. (A) In vitro transcription
experiments using highly purified mouse GTFs and the G-less cassette
reporter gene under the control of: lane 1, the AdML promoter;
lane 2, the full-length mouse R2 promoter (TATA
Wt
UTR
mut
); lane 3,
the full-length R2 promoter with a mutation in the TATA-box
(TATA
mut
UTR
mut
); lane 4, same as lane 2; lane 5, same as lanes 2 and
5 but with TBP omitted from the in vitro transcription reaction.
(B) Transient transfection experiments using the indicated amounts of
the full-length mouse R2 promoter (TATA
Wt
UTR
Wt
) ligated to the
luciferase gene (black bars) and of the full-length R2 promoter with a
mutation in the TATA-box (TATA
mut
UTR
Wt
), ligated to the
luciferase gene (white bars). (C) A mutation of the TATA-box does not
effect the S-phase specific expression from R2 promoter. Balb/3T3 cells

were transiently transfected with the full-length R2 promoter-luciferase
constructs, TATA
Wt
UTR
Wt
(m)andTATA
mut
UTR
Wt
(j). The graph
shows relative luciferase values at the indicated time points after release
from serum starvation.
Ó FEBS 2003 Role of RNR2 5¢-UTR in transcription initiation (Eur. J. Biochem. 270) 1795
In reciprocal experiments we also made new G-less
templates for in vitro transcription that included the R2
5¢-UTR and either contained the natural R2 TATA-box
or a mutation of it to GCGCGC (G-less templates
TATA
Wt
UTR
Wt
and TATA
mut
UTR
Wt
in Fig. 3D). The
results from these experiments confirm the in vivo results. As
seen in Fig. 3C, we found that transcription from these
templates, which include the R2 5¢-UTR, was almost
independent of the R2 TATA-box (compare to Fig. 2B).

Similarly to the experiments with the mutation of the R2
TATA-box (Fig. 2C), we also performed transient trans-
fection experiments in synchronized Balb/3T3 cells using
full-length R2 promoter-luciferase constructs with wild-
type or mutated 5¢-UTR (Fig. 3E TATA
Wt
UTR
Wt
and
TATA
Wt
UTR
mut
). We found that a mutation of the R2
5¢-UTR had no effect on the S-phase specific expression
from the mouse R2 promoter.
Mutation of the R2 TATA-box affects the position
for transcription initiation
It was possible that the mutation of the TATA-box and the
different 5¢-UTR could result in a change of transcription
start that might in turn influence the observed transcription
levels. We therefore performed primer extension assays on
Fig. 3. Importance of the R2 TATA-box for promoter activity in the
absence of the R2 5¢-UTR. (A) In vitro transcription experiments using
the R2-promoter G-less templates TATA
Wt
UTR
mut
(lane 1) and
TATA

mut
UTR
mut
(lane 2) (described in Fig. 3D). Two templates were
used in each experiment: the R2 promoter construct ligated to a longer
G-less cassette (product indicated by the upper arrow to the left of the
autoradiograph) and the adenovirus major late promoter ligated to a
shorter G-less cassette (product indicated by the lower arrow to the left
of the autoradiograph). All bands were quantified using the Scion
Image program and the ratio between the upper and lower bands for
each assay is presented below the autoradiograph. (B) Transient
transfection experiments with increasing amounts of DNA. Black
bars: the TATA
Wt
UTR
mut
R2-luciferase construct; white bars:
the TATA
mut
UTR
mut
R2-luciferase construct. The values on the
y-axis indicate the relative luciferase values after normalization of
the R2 promoter luciferase to the cotransfected SV40-driven Renilla
luciferase values for each transfection experiment. (C) In vitro
transcription experiments using the R2-promoter G-less templates 1,
TATA
Wt
UTR
Wt

;2,TATA
mut
UTR
Wt
(described in Fig. 3D). The
numbers below the autoradiograph represent the ratio between the
upper and lower bands. (D) Overview of the reporter gene constructs
used in experiments. All constructs start at the Pvu II restriction site
located at nucleotide )1500 relative to the R2 transcription start
site. TATA
Wt
indicates that the construct contains the wild-type
R2 TATA-box, TATA
mut
indicates that the construct carries a
TTTAAA fi GCGCGC mutation, UTR
Wt
indicates that the con-
struct contains 17 base pairs (luciferase constructs) or 42 base pairs
(G-less cassette constructs) from the wild-type mouse R2 5¢-UTR.
Finally, UTR
mut
indicates that the construct either lacks a 5¢-UTR (the
G-less cassette constructs) or that it contains a 5¢-UTR composed of 21
nucleotides from the 5¢-end of the G-less cassette fused to 18 nucleo-
tides from the 5¢-UTR of the luciferase reporter gene. Arrows indicate
the corresponding position for the wild-type R2 transcription start site.
(E) A mutation of the R2 5¢-UTR does not effect the S-phase specific
expression from R2 promoter. Balb/3T3 cells were transiently trans-
fected with the full-length R2 promoter-luciferase constructs,

TATA
Wt
UTR
Wt
(d) and TATA
Wt
UTR
mut
(r). The graph shows
relative luciferase values at the indicated time points after release from
serum starvation.
1796 I. Kotova et al.(Eur. J. Biochem. 270) Ó FEBS 2003
RNA synthesized in vitro using all four luciferase constructs
in nuclear extract-based transcription assays. The luciferase
templates were used in these experiments as it was difficult
to find suitable sequences for synthesis of a primer in the
G-less cassette. Similarly to the previously reported map-
ping of the transcription start in the wild-type R2 gene [15],
we found that all four constructs used here initiate
transcription on two adjacent nucleotides (Fig. 4). We also
found that both constructs that contain the wild-type
TATA-box (TATA
Wt
UTR
Wt
and TATA
Wt
UTR
mut
)initi-

ate transcription at the positions used by the native R2 gene.
In contrast, the two constructs that contain the mutated
TATA-box (TATA
mut
UTR
Wt
and TATA
mut
UTR
mut
) both
initiate transcription 2–3 base pairs upstream from the
normal R2 promoter initiation sites. However, this change
in transcription start site does not correlate to the expression
levels from the different promoters (compare to Figs 3A–C
and 4). Please observe that the UTR of the UTR
mut
templatesislongerthantheUTR
Wt
templates, which
explains the differences in length of the primer extension
products between these two types of constructs.
Protein interaction with the R2 5¢-UTR
Our data presented above suggest that the R2 5¢-UTR
contains sequences that bind protein(s) which assist TBP
in the formation of a functional preinitiation complex.
However, the R2 5¢-UTR showed no homologies to other
5¢-UTR sequences that previously have been identified as
important for expression from different promoters, for
example downstream promoter element (DPE) [14]. We

therefore analyzed the sequence of the R2 promoter and
the 5¢-UTR, and compared it to the corresponding region
in the human R2 gene. We could identify a potentially
interesting palindrome in the R2 5¢-UTR sequence that
covers 10 base pairs and overlaps with the position for
transcription initiation in the mouse R2 promoter
(Fig. 5A, palindromes in boxes). Interestingly, this se-
quence is also conserved in the human promoter except
for the second and the last base pairs. In general, the
sequence from the conserved atypical TATA-box into the
first 30 nucleotides of the 5¢-UTR shows a much higher
homology between mouse and human (66% identity)
compared to either the sequence upstream or downstream
from this sequence.
To study if the sequence downstream from the mouse R2
transcription start site interacts with proteins, we performed
gel shift assays using a labeled oligonucleotide correspond-
ing to base pairs )8to+23intheR2generelativetothe
major transcription start site, and nuclear extracts prepared
from logarithmically growing Ehrlich–Lettre ascites mouse
cells. Incubation of nuclear extract with this oligonucleotide
resulted in formation of a DNA-protein complex (Fig. 5B,
lanes 2 and 4), which could be competed specifically by an
unlabeled oligonucleotide with the same sequence as the
labeled oligonucleotide (Fig. 5B, lane 3). However, it could
not be competed by unrelated oligonucleotides (data not
shown). We also performed similar experiments using an
oligonucleotide that included the R2 TATA-box (nucleo-
tides )34 to +23). The results from these experiments were
identical to the results obtained with the shorter oligo-

nucleotide (data not shown).
TAF subunits have been shown to interact to sequences
both upstream and downstream from the TATA-box of
promoters. In addition, mapping of interactions between
different TAF subunits and the adenovirus major late
promoter also showed interactions between TAF250 and
TAF135 and sequences even downstream from the tran-
scription start [5]. We therefore wanted to study if the
sequence downstream from the R2 transcription start site
could interact with TFIID, but all commercially available
TAF antibodies are specific for human TAFs and show no
cross-reactivity with the corresponding mouse proteins
according to the manufacturers. We could however, obtain
a monoclonal antibody that recognizes mouse TAF
II
135 in
Western blots and which also can immunoprecipitate the
mouse TFIID-complex (W. S. Mohan II, E. Scheer,
O. Wendling, D. Metzger & L. Tora, personal communica-
tion). Incubation of a nuclear extract with monoclonal
antibodies against TAF135 abolished formation of the
complex (Fig. 5B, lanes 5–7), whereas incubation with the
same amounts of monoclonal antibodies against the ribo-
nucleotide reductase R1 protein had no effect (Fig. 5B,
lanes 8–10).
Fig. 4. Determination of the transcription start site in the different
R2-luciferase constructs. The indicated R2 promoter luciferase con-
structs were used as templates in in vitro transcription experiments and
the resulting RNA products were used for primer extension experi-
ments.Thesameprimer,specificfortheluciferaseopen-readingframe

was used for all constructs. Arrows indicate the position for the two
major transcription start sites for each template.
Ó FEBS 2003 Role of RNR2 5¢-UTR in transcription initiation (Eur. J. Biochem. 270) 1797
In order to map the position in the R2 5¢-UTR where the
TAF135 protein interacts, we synthesized three different
oligonucleotides corresponding to nucleotides )8to+23in
the R2 gene. Each oligonucleotide carried mutations in
discrete regions (Experimental procedures). Gel shift experi-
ments using these mutated oligonucleotides and nuclear
extracts showed the only mutations within the palindrome
sequence (mutation 1) resulted in a shift that differed from
the one observed using the wild-type oligonucleotide
(Fig. 5C and data not shown). As seen in Fig. 5C, the
oligonucleotide with mutations in the palindrome sequence
resulted in two gel shift bands compared to the single band
observed with the wild-type oligonucleotide. However,
neither of these two bands could be competed by addition
of TAF135 antibodies.
We next included the TAF135 antibody in in vitro
transcription experiments using nuclear extracts and the
G-less cassette constructs that contain the native R2 TATA-
box and either the natural or the deleted R2 5¢-UTR
(TATA
Wt
UTR
Wt
and TATA
Wt
UTR
mut

, respectively). We
found that addition of increasing amounts of the TAF
II
135
antibody resulted in an up to 5.1-fold increase in transcrip-
tion from the TATA
Wt
UTR
Wt
template (Fig. 5D, lanes
1–3). A corresponding, 4.8-fold increase was also found
when comparing the wild-type (TATA
Wt
UTR
Wt
)andthe
template that lacks the R2 5¢-UTR (TATA
Wt
UTR
mut
;
compare lanes 1 and 4). In contrast, addition of the
TAF
II
135 antibody to reactions using the TATA
Wt
UTR
mut
template resulted in a much less pronounced increase in
transcription (1.6-fold, compare Fig. 5D, lanes 4–6). In

control experiments, monoclonal antibodies against the
ribonucleotide reductase R1 protein had no effect on
transcription efficiency in similar in vitro transcription
Fig. 5. Sequences downstream from the R2 transcription start site
interact with proteins and affect R2 transcription. (A) Comparison of
the mouse and human R2 DNA sequences around their transcription
start sites. Capital letters in bold style indicate nucleotides that are
conserved between human and mouse; arrows indicate the mapped
major transcription start at each promoter and boxes represents the
partially conserved palindrome sequence described in the text. (B) Gel
shift experiments using nuclear extracts from logarithmically growing
Ehrlich–Lettre ascites cells and a
32
P-labeled wild-type oligonucleotide
including the transcription start and the downstream sequence from of
the mouse R2 gene. The protein-DNA complex is indicated by the
arrow to the right of the autoradiograph. Lanes 2–10,
32
P-labeled R2
5¢-UTR oligonucleotide with nuclear extracts (10 lg) from exponen-
tially growing Ehrlich–Lettre ascites cells; lane 3, a 100-fold molar
excess of unlabeled R2 5¢-UTR oligonucleotide was added; lanes 5–7,
nuclear extract was preincubated with different amounts (0.43 lg,
0.85 lgand1.7lg, respectively) of monoclonal antibody towards
human TAF
II
135 for 10 min on ice prior to addition of the probe;
lanes 8–10, the same as 5–7, but with monoclonal antibodies against
mouse R1. The numbers under the gel represent the intensity of each
band normalized to the band in lane 2. (C) Gel shift experiment using

nuclear extracts from logarithmically growing Ehrlich–Lettre ascites
cells, wild-type and mutated oligonucleotides including the transcrip-
tion start and the downstream sequence from of the mouse R2 gene.
Lanes 1–3:
32
P-labeled R2 5¢-UTR wild-type oligonucleotide; lanes 2
and 3,
32
P-labeled R2 5¢-UTR oligonucleotide with nuclear extracts
(10 lg) from exponentially growing Ehrlich–Lettre ascites cells; lane 3,
nuclear extracts were preincubated with 1.7 lgoftheTAF
II
135
monoclonal antibody; lanes 4–6, the same as lanes 1–3, but using a
labeled oligonucleotide containing mutations in the palindrome
sequence (mutation 1, experimental procedures); lanes 7–9, as lanes
1–3 but using a labeled mutation 2 oligonucleotide; lanes 10–12, as
lanes 1–3 but using a labeled mutation 3 oligonucleotide. (D) In vitro
transcription experiments with nuclear extracts isolated from log-
arithmically growing Ehrlich–Lettre ascites cells, the TATA
Wt
UTR
Wt
R2-G-less cassette reporter gene (lanes 1–3), the TATA
Wt
UTR
mut
R2-G-less cassette reporter gene (lanes 4–6) and monoclonal anti-
TAF
II

135 antibodies. Lanes 1 and 4, no antibody added to the in vitro
transcription reaction; lanes 2 and 5, 1 lL of 300-fold diluted antibody
was added to the in vitro transcription reactions; lanes 3 and 6, 1 lLof
60-fold diluted antibody was added to the in vitro transcription reac-
tions. All bands were quantified using the Scion Image program. The
upper numbers represent the intensity of each band normalized to the
band in lane 1. The lower numbers represent the intensity of the bands
in lanes 5 and 6 normalized to the band in lane 4.
1798 I. Kotova et al.(Eur. J. Biochem. 270) Ó FEBS 2003
experiments (data not shown). The fact that both a deletion
of the R2 5¢-UTR or addition of the monoclonal TAF
II
135
antibodies to the transcription reactions results in a similar
fivefold increase in transcription shows that TFIID binds to
the mouse R2 5¢-UTR and causes down-regulation of
transcription from the R2 promoter.
Finally, we also performed primer extension experiments
on in vitro transcription reactions were the TAF
II
135
antibody was included. We found that inclusion of the
TAF
II
135 antibodies in the in vitro transcription reaction
had no effect on the position for the R2 transcription start
site (data not shown).
Discussion
Previous and present experiments on the regulation of
expression of the ribonucleotide reductase R2 subunit are

focused on sequences located upstream from the R2
transcription start site, and on regulatory proteins that bind
to these sequences. The aim of these studies is both to
understand how transcription from a natural promoter is
regulated in detail, but also to identify potential targets for
interference with the expression of the R2 gene. Inhibition of
ribonucleotide reductase activity by hydroxyurea, which is a
specific inhibitor of the R2 subunit, or by peptidomimetics
that interfere with the interaction between the herpes
simplex virus R1 and R2 subunits, has previously proven
to be useful for antiproliferative therapy [28,29].
In order to extend these studies to also include the
function of sequences around the R2 transcription start
site, we obtained a polyamide that bound specifically to
the sequence immediately upstream from the mouse R2
TATA-box. Polyamides are described as potent inhibitors
of protein–DNA interactions and they penetrate the
plasma membrane efficiently [30]. Our initial experiments
presented here showed that the R2-specific polyamide
bound efficiently to its target sequence in the R2 promoter
but we found no inhibition of expression from an R2
promoter-luciferase reporter gene in stably transformed
cells, even at high concentrations of polyamide. We
realized that we had taken for granted that the R2
TATA-box is essential for transcription initiation at the
R2 promoter and had overseen the possibility that the R2
TATA-box could be redundant. Our results presented
here show that the polyamide could compete with
recombinant TBP for binding to the mouse R2 TATA-
box and that both TBP and the R2 TATA-box are

required for transcription from the R2 promoter in an in
vitro transcription system reconstituted from recombinant
or highly purified mouse general RNA polymerase II
transcription factors. In these assays we used naked
plasmid DNA templates where the G-less cassette is fused
directly downstream from the mapped transcription start
of the full-length R2 promoter, which either contained the
normal R2 TATA-box, or a mutation of the TATA-box
to GCGCGC. However, these results do not reflect the
situation in vivo, as our reconstituted in vitro transcription
system lacks both TAFs and coactivators like mediator.
Initially, we therefore made corresponding R2-promoter
constructs fused to the luciferase reporter gene to study
the importance of the R2 TATA-box in vivo. Similar to
the experiments using the polyamide in vitro,that
indicated redundancy of the R2 TATA-box, we found
no requirement for the R2 TATA-box in vivo.
We had first neglected that the two types of templates
used here, the R2-promoter coupled to either the G-less
cassette or to the luciferase reporter gene, differed as the
luciferase constructs also contained 17 base pairs of the
mouse R2 5¢-UTR. We therefore made new reporter gene
constructs, both G-less cassette constructs including the R2
5¢-UTR, and luciferase constructs where the R2 5¢-UTR
was replaced by sequences from the G-less cassette and the
luciferase 5¢-UTR. For each construct we also made a
corresponding version with a mutated R2 TATA-box.
By comparison of all constructs we could now find a
common theme for the dependency of the R2 TATA-box
(Table 1). Both in vivo and in vitro, a mutation of the R2

TATA-box had a very limited effect on transcription from
the R2 promoter in the presence of the R2 5¢-UTR. In
contrast, the R2-TATA box was required for full expression
from R2-promoter templates lacking the 5¢-UTR. However,
the requirement of the R2 TATA-box was not absolute in the
later situation. Rather, either the lack of a 5¢-UTR (G-less
cassette controlled by the TATA
Wt
UTR
mut
R2 promoter) or
amutationoftheR25¢-UTR (luciferase reporter controlled
by the TATA
Wt
UTR
mut
promoter) results in an up-regula-
tion of transcription. In this background, an additional
mutation of the R2 TATA-box brings transcription down
to the levels observed for the constructs that contain the R2
5¢-UTR (G-less cassette and luciferase under the control of
the TATA
Wt
UTR
Wt
or TATA
mut
UTR
Wt
promoters).

The results presented above led us to focus on the R2
5¢-UTR. Sequences downstream from the transcription
start site have previously been identified as essential for
transcription from different promoters, especially from
those lacking a TATA-box. The most well studied example
is the downstream promoter element (DPE) which was
identified as a sequence present in many TATA-less
promoters, and which interacts with the TFIID-complex
[14]. However, more recent studies showed that DPE
interacts with the Drosophila homolog of the transcriptional
repressor known as NC2 or Dr1-Drap1 and that purified
recombinant dNC2 activates DPE-containing promoters
and represses TATA-containing promoters [31]. Detailed
studies of protein–DNA interactions between the human
TFIID complex and the adenovirus major late promoter
using cross-linking have shown that TFIID subunits contact
DNA both downstream and upstream of the TATA-box,
but also that the hTAF
II
135 and hTAF
II
250 interact with
sequences even downstream of the transcription start site.
Several recent reports also show that TFIID or specific TAF
subunits are involved in repression of transcription rather
Table 1. Comparison of the relative transcription levels from the dif-
ferent R2-promoter gene constructs used in vivo and in vitr o.
Relative values
in vivo
Relative values

in vitro
TATA
Wt
-UTR
Wt
11
TATA
mut
-UTR
Wt
0.7 0.73
TATA
Wt
-UTR
mut
2.90 6.14
TATA
mut
-UTR
mut
1.03 1.46
Ó FEBS 2003 Role of RNR2 5¢-UTR in transcription initiation (Eur. J. Biochem. 270) 1799
than activation. For example, human TAF
II
130 interacts
with heterochromatin protein 1 (HP1) to mediate transcrip-
tional repression, and TAF
II
250 has been shown both to
bind to the DNA-binding domain of TBP to inhibit

TBP:DNA interactions and to be involved in repression
of MHC class I expression by the HIV protein Tat [32–34].
While these results would fit with the regulation of the
mouse R2 promoter as we have presented it here, we were
unable to find a consensus DPE-sequence [(A/G)G(A/T)
CGTG] in the mouse R2 5¢-UTR. Instead, comparison of
the mouse and human R2 promoters from the TATA-box
to 30 base pairs downstream from the R2 transcription start
showed that this region is highly conserved from mouse to
human. In this region 39 out of 59 basepairs (66%) are
identical, without including any gaps, between the mouse
and human sequences (Fig. 5A). This is in contrast to the
sequences immediately upstream or downstream from this
region, which shows <20% sequence identity. Interestingly,
we also found a perfect palindrome (CGGTGCACCG)
located immediately downstream from the mouse R2
transcription start. Except for the second and last nucleo-
tides, the palindrome is completely conserved in the human
R2 5¢-UTR.
Our results support a model where the palindrome
sequence downstream of the mouse R2 transcription start
interacts with TFIID subunits. This interaction functions
both as a core promoter element, as it eliminates the
requirement for the atypical R2 TATA-box, and also as a
repressor of transcription, as a deletion or a mutation of
this sequence or addition of TAF
II
135 antibodies leads to a
three- to fivefold up-regulation of transcription from the
mouse R2 promoter. TAF

II
135 has been shown to be a
subunit of two different TAF-containing complexes, TFIID
and TFTC [35]. TFTC comprises most of the TAF subunits
present in TFIID. However, TFTC lacks TBP and has been
shown to promote both basal and activated transcription
from TATA-containing as well as TATA-less promoters
but with three times lower efficiency compared to TFIID or
free TBP [36]. It is therefore possible that the fivefold
repression of R2 transcription that we detect from templates
containing the R2 5¢-UTR is due to TFTC-dependent
transcriptional initiation. In R2 templates lacking the
downstream sequence, or when anti-TAF
II
135 antibodies
are included in the in vitro transcription assays, transcrip-
tional initiation would be TBP-dependent and thus more
efficient. However, genome-wide expression analyses using
temperature-sensitive mutations in different TAF
II
-subunits
show that expression of many genes are up-regulated
when cells are shifted to the nonpermissive temperature,
thus indicating that expression of these genes are negat-
ively regulated by TFIID or other TAF
II
-containing
complexes [37].
Acknowledgements
We thank Irwin Davidson for the 32 TA monoclonal antibody towards

TAF
II
135, and Peter Dervan for synthesis of the polyamide used in our
experiments. This work was supported by grants from the Swedish
Research Council, the Swedish Cancer Society and the Swedish
Foundation for Strategic Research to both L.T and S.B, by grants from
the Human Frontier Science Program to S.B and from the Kempe
foundation to I.K and A.L.C.
References
1. Orphanides, G., Lagrange, T. & Reinberg, D. (1996) The general
transcription factors of RNA polymerase II. Genes & Dev. 10,
2657–2683.
2. Lee, T.I. & Young, R.A. (2000) Transcription of eukaryotic pro-
tein-coding genes. Annu. Rev. Genet. 34, 77–137.
3. Myers, L.C. & Kornberg, R.D. (2000) Mediator of transcriptional
regulation. Annu.Rev.Biochem.69, 729–749.
4. Buratowski, S., Hahn, S., Guarente, L. & Sharp, P.A. (1989) Five
intermediate complexes in transcription initiation by RNA poly-
merase II. Cell 56, 549–561.
5. Oelgeschlager, T., Chiang, C.M. & Roeder, R.G. (1996) Topology
and reorganization of a human TFIID-promoter complex. Nature
382, 735–738.
6. Kim, Y.J., Bjo
¨
rklund, S., Li, Y., Sayre, M.H. & Kornberg, R.D.
(1994) A multiprotein mediator of transcriptional activation and
its interaction with the C-terminal repeat domain of RNA poly-
merase II. Cell 77, 599–608.
7. Koleske, A.J. & Young, R.A. (1994) An RNA polymerase II
holoenzyme responsive to activators. Nature 368, 466–469.

8. Brou, C., Chaudhary, S., Davidson, I., Lutz, Y., Wu, J., Egly,
J.M., Tora, L. & Chambon, P. (1993) Distinct TFIID complexes
mediate the effect of different transcriptional activators. EMBO J.
12, 489–499.
9. Brand, M., Yamamoto, K., Staub, A. & Tora, L. (1999) Identi-
fication of TATA-binding protein-free TAFII-containing complex
subunits suggests a role in nucleosome acetylation and signal
transduction. J. Biol. Chem. 274, 18285–18289.
10. Veenstra, G.J. & Wolffe, A.P. (2001) Gene-selective develop-
mental roles of general transcription factors. Trends Biochem. Sci.
26, 665–671.
11. Reichard, P. (1993) From RNA to DNA, why so many ribo-
nucleotide reductases? Science 260, 1773–1777.
12. Bjo
¨
rklund, S., Skog, S., Tribukait, B. & Thelander, L. (1990)
S-phase-specific expression of mammalian ribonucleotide
reductase R1 and R2 subunit mRNAs. Biochemistry 29, 5452–
5458.
13. Johansson, E., Skogman, E. & Thelander, L. (1995) The TATA-
less promoter of mouse ribonucleotide reductase R1 gene contains
a TFII-I binding initiator element essential for cell cycle-regulated
transcription. J. Biol. Chem. 270, 30162–30167.
14. Burke, T.W. & Kadonaga, J.T. (1996) Drosophila TFIID binds to
a conserved downstream basal promoter element that is present in
many TATA-box-deficient promoters. Genes Dev. 10, 711–724.
15. Thelander, M. & Thelander, L. (1989) Molecular cloning and
expression of the functional gene encoding the M2 subunit of
mouse ribonucleotide reductase: a new dominant marker gene.
EMBO J. 8, 2475–2479.

16. Qian, X., Strahs, D. & Schlick, T. (2001) Dynamic simulations of
13 TATA variants refine kinetic hypotheses of sequence/activity
relationships. J. Mol. Biol. 308, 681–703.
17. Sawadogo, M. & Roeder, R.G. (1985) Factors involved in specific
transcription by human RNA polymerase II: analysis by a rapid
and quantitative in vitro assay. Proc. Natl Acad. Sci. USA 82,
4394–4398.
18. Kotova, I., Chabes, A.L., Segerman, B., Flodell, S., Thelander, L.
&Bjo
¨
rklund, S. (2001) A mouse in vitro transcription system
reconstituted from highly purified RNA polymerase II, TFIIH
and recombinant TBP, TFIIB, TFIIE and TFIIF. Eur. J. Bio-
chem. 268, 4527–4536.
19. Baird, E.E. & Dervan, P.B. (1996) Solid-phase synthesis of
sequence specific DNA binding polyamides containing imidazole
and pyrrole amino acids. J. Am. Chem. Soc. 118, 6141–6146.
20. Ehley,J.A.,Melander,C.,Herman,D.,Baird,E.E.,Ferguson,
H.A., Goodrich, J.A., Dervan, P.D. & Gottesfeld, J.M. (2002)
1800 I. Kotova et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Promoter scanning for transcription inhibition with DNA-binding
polyamides. Mol. Cell Biol. 22, 1723–1733.
21. Chabes, A. & Thelander, L. (2000) Controlled protein degrada-
tion regulates ribonucleotide reductase activity in proliferating
mammalian cells during the normal cell cycle and in response to
DNA damage and replication blocks. J. Biol. Chem. 275, 17747–
17753.
22. Stein, B., Rahmsdorf, H.J., Steffen, A., Litfin, M. & Herrlich, P.
(1989) UV-induced DNA damage is an intermediate step in
UV-induced expression of human immunodeficiency virus type 1,

collagenase, c-fos, and metallothionein. Mol. Cell Biol. 9, 5169–
5181.
23. Sambrook, J., Fritisch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring. Harbor
Laboratory Press, Cold Spring Harbor, NewYork.
24. Dignam, J.D., Martin, P.L., Shastry, B.S. & Roeder, R.G. (1983)
Eukaryotic gene transcription with purified components. Methods
Enzymol. 101, 582–598.
25. Carthew, R.W., Chodosh, L.A. & Sharp, P.A. (1985) An RNA
polymerase II transcription factor binds to an upstream element in
the adenovirus major late promoter. Cell 43, 439–448.
26. Carey, M. & Smale, S.T. (2000) Transcriptional Regulation in
Eukaryotes: Concepts, Strategies, and Techniques. Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York.
27. Reference withdrawn.
28. Liuzzi, M., Deziel, R., Moss, N., Beaulieu, P., Bonneau, A.M.,
Bousquet, C., Chafouleas, J.G., Garneau, M., Jaramillo, J.,
Krogsrud, R.L., Lagace
´
,L.,McCollum,R.S.,Nawoot,S.&
Guindon, Y. (1994) A potent peptidomimetic inhibitor of HSV
ribonucleotide reductase with antiviral activity in vivo. Nature 372,
695–698.
29. Nocentini, G. (1996) Ribonucleotide reductase inhibitors: new
strategies for cancer chemotherapy. Crit. Rev. Oncol. Hematol. 22,
89–126.
30. Dickinson,L.A.,Gulizia,R.J.,Trauger,J.W.,Baird,E.E.,Mosier,
D.E., Gottesfeld, J.M. & Dervan, P.B. (1998) Inhibition of RNA
polymerase II transcription in human cells by synthetic DNA-
binding ligands. Proc. Natl Acad. Sci. USA 95, 12890–12895.

31. Willy, P.J., Kobayashi, R. & Kadonaga, J.T. (2000) A basal
transcription factor that activates or represses transcription.
Science 290, 982–985.
32. Vassallo, M.F. & Tanese, N. (2002) Isoform-specific interaction of
HP1 with human TAFII130. Proc.NatlAcad.Sci.USA99, 5919–
5924.
33. Liu, D., Ishima, R., Tong, K.I., Bagby, S., Kokubo, T.,
Muhandiram, D.R., Kay, L.E., Nakatani, Y. & Ikura, M. (1998)
Solution structure of a TBP-TAF (II), 230 complex: protein
mimicry of the minor groove surface of the TATA box unwound
by TBP. Cell 94, 573–583.
34. Weissman, J.D., Brown, J.A., Howcroft, T.K., Hwang, J.,
Chawla, A., Roche, P.A., Schiltz, L., Nakatani, Y. & Singer, D.S.
(1998) HIV-1 tat binds TAFII250 and represses TAFII250-de-
pendent transcription of major histocompatibility class I genes.
Proc.NatlAcad.Sci.USA95, 11601–11606.
35. Bell, B. & Tora, L. (1999) Regulation of gene expression by
multiple forms of TFIID and other novel TAFII-containing
complexes. Exp. Cell Res. 246, 11–19.
36. Wieczorek, E., Brand, M., Jacq, X. & Tora, L. (1998) Function of
TAF (II)-containing complex without TBP in transcription by
RNA polymerase II. Nature 393, 187–191.
37. Holstege, F.C., Jennings, E.G., Wyrick, J.J., Lee, T.I., Hengart-
ner, C.J., Green, M.R., Golub, T.R., Lander, E.S. & Young, R.A.
(1998) Dissecting the regulatory circuitry of a eukaryotic genome.
Cell 95, 717–728.
38. Turner, J.M., Swalley, S.E., Baird, E.E. & Dervan, P.B.
(1998) Aliphatic/aromatic amino acid pairings for polyamide
recognition in the minor groove of DNA. J. Am. Chem. Soc. 120,
6219–6226.

Ó FEBS 2003 Role of RNR2 5¢-UTR in transcription initiation (Eur. J. Biochem. 270) 1801