Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Identification and functional expression of a second human
b-galactoside a2,6-sialyltransferase, ST6Gal II
Marie-Ange Krzewinski-Recchi
1
, Sylvain Julien
1
, Sylvie Juliant
2
,Me
´
lanie Teintenier-Lelie
`
vre
1
,
Be
´
ne
´
dicte Samyn-Petit
1
, Maria-Dolores Montiel
1
, Anne-Marie Mir
1
, Martine Cerutti
2
,
Anne Harduin-Lepers
1
and Philippe Delannoy

1
1
Unite
´
de Glycobiologie Structurale et Fonctionnelle, UMR CNRS – USTL 8576, Universite
´
des Sciences et Technologies de Lille,
F-59655 Villeneuve d’Ascq, France;
2
Station de Recherche de Pathologie Compare
´
e, UMR CNRS – INRA 5087,
F-30380 Saint Christol-lez-Ale
`
s, France
BLAST
analysis of the human and mouse genome sequence
databases using the sequence of the human CMP-sialic
acid:b-galactoside a-2,6-sialyltransferase cDNA (hST6Gal I,
EC2.4.99.1) as a probe allowed us to identify a putative
sialyltransferase gene on chromosome 2. The sequence of
the corresponding cDNA was also found as an expressed
sequence tag of human brain. This gene contained a
1590 bp open reading frame divided in five exons and the
deduced amino-acid sequence didn’t correspond to any
sialyltransferase already known in other species. Multiple
sequence alignment and subsequent phylogenic analysis
showed that this new enzyme belonged to the ST6Gal
subfamily and shared 48% identity with hST6Gal-I.
Consequently, we named this new sialyltransferase

ST6Gal II. A construction in pFlag vector transfected in
COS-7 cells gave raise to a soluble active form of ST6Gal II.
Enzymatic assays indicate that the best acceptor substrate of
ST6Gal II was the free disaccharide Galb1–4GlcNAc
structure whereas ST6Gal I preferred Galb1–4GlcNAc-R
disaccharide sequence linked to a protein. The a2,6-linkage
was confirmed by the increase of Sambucus nigra agglutinin-
lectin binding to the cell surface of CHO transfected with
the cDNA encoding ST6Gal II and by specific sialidases
treatment. In addition, the ST6Gal II gene showed a very
tissue specific pattern of expression because it was found
essentially in brain whereas ST6Gal I gene is ubiquitously
expressed.
Keywords: human; b-galactoside a2,6-sialyltransferase;
molecular cloning.
Sialylated sugar chains are present at the cell surface of
various animal species. Due to their position, they are
thought to serve important roles in a large variety of
biological functions such as cell–cell and cell–substrate
interactions, bacterial and virus adhesion, and protein
targeting [1,2]. Sialylated glycoconjugates exhibit remark-
ably diverse structures [3–5] and their expression has been
shown to change during development [6], differentiation,
disease and oncogenic transformation [7]. In mammals,
sialic acids are found at the nonreducing terminal position
of glycoconjugates sugar chains, a2,3- or a2,6-linkedtoa
b-
D
-galactopyranosyl (Gal) residue, or a2,6-linkedtoa
b-

D
-N-acetylgalactosaminyl (GalNAc) or a b-
D
-N-acetyl-
glucosaminyl (GlcNAc) residue. Sialic acids are also found
a2,8-linked to sialic acid residues in gangliosides and in
polysialic acid, a linear a2,8-homopolymer observed on
several glycoproteins including the neural cell adhesion
molecule N-CAM [8]. In addition, a2,6-linked sialic acid is
also present in free oligosaccharides such as 6¢-sialyllactose
from human milk [9], monosialylganglioside of the human
meconium [10]; Neu5Aca2–6GalNAcb1–4GlcNAc-R
sequence has been described as a terminal sequence of the
N-glycans of pituitary hormones [11].
The biosynthesis of sialylated oligosaccharides is cata-
lysed by a family of enzymes named sialyltransferases [3,12].
These enzymes are a subset of the glycosyltransferases
family (family 29 in the CAZy database [13]) that use CMP-
Neu5Ac as the activated sugar donor to catalyse the transfer
of sialic acid residues to the terminal position of oligosac-
charide chains of glycolipids and glycoproteins. Sialyltrans-
ferases are a family of type II membrane-bound glycoproteins
with a short NH
2
-terminal cytoplasmic tail, a 16–20 amino
acid signal anchor domain that is involved with retention of
the protein in the Golgi apparatus, a stem region, highly
variable in length (from 20 amino acids to 200 amino acids),
ending with a large COOH-terminal catalytic domain that
resides in the Golgi lumen [14]. The catalytic domain

contains three highly conserved amino-acid sequences
termed sialylmotifs L (large), S (small), and VS (very small).
Correspondence to M A. Krzewinski-Recchi, Unite
´
de Glycobiologie
Structurale et Fonctionnelle, UMR CNRS no. 8576, Laboratoire de
Chimie Biologique, Universite
´
des Sciences et Technologies de Lille,
F-59655 Villeneuve d’Ascq, France.
Fax: + 33 320 43 65 55, Tel.: + 33 320 43 69 23,
E-mail:
Abbreviations: EST, expressed sequence tag; Gal, b-
D
-galactopyrano-
sylresidue;GalNAc,b-
D
-N-acetylgalactosaminyl; N-CAM, neural
cell adhesion molecule; EGT, ecdysone-S-glycosyltransferase.
Enzyme: CMP-sialic acid:b-galactoside a-2,6-sialyltransferase cDNA
(hST6Gal I, EC2.4.99.1).
Note: nucleotide sequence data are available in the DDBJ/EMBL/
GenBank databases under the accession number AJ512141.
(Received 5 November 2002, revised 7 January 2003,
accepted 10 January 2003)
Eur. J. Biochem. 270, 950–961 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03458.x
Sialylmotifs L and S are involved in the binding of donor
and acceptor substrates, respectively [15,16], whereas the
sialylmotifVSisinvolvedinthecatalyticprocess[17].
To date, 19 different sialyltransferases have been identi-

fied in mouse and humans but only one of these enzymes,
ST6Gal I (CMP-sialic acid:b-galactoside a2,6-sialyltrans-
ferase, EC 2.4.99.1) is known to mediate the transfer of a
sialic acid residue in a2,6-linkage to the galactose residue of
thetype2disaccharide(Galb1–4GlcNAc) found as a free
disaccharide or as a terminal N-acetyllactosamine unit of
N- and O-glycans. However, as reviewed previously [3],
ST6Gal I has been shown in in vitro assays to have a low
activity for transferring sialic acid onto other oligosac-
charide structures, such as lactose (Galb1–4Glc), type 1
disaccharide structure (Galb1–3GlcNAc) [18] or type 2
structure GalNAcb1–4GlcNAc [19,20] but not onto
type 3 structure (Galb1–3GalNAc). ST6Gal I has been
purified to homogeneity from animal livers and hepatoma
cells (reviewed in [3]) and cDNA has been cloned from rat
liver [21], human placenta [22], mouse liver [23], bovine
tissues [20] and chick embryo [24]. Several mRNA isoforms
are generated from a unique gene encoding ST6Gal I
through the use of physically distinct promoters. These
transcripts differ only in their 5¢-untranslated region and
share an identical ST6Gal I coding region. These transcripts
are expressed in a tissue-specific manner and contribute to
the regulation of a2,6-sialylation in tissue and cells during
cell differentiation [25,26], inflammation [27] and oncogenic
transformation [28,29].
BLAST
analysis of the mouse and human genome
databases allowed us to identify an unknown sialyltrans-
ferase gene encoding a second Galb1–4GlcNAc a2,6-
sialyltranferase that has been named hST6Gal II. In this

report, we describe the functional analysis of a recombinant
human ST6Gal II, which shows slightly different substrate
specificity than ST6Gal I. The expression pattern of the
gene was also examined in various human tissues and found
to be very restricted, mainly to brain and fetal tissues.
Materials and methods
Materials
CMP-[
14
C]Neu5Ac (10.7 GBqÆmmol
)1
), Redivue stabilized
[a-
32
P]dCTP (110 TBqÆmmol
)1
) and Rediprime II DNA
labelling system were from Amersham Pharmacia Biotech
(Little Chalfont, UK). The DyNazyme EXT DNA poly-
merase was from Ozyme (Saint Quentin en Yvelines,
France). Oligonucleotides were synthesized by Eurogentec
(Seraing, Belgium). Dulbecco’s modified Eagle’s medium
(DMEM) containing 4.5 gÆL
)1
glucose and lacking gluta-
mine was from BioWhittaker Europe. Alpha Eagle’s
minimal essential medium (aMEM), OPTIMEM,
L
-gluta-
mine and antibiotics used in cell culture were from Gibco

BRL (Cergy-Pontoise, France). Fetal bovine serum was
from D. Dustscher (Issy-les-Moulineaux, France). Lipofect-
AMINE PLUS Reagent was from Invitrogen. The block-
ing reagent and fluorescein labelled anti-digoxigenin Fab
fragments and DOTAP transfection reagent were from
Roche (Meylan, France). a
1
-Acid glycoprotein, fetuin,
Gala-O-pNp, GalNAca-O-pNp, GlcNAca-O-pNp,
Galb1–3GalNAca-O-benzyl, Galb1–3GlcNAc, Galb1–
4GlcNAc, the expression vector pFlag-CMV-1, the mono-
clonal antibody (mAb) anti-Flag BioM2, alkaline phospha-
tase conjugated goat anti-[mouse IgG (Fab specific)] Ig and
CMP-Agarose beads were from Sigma (St Louis, MO,
USA). Lacto-N-neotetraose and Lacto-N-tetraose were the
generous gift of G. Strecker and F. Chirat (UMR CNRS
8576, Villeneuve d’Ascq, France). Galb1–3GlcNAcb-O-
octyl and Galb1–4GlcNAcb-O-octyl were the generous gift
of C. Auge
´
(URA CNRS 462, Orsay, France). MTN
TM
multiple tissue Northern blot and MTE
TM
multiple tissue
expression arrays were from Clontech (Palo Alto, CA,
USA). Sialic Acid Linkage Analysis Kit was from Glyko
Inc. (Novato, CA, USA). The expressed sequence tag (EST)
clone (GenBank/EBI accession number AB058780) was a
generous gift from T. Nagase, KAZUSA DNA Research

Institute, Chiba, Japan.
Preparation of asialo-glycoproteins
Fetuin and a
1
-acid glycoprotein (10 mgÆmL
)1
) were incu-
bated for 1 h in 0.05
M
sulfuric acid at 80 °C. The asialo-
products were then neutralized, dialyzed and lyophilized
prior to use. The carbohydrate content of asialo-glycopro-
teins was analysed by GC-MS [30].
Construction of expression vectors of hST6Gal II
and transfections
A truncated form of hST6Gal II lacking the first 33 amino
acids of the open reading frame, was generated by PCR
amplification using a 5¢ primer containing an EcoRI site,
5¢-CCGACAGGAATTCCGCTGAGCCTGTACCCAGC
TCCC-3¢ (nucleotides 91–127, Fig. 1A) and 3¢ primer
containing a BamHI site, 5¢-ACATTGGATCCCAAG
AAACCCTTTTTAAGAGTGTGG-3¢ (nucleotides 1577–
1614, Fig. 1A). A full-length open reading frame of
ST6Gal II was also prepared by PCR amplification using
a5¢ primer containing an EcoRI site, 5¢-CCCTCTGA
ATTCAGACACAAGGTGCTGACCGCAGAG-3¢ (nuc-
leotide 1–35, Fig. 1A) and the 3¢ primer described above.
The 25 lL of PCR mixture consisted of 1 unit of
DyNazyme EXT, 0.3 l
M

of each primer, 0.2 m
M
dNTP
and 1.5 ng of plasmid DNA. Reactions were run using the
following conditions: 1 min at 96 °C, 4 min at 72 °Cfor40
cycles. Two amplification fragments of 1656 bp and
1522 bp, respectively, were obtained and subcloned in the
Topo TA cloning vector (Invitrogen, USA). The inserted
fragments were cut out by digestion with BamHI and EcoRI
and inserted into BamHI and EcoRI sites of the pFlag-
CMV-1 expression vector, which contains the preprotrypsin
leader sequence. Restriction enzymes digestions and DNA
sequencing by Genoscreen (Lille, France) confirmed the
cDNA sequence and the insert junctions. The resulting
plasmids encoded a soluble fusion protein consisting of the
Flag sequence and a truncated form of ST6Gal II (pFlag-
sST6Gal-II) or the whole coding region of ST6Gal II
(pFlag-wST6Gal-II). COS-7 cells were grown in DMEM
with 4.5 gÆL
)1
glucose without glutamine supplemented
with 10% fetal bovine serum,
L
-glutamine 20 m
M
, penicillin,
streptomycin at 37 °C under 5% CO
2
.
Twelve micrograms of Qiagen-purified pFlag-sST6Gal-II

or pFlag plasmids were transiently transfected into COS-7
Ó FEBS 2003 Characterization of the human ST6Gal II (Eur. J. Biochem. 270) 951

952 M A. Krzewinski-Recchi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
cells in a 100-mm diameter dish using LipofectAMINE
PLUS reagent, following the manufacturer’s instructions.
The medium was harvested 48 h after transfection. The
enzymatic protein expressed in the medium was used as the
enzyme source.
Western blot analysis of a soluble ST6Gal II
Nine milliliters of media from COS-7 cells transfected with
the expression plasmid pFlag-sST6Gal II and from mock-
transfected cells were concentrated into 2 mL on Macrosep
30K and 1.5 mL of this preparation were incubated with
150 lL of CMP-Agarose beads (2.8 lmolÆmL
)1
CMP).
After washing, the supernatants were discarded and beads
were boiled for 5 min in 100 lL SDS/PAGE loading buffer,
centrifuged and loaded on a 4–20% gradient polyacryl-
amide gel under reducing conditions. After Western blotting,
the nitrocellulose membrane was incubated with 10 lgÆmL
)1
anti-Flag BioM2 mAb. Alkaline phosphatase-labelled goat
anti-(mouse IgG) Ig was used as the second antibody and
revealed by Nitro Blue tetrazolium/5-bromo-4-chloro-
3-indolyl-phosphate and X-phosphate staining.
Confocal microscopy
CHO cells were grown in aMEM with glutamax, supple-
mented with 10% fetal bovine serum, penicillin and

streptomycin at 34 °C under 5% CO
2
.CHOandCOS-7
cells were transiently transfected with the pFlag plasmid or
pFlag plasmid containing the full-length ST6Gal II cDNA
(pFlag-wST6Gal-II). Briefly, 15 000 cells were seeded on
eight chamber slides (LAB-TEK Nalgen Nunc Interna-
tional) and cultured in standard conditions until mid-
confluence. Then cells were transfected with 0.25 lgof
purified plasmid per well in 200 lLOPTIMEM,usingthe
Lipofectamine Reagent Plus kit. After transfection, cells
were cultured for 24 h in fresh medium containing fetal
bovine serum. Cells were then fixed for 30 min at 4 °Cwith
4% paraformaldehyde and quenched 30 min with 50 m
M
NH
4
Cl in phosphate buffered saline (NaCl/P
i
). Cells were
then saturated for 30 min at 4 °C with 2% polyvinylpyr-
olidone in Tris buffered saline (NaCl/Tris) and incubated
with digoxigenin-labeled Sambucus nigra agglutinin
(10 lgÆmL
)1
). After washing with NaCl/Tris, the cells were
further saturated for 30 min with the blocking reagent.
S. nigra agglutinin-DIG was revealed using anti-digoxige-
nin-fluorescein Fab fragments diluted 1 : 100 in NaCl/Tris,
1% BSA. Laser confocal microscopy analysis was per-

formed using a Zeiss-instrument (Model LSM 510).
Construction of recombinant baculoviruses
and production of soluble ST6Gal I and ST3Gal III in Sf9
In order to express soluble and His
6
-tagged enzymatic forms
of human ST6Gal I (GenBank accession number X17247)
and rat ST3Gal III (clone ST3N-1 [31]), the 5¢ end of these
genes were modified. The cytoplasmic tail and the trans-
membrane domain were deleted and the signal peptide
sequence of a viral gene ecdysone-S-glycosyltransferase
(EGT) was inserted [32]. For this purpose, a 247 bp PCR
fragment corresponding to the hST6Gal I amino acids
52–122 was amplified using a pflag/hST6Gal I plasmid,
generated by PCR from HepG
2
cDNA library (C. Baisez
and A. Harduin-Lepers, unpublished data), as the template
and two specific primers For 6I 5¢-CGATGAATTC
GTTAACGCTCATCACCATCACCATCACGGGAAA
TTGGCCATGGGGT-3¢ containing a HpaIsiteandBack
6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢
and subcloned into pUC19 for further sequencing (Euro-
gentec, Belgium). This plasmid was then digested with AvrII
and BamHI and ligated to the remaining 909 bp AvrII–
BamHI fragment containing the 3¢ end of the gene purified
from the original construct pflag/hST6Gal I. This construc-
tion named pUC 6hisST6Gal I contained an additional
HpaI site, the last codon of the EGT signal peptide sequence
and six histidine codons. The modified hST6Gal I sequence

was then excised as an 1104 bp HpaI–BamHI fragment and
inserted into the HpaI–BglII sites of pUC-PSEGT. The
pUC-PSEGT plasmid was generated by inserting a 78 bp
fragment encoding the signal peptide sequence of EGT gene
[32]. This 78 bp fragment was obtained after the annealing
of the two following synthetic oligonucleotides For EGT 5¢-
GATCCGCCACCATGACCATCTTATGTTGGCTCG
CTCTCCTGAGCACACTCACAGCTGTTAACGCTG
ACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCG
TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG
CCAACATAAGATGGTCATGGTGGCG-3¢. (In order
to avoid homologous recombination between the two EGT
sequences, codons were degenerate.) For rST3Gal III, a
108 bp DNA fragment containing a HpaIsite,thelast
codon of the EGT signal peptide sequence, six histidine
codons and 19 codons corresponding to amino-acid
residues 34–52 was reconstituted using a set of nine
overlapping synthetic oligonucleotides and four unique
restriction sites AvrII, MunI, HindIII and SacI. The DNA
fragment was subcloned in a pUC plasmid and sequenced.
The reconstituted fragment was HpaI–SacI cut and cloned
in HpaI–SacI sites of the pUC-PSEGT plasmid described
above. The resulting construct was digest with AvrII–MunI
to receive the 1900 bp AvrII–EcoRI fragment prepared
from pBS SK ST3Gal III (clone ST3N-1 [31]). The plasmid
pUC PS6HisST3Gal III was obtained. The full length
modified hST6Gal I gene was then excised after digestion
with BamHI and HindIII and inserted at the BglII–HindIII
sites of the p119 transfer vector designed for recombination
into the p10 locus of the baculovirus giving rise to the p119-

PS ST6Gal I construct [33]. The full-length modified
Fig. 1. Nucleotide and predicted amino acid sequence (A) and hydro-
pathy profile (B) of human ST6Gal II, and (C) comparison of the sia-
lylmotifs L, S and VS of hST6Gal II with those of previously cloned
sialyltransferases. (A) Numbering of the cDNA begins with the initi-
ation codon. The amino-acid sequence is shown in single letter code.
The putative N-terminal transmembrane domain is boxed. Putative
N-glycosylation site (N-X-S/T) are marked with asterisks (*) and
O-glycosylation sites (NetOGlyc 2.0) with back dots (d). Sialylmotifs
L, S and VS are underlined. (B) The prediction of transmembrane
region has been determined by the Dense Alignment Surface method
according to Cserzo et al. (1997) [49]. The portions (positive numbers)
above the horizontal dotted line correspond to hydrophobic regions.
(C) The sialyltransferases protein sequences were aligned using the
CLUSTAL W
algorithm. Amino acid identities are marked with asterisks
and dots indicate a position that is well conserved.
Ó FEBS 2003 Characterization of the human ST6Gal II (Eur. J. Biochem. 270) 953
rST3Gal III gene was excised with BamHI and HindIII and
inserted at the BglII–HindIII site of the p119 transfer vector
giving the p119-PS ST3Gal III construct. Sf9 cells (ATCC
CRL1711) were cotransfected by lipofection [34] using
DOTAP with the transfer vectors and purified viral DNA.
The recombinant baculoviruses were plaque purified and
viral clones were tested for sialyltransferase activity as
described below.
Sialyltransferase assays
Sialyltransferase assays were performed as described previ-
ously [30,35–36]. In brief, enzyme activity was measured in
0.1

M
cacodylate buffer pH 6.2, 10 m
M
MnCl
2
,0.2%
Triton CF-54, 50 l
M
CMP-[
14
C]Neu5Ac (1.85 KBq), with
one of the acceptor substrate (2 mgÆmL
)1
for glycoprotein
or 1 m
M
for arylglycosides and oligosaccharides) and 23 lL
of the enzyme source in a final volume of 50 lL. The
reactions were performed at 37 °C for 4 h. Reaction
products were separated from CMP-[
14
C]Neu5Ac depend-
ing on the acceptor substrate. For glycoproteins, the
reaction was terminated either by precipitation and filtra-
tion as previously described [35] or by SDS/PAGE. After
Western blotting, the radioactive products were detected
and quantified by radio-imaging using a Personal Molecular
Imager FX (Bio-Rad, France). Quantification was per-
formed within the linear range of standard radioactivity.
For arylglycosides, the reaction was stopped with the

addition of 1 mL H
2
O and products were isolated by
hydrophobic chromatography on C
18
SepPak cartridges
(Millipore Corp., Milford, MA, USA). For free oligosac-
charides, the reaction mixture was heated at 100 °Cfor
5 min, centrifuged and subjected to a paper descending
chromatography (Whatman 3) in the following solvent:
pyridine/ethyl acetate/acetic acid/H
2
O (5 : 5 : 1 : 3, v/v/v/v)
and the radioactive products were detected and quantified
by radio-imaging. Under these conditions, the product
formation from the individual acceptor substrates was
linearupto8h.
For kinetic analysis, incubations were performed as
described above using various concentrations of acceptor
substrates: 0–500 l
M
of CMP-Neu5Ac, 0–500 l
M
of
Galb1–4GlcNAcb-O-octyl, or 0–5 mgÆmL
)1
of asialo-a
1
-
acid glycoprotein. Kinetic parameters were determined by

Lineweaver–Burk plots and the K
m
for asialo-a
1
-acid
glycoprotein is expressed in m
M
relative to the 18 mol
terminal Gal residues per mol of human of asialo-a1-acid
glycoprotein [37].
Linkage analysis by sialidase digestion
For linkage analysis, asialo-a
1
-acid glycoprotein sialylated
either with the soluble ST6Gal II or, for the control, with
soluble ST6Gal I and ST3Gal III, was precipitated with
ethanol and air dried, dissolved in water and then digested
with specific sialidase (sialic acid linkage analysis kit, Glyco
Inc., USA): NANase I (specific for a2,3-linked sialic acid,
0.5 mUÆlL
)1
), NANase II (specific for a2,3 and a2,6-linked
sialic acid, 1 mUÆlL
)1
), or NANase III (specific for a2,3,
a2,6 and a2,8/9-linked sialic acid, 0.5 mUÆlL
)1
)at37 °Cfor
1 h. Digested materials were then analysed by SDS/PAGE
and the radioactive products were analysed by radio-imaging.

Multiple tissue expression array and northern analysis
An EcoRI–BamHI 1.6 kb fragment of the human ST6Gal
II cDNA and a 1.8 kb human b-actin cDNA (Clontech)
used as a positive control for Northern were labelled with
[a-
32
P]dCTP by random priming using the Rediprime II
DNA labelling system. The human multiple tissues array
membrane and Northern blot were probed according to the
manufacturer’s instructions and analysed by radio-imaging.
Results
Identification and isolation of human ST6Gal II cDNA
Similarity searches using the tBLASTn algorithm in the
human expressed sequence tag (EST), high throughput
genomic sequences (HTGs) and human genomic sequences
divisions of the GenBank
TM
/EBI databases at the National
Center for Biotechnology Information allowed us to
identify nucleotide sequences with significant similarities
to hST6Gal I (X17247 [22]). These sequences (GenBank
accession numbers AB058780, BC008660, AA385852;
EST clones and AC108049, AC016994, AC005040 and
NT_005429; genomic clones) were subsequently used to
reconstitute a nucleotide sequence potentially encoding a
sialyltransferase as yet not described. Clone AB058780
represented a full-length cDNA sequence already cloned
from hippocampus [38] whereas EST clones BC008660
and AA385852, found in ovary adenocarcinoma and in
thyroid, respectively, represented truncated nucleotide

sequences. Oligonucleotides were designed and partial
cDNA sequence (nucleotides 940–1629) was obtained by
RT-PCR using neuroblastoma cells NSK total RNAs as
template (data not shown). This nucleotide sequence
(GenBank accession number AJ512141) was subcloned
and sequenced and found to be 100% identical to the
AB058780 corresponding sequence. However, we failed to
amplify the corresponding full-length open reading frame
as one fragment and thus we further worked with the
clone AB058780 kindly provided by T. Nagase, Kazusa
DNA Research Institute (Kisarazu, Chiba, Japan). As
shown in Fig. 1A, the nucleotide sequence contains an
open reading frame of 1586 bp encoding a putative 529
amino-acid polypeptide with three putative N-glycosyla-
tion sites and two putative O-glycosylation sites. Hydro-
pathy profile analysis of the predicted protein (Fig. 1B)
suggests that it has the structural organization of a
membrane-bound type II glycoprotein, which is com-
monly described for Golgi glycosyltransferases. This
polypeptide shows a short cytosolic region of 11 amino-
acid residues, a single hydrophobic segment of 20 amino-
acid residues and a large luminal catalytic domain (498
amino-acid residues). Comparison of the primary structure
of this new sialyltransferase with that of the 18 other
cloned human sialyltransferases indicates that there are
significant similarities in the three sialyltransferases con-
served regions named sialylmotifs L, S and VS (Fig. 1C).
In particular, this protein shares with hST6Gal I a
common motif YEXXP in the sialylmotif S where the
glutamic acid residue (E) is present only in these two

proteins. This analysis strongly suggests that this protein
represents a new sialyltransferase and since this polypep-
954 M A. Krzewinski-Recchi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
tide shows 48% overall identity with the human ST6Gal I,
we have named it hST6Gal II.
The gene organization of hST6Gal II was reconstituted
from the genomic clones previously identified and found to
localize on human chromosome 2 (2q11.2-q12.1). As
presented in Fig. 2A, in a similar manner to the hST6Gal I
gene found on human chromosome 3 (3q27-q28), hST6Gal
II gene divides into five exons and spans over 38 kb of
human genomic sequence. Sequence comparison of each
exon shows that these two genes share high similarities in E2,
E3, E4, E5 (Fig. 2B). This analysis, as well as the dendro-
gram of the cloned human sialyltransferases (Fig. 3),
suggests a common ancestral gene for the two ST6Gal genes
that have evolved independently.
ST6Gal-II gene expression
In order to determine the expression pattern and the size of
hST6Gal II mRNA, Northern blotting was performed using
the ST6Gal II cDNA (1.6 kb fragment) as a probe. As
shown in Fig. 4A, among the 12 human tissues examined,
hST6Gal II mRNA was detectable only in brain as an
8.0 kb transcript. An expression array of 72 different human
tissues and eight different control RNAs and DNAs, was
also probed with the 1.6 kb hST6Gal II cDNA (Fig. 4B).
hST6Gal II gene appears to be expressed in lymph node, to a
lesser extent in testis, thyroid gland, caudate nucleus,
temporal lobe, hippocampus, and fetal tissues (brain, kidney,
thymus, liver), and rather weakly in placenta, lung, aorta,

amygdala, occipital and parietal lobe and salivary gland.
Almost no expression was observed in fetal lung and heart,
uterus, bladder, kidney, duodenum, trachea, Burkitt’s lym-
phoma, and colorectal adenocarcinoma. These data lead us to
the conclusion that hST6Gal II gene is weakly expressed in
a very restricted manner, which is in contrast to hST6Gal I
which is expressed in most of human tissues [39].
Expression of a recombinant hST6Gal II
In order to facilitate functional analysis of the enzyme, a
truncated cDNA of hST6Gal II lacking the first 33 amino
acids of N-terminus region was generated by PCR from
the human cDNA clone AB058780. The putative catalytic
domainwasfusedtoaFlag octapeptide (DYKDDDDK)
and transiently expressed in COS-7 cells. This construction
including a preprotrypsin signal produced a soluble form
of the enzyme secreted from the cells. This soluble Flag-
ST6Gal II fusion protein produced in cell culture media
was concentrated on CMP-agarose beads, subjected to
SDS/PAGE and Western blotting and visualized as a
70 kDa band (Fig. 5). A smaller 40 kDa band was also
observed, probably as the result of proteolytic degradation
in the cell culture medium. To monitor the activity of the
soluble form of hST6Gal II, media from cells transfected
with pFlag-sST6Gal II or control plasmid were collected
after 3 days of transfection and assayed for sialyltrans-
ferase activity, using various acceptor substrates (Table 1).
We also simultaneously carried out the same enzymatic
Fig. 3. Dendrogram of the cloned human sialyltransferases. The
deduced amino-acid sequences of the catalytic domain (starting 10
amino-acidsupstreamofthesialylmotifL)oftheclonedhumansia-

lyltransferases were aligned by
CLUSTAL W
and the corresponding
phylogenetic tree was constructed using the neighbour-joining method.
Fig. 2. Comparison of the genomic structure
the human ST6Gal I and ST6Gal II genes.
(A) Exon structure of hST6Gal I and
hST6Gal II genes are represented by boxes
and are denoted E1 to E5. Darkened boxes
with their size (in bp) indicated above, repre-
sent the protein coding sequences and opened
boxes represent untranslated sequences. Solid
lines between the exons represent the intron
sequences (not drawn to scale); their sizes are
indicated below. (B) Comparison of the
deduced amino acid sequence of the
hST6Gal II gene with those of the hST6Gal I
gene.
Ó FEBS 2003 Characterization of the human ST6Gal II (Eur. J. Biochem. 270) 955
assay with a recombinant soluble form of hST6Gal I
produced in the Sf9 cells. hST6Gal II was shown to be able
to transfer a sialic acid residue onto a terminal Gal residue
of asialofetuin and asialo-a
1
-acid glycoprotein. As shown
in Table 1, the best acceptor substrate of hST6Gal II was
thefreedisaccharideGalb1–4GlcNAc, lacto-N-neotetraose
and Galb1–4GlcNAcb-O-octyl whereas hST6Gal I pre-
ferred Galb1–4GlcNAc-R disaccharide linked to a protein
as found in asialo-a

1
-acid glycoprotein. No significant
activity was observed towards sialylated glycoproteins such
as native fetuin and a
1
-acid glycoprotein, or type 1
containing structures such as Galb1–3GlcNAc, Galb1–
3GlcNAcb-O-octyl or lacto-N-tetraose.
The kinetic parameters of hST6Gal II were determined
using CMP-Neu5Ac as the donor substrate, and using
Galb1–4GlcNAcb-O-octyl and asialo-a1-acid glycoprotein
as the acceptor substrates. The apparent K
m
value of
hST6Gal II for CMP-Neu5Ac (59 l
M
)wasverycloseto
those previously described for native or recombinant
hST6Gal I which range from 33 to 50 l
M
[40,41]. The
apparent K
m
value for asialo-a
1
-acid glycoprotein (0.12 m
M
)
was also in the same range than that determined for the
recombinant hST6Gal I (0.10 m

M
) [41]. On the other hand,
the apparent K
m
value of hST6Gal II for Galb1–4GlcNAcb-
O-octyl was 0.74 m
M
, which is significantly lower than the
values determined for native (1.78 m
M
) or recombinant
(2.38 m
M
)ST6GalIusingGalb1–4GlcNAc [41].
Fig. 4. hST6Gal II gene expression in various human tissues.
(A) Northern blot analysis. Commercially prepared Northern blot
(Clontech) with 1 lgpoly(A)
+
RNA from various adult human tis-
sues were probed with a 1.6 kb
32
P-random-labelled hST6Gal II
cDNA as described in the Materials and methods section and a 1.8 kb
human b-actin cDNA control probe (upper and lower panels,
respectively). RNA size marker bands are indicated on the left side of
the blot. Sizes of the detected mRNA are indicated on the right.
(B) Expression array analysis of the expression of hST6Gal II in
various human tissues. Commercially prepared Multiple Tissue
Expression (Clontech) array with poly(A
+

) RNA from 72 different
human tissues and eight different control RNAs and DNAs was
probed with
32
P-random-labelled hST6Gal II cDNA.
Fig. 5. Immunoblotting of hST6Gal II recombinant protein from
transfected cell culture media. Cell culture media from pFlag-
sST6Gal II and mock-transfected cells (48 h after transfection) were
incubated with CMP-Agarose beads. The beads were washed, boiled
and subjected to SDS/PAGE under reduced conditions and Western
blotting using the BioM2 anti-Flag mAb. The positions of the high
range prestained SDS/PAGE standards are indicated in KDa on the
left side of the figure. Lane 1, 50 lL from mock transfected cells;
lane 2, 50 lL from pFlag/ST6Gal-II transfected cells.
956 M A. Krzewinski-Recchi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Linkage analysis
To determine the incorporated sialic acid linkage, sialidase
digestions of asialo-a
1
-acid-glycoprotein, sialylated with
either hST6Gal II, hST6Gal I, or hST3Gal III, and subse-
quent electrophoresis of the digested products were per-
formed. As shown in Fig. 6, the incorporated
14
C-labelled
sialic acid was resistant to treatment with a2,3-specific
sialidase compared to asialo-a
1
-acid-glycoprotein sialylated
with ST3Gal III used as a positive control of the NANase I

specific action. The radioactive material was completely
removed upon treatment with a2,3/6-sialidase or a2,3/6/8-
sialidase, indicating that the product formed is indeed
NeuAca2–6Gal.
ST6Gal II induces the expression of NeuAca2–6Gal
structures at the cell surface of transfected cells
In order to visualize a phenotypic change in the hST6Gal II
expressing cells, the full-length ORF of hST6Gal II was
inserted in the pFlag expression vector and transfected into
CHO or COS-7 cells. Forty-eight hours after transfection,
cells were incubated with digoxigenin-labelled S. nigra
agglutinin, a lectin that recognized NeuAca2–6Gal/GalNAc
structures, and revealed with an anti-digoxigenin fluoresc-
ein-labelled Fab fragment. A negative control without lectin
was also performed. As observed by confocal microscopy
(Fig. 7), hST6Gal II induces the over-expression of Neu-
Aca2–6Gal structures at the cell surface of transfected CHO
cells whereas mock transfected cells weakly expressed
NeuAca2–6Gal. No fluorescence was detected in the
control, indicating the specificity of the fluorescence detec-
tion. The same result was also obtained with COS-7 cells
(data not shown).
Discussion
The ST6Gal subfamily
Unlike all the other sialyltransferases cloned to date and
characterized [36], ST6Gal I was so far the unique member
of the b-galactoside a2,6-sialyltransferase subfamily to be
identified. This unique gene is widely expressed in human
tissues and the enzyme is mainly involved in the a6-sialy-
lation of membrane and secreted glycoproteins. However,

other b-galactoside a2,6-sialyltransferases with different
Fig. 6. Analysis of linkage specificity of hST6Gal II. [
14
C]Neu5Ac-
labelled asialo-a
1
-acid glycoprotein was produced using soluble recom-
binant ST6Gal II, ST6Gal I or ST3Gal III. The sialylated labelled
products were subjected to sialidase treatment with NANase I (specific
for a2–3-linked sialic acid, lane 2), or NANase II (specific for a2–3/
6-linked sialic acids, lane 3), or NANase III (specific for a2–3/6/8/
9-linked sialic acids, lane 4), or none (lane 1). The resulting products
were separated on SDS/PAGE and detected by radio-imaging.
Table 1. Comparison of the acceptor substrate specificity of ST6Gal I and ST6Gal II. Acceptor substrates were used at a concentration of 1 m
M
for
arylglycosides and 2 mgÆml
-1
for glycoproteins. Relative rates are calculated as a percentage of the incorporation of sialic acid onto asialo-a
1
-acid
glycoprotein. A value of 0 indicates less than 0.4 %. d bn, benzyl; pNp, para-nitrophenol.
Acceptor Structures
Relative rate (%)
hST6Gal II hST6Gal I
Asialo-a
1
-acid glycoprotein Galb1-4GlcNAc-R
a
100 (0.52)

b
100 (13.86)
b
a
1
-Acid glycoprotein NeuAca2-6Galb1-4GlcNAc-R 00
Fetuin NeuAca2-3Galb1-3GalNAca1-O-Ser/Thr
c
0 1.4
NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thr
c
NeuAca2-6(3)Galb1-4GlcNAc-R
c
Asialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83
Galb1-4GlcNAc-R
Arylglycosides Gala1-O-pNp 8 0.6
GalNAca1-O-pNp 5.3 0.6
GlcNAca1-O-pNp 8.2 0.4
Galb1-4GlcNAcb-O-octyl 259 72
Galb1-3GlcNAcb-O-octyl 0 2.5
Galb1-3GalNAca1-O-bn 0 0.7
Oligosaccharides Galb1-4GlcNAc 692 87
Galb1-3GlcNAc 0 0
LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc 623 120
LNT: Galb1-3GlcNAcb1-3Galb1-4Glc 0 0
a
Rrepresents the remainder of the N-linked oligosaccharide chain.
b
Actual activities are shown in brackets in pmolÆh
)1

ÆlL
)1
.
c
Data from
Spiro & Bhoyroo [50].
Ó FEBS 2003 Characterization of the human ST6Gal II (Eur. J. Biochem. 270) 957
substrate specificity or preferences were expected to exist to
account for the presence 6-sialylated oligosaccharides such
as 6¢-sialyl-lactose, sialyl-lactosamine or sialyl-lacto-N-neo-
tetraose found in human milk [42,43], monosialylgan-
glioside NeuAca2–6Galb1–4GlcNAcb1–3Galb1–4Glc-Cer
immunostained in human meconium or NeuAca2–6Gal-
NAcb1–4GlcNAc structures found on pituitary hormones.
As the human genome is being deciphered, we gain access to
a large number of sialyltransferase-gene related sequences
through screening of the databanks. This strategy allowed
us to identify a new human sialyltransferase gene located on
chromosome 2 with high similarity to hST6Gal I located on
chromosome 3, both in terms of gene organization and
sequence. Our data clearly indicate that these two genes may
have a common ancestral gene and after dispersion in the
human genome would have evolved independently. From
an evolutionary point of view, we could also identify the rat
homologue of this new gene (in genomic clones AC094827
and AC106335; data not shown), and also the mouse
homologue located on mouse chromosome 17 (XM140080).
Several EST (BU055532, BB651169, BB552328) expressed
either in the neonate cerebellum or in pregnant mouse
oviduct were assembled and the corresponding protein

sequence deduced. A protein sequence comparison of the
two homologues is shown in Fig. 8, which indicates 77%
identity between them. Two cDNAs corresponding to
partial mRNAs were also found in the zebra fish databanks
(BE606075, BM103887) which suggest that this ST6Gal II
protein appeared early in the evolution.
Sequence analysis
Sequence analysis of the deduced protein showed that this
protein has one of the longest stem region (around 200
amino acid residues) whereas the size of the catalytic
domain is conserved among the different sialyltransferases.
It is interesting to note that hST6Gal II protein shared 48%
overall identity with hST6Gal I and even higher identities
within the sialylmotifs, with 67%, 56% and 90% identity
for the L, S and VS motif, respectively. In the catalytic
domain, hST6Gal II protein shows six cysteine residues that
are strictly conserved in hST6Gal I protein. Ma and Colley
(1996) [44] have described formation of a disulfide-bonded
dimer of ST6Gal I that is catalytically inactive but retains its
ability to bind galactose. The presence of a faint band
around 140 kDa in Fig. 5 suggests that this dimerization
may also occur for hST6Gal II. Human ST6Gal II protein
shows also three potential N-glycosylation sites, two of
which lie within the sialylmotif L (Fig. 1). These two sites
are conserved in the mouse ST6Gal II protein whereas the
third-one, located in the stem region, is missing. The
influence of N-glycosylation on the activity and trafficking
of ST6Gal I has been previously investigated [45]. It appears
that these N-glycosylation sites are required for the activity
and endoplasmic reticulum to Golgi transport of the soluble

form of ST6Gal I. However, the position of these glycosy-
lation sites is not conserved in ST6Gal II. In addition, we
have shown that the soluble hST6Gal II recombinant
protein is secreted in the culture medium of COS-7 cells as
a 70 kDa polypeptide (Fig. 5). Taking into account the
expected molecular mass of the nonglycosylated polypep-
tide (58 kDa), we can predict that these N-glycosylation
sites are occupied. Further analyses will be required to
determine whether or not the N-glycosylation could influ-
ence ST6Gal II activity.
Gene expression pattern
The results of Northern and expression array analyses
clearly indicated a restricted and low level expression of
hST6Gal II gene as an 8 kb transcript mainly in brain,
which is in accordance with the size of the cDNA clone
AB058780 (6.782 kb). It was found also in specific regions
of the brain: hippocampus and amygdala of the limbic
Fig. 7. S. nigra agglutinin staining of CHO/hST6Gal II transfected cells. CHO cells were transiently transfected with pFlag-wST6Gal II vector
encoding the full length ORF of hST6Gal II cDNA or with the pFlag vector by means of LipofectAMINE-reagent plus. Expression of NeuAca2–
6Gal was detected using digoxigenin-labelled S. nigra agglutinin and an anti-digoxigenin-fluorescein Fab fragment, and the fluorescence was
detected by confocal microscopy. (A) CHO/pFlag-wST6Gal II cells, (B) CHO/pFlag cells, (C) CHO cells anti-digoxigenin-fluorescein Fab frag-
ment.
958 M A. Krzewinski-Recchi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
system, caudate nucleus and the cerebral cortex temporal
lobe. Very low levels of mRNA were detected also in lymph
node, testis, thyroid gland and fetal tissues. This low and
restricted level of expression is in agreement with the little
number of ST6Gal II EST in databanks. This is in contrast
to the expression pattern of the ST6Gal I gene, which is
abundantly expressed in almost all human tissues examined,

including fetal tissues but with the notable exceptions of
testis and brain [39] where it is expressed at lower levels. One
can postulate that expression of ST6Gal II in these two
tissues could compensate for the lower expression of
ST6Gal I or be responsible for the specific synthesis of
a6-sialylated glycoconjugates. We also identified two
upstream untranslated exons, exon A (119 bp) found in
the EST BE613250 and located 42 941 bp upstream the first
coding exon, and exon B (62 bp) found in the mRNA
sequence AB058780 and located 42 058 bp upstream the
first coding exon (data not shown). The hST6Gal II gene
would thus drive the expression of at least two individual
mRNAs through the use of two distinct promoters. Very
preliminary analysis of the two upstream genomic sequences
identified in the databanks indicated the presence potential
trans-acting factors binding sites such as SP1 and TBP
binding sites found upstream exon B. This finding would
argue for a ubiquitous and low-level expression of exon B
containing transcripts. On the other hand, the presence of
CREB and SREBP binding sites upstream exon A
would indicate a specific expression of exon A containing

Fig. 8. Comparison of the putative amino-acid sequence of hST6Gal II and mST6Gal II. The two vertical dots indicate identical amino acid residues
and single dots indicate similar amino-acid residues. The underlined amino acid residues indicate the sialylmotifs L, S and VS. Putative conserved
N-glycosylation site (N-X-S/T) are marked with asterisks (*).
Ó FEBS 2003 Characterization of the human ST6Gal II (Eur. J. Biochem. 270) 959
transcripts in brain and fetal tissues. Future transcriptional
regulation studies will help elucidate the biological signifi-
cance of each transcript.
Expression and specific activity of hST6Gal II

The acceptor substrate specificity of ST6Gal II was deter-
mined using a Flag-tagged soluble form of the enzyme
missing the first 33 amino-acids. The results of the
enzymatic assays clearly suggested a narrow activity of
hST6Gal II in transferring sialic acid residues in the
6-position of the Gal residue of the Galb1–4GlcNAc
disaccharide, exclusively. Although active with asialo-
glycoproteins, hST6Gal II showed a higher activity towards
arylglycosides and above all onto free oligosaccharides. In
particular, the K
m
value determined using Galb1–4Glc-
NAcb-O-octyl (0.74 m
M
) was significantly lower than the
value determined for native (1.78 m
M
) or recombinant
(2.38 m
M
) ST6Gal I [41]. These results raised the question
of the biological significance of the presence of a second
Galb1–4GlcNAc a2,6-sialyltransferase preferentially acting
onto free oligosaccharides since hST6Gal I showed also
activities towards these substrates (Table 1). The release of
free 6-sialylated oligosaccharides in human milk is known
for a long time (reviewed in [46]) and previous reports
described elevated mammary gland sialyltransferase activity
accompanying lactation [47]. More recently, Dalziel et al.
(2001) [48] described an ST6Gal I mRNA induction

mediated by recruitment of a novel 5¢ untranslated exon
probably driven by a lactogenic promoter. Our future
studies will aim to refine ST6Gal II gene expression in
various free 6-sialylated oligosaccharides producing tissues
such as lactating mammary gland but also to refine
ST6Gal II enzymatic activity towards substrate acceptors
such as GalNAcb1–4GlcNAc or glycolipids.
In order to shed light on the biological function of
ST6Gal II, in vivo activity of ST6Gal II was assessed
through transient transfection of CHO cells and COS-7
cells with the full-length ST6Gal II cDNA. Significant
changes in the sialylation pattern of cell surface glycocon-
jugates were observed through the use of S. nigra agglutinin.
Western blot analysis of ST6Gal II transfected CHO cells
has also shown that only a small number of glycoproteins
exhibit a modified sialylation profile (data not shown). This
observation lent support to the conclusion that this
b-galactoside a2,6-sialyltransferase generated NeuAca2–
6Galb1–4GlcNAc epitopes and may have very specific
glycoproteins or glycolipids substrate acceptors, which our
future studies will aim to determine. The presence of this
new b-galactoside a2,6-sialyltransferase ST6Gal II will shed
new light onto previous studies conducted with ST6Gal I.
Acknowledgements
The authors are very thankful to Dr Claudine Auge
´
(URA CNRS 462,
Orsay, France), Drs Ge
´
rard Strecker and Fre

´
de
´
ric Chirat (UMR
CNRS-USTL 8576, Villeneuve d’Ascq, France) for the generous gift of
acceptor substrates and to Prof. J. C. Paulson for the kind gift of
ST3N-1 clone. The University of Sciences and Technologies of Lille, the
European Carbohydrate Research Network GlycoTrain, the CNRS
Re
´
seau >G3, and the Association pour la Recherche sur le Cancer
(grant no. 5469) have supported this work.
References
1. Varki, A. (1993) Biological roles of oligosaccharides: all of the
theories are correct. Glycobiology 3, 97–130.
2. Kelm, S. & Schauer, R. (1997) Sialic acids in molecular and cel-
lular interactions. Int. Rev. Cytol. 175, 137–240.
3. Harduin-Lepers, A., Recchi, M.A. & Delannoy, P. (1995) 1994,
the year of sialyltransferases. Glycobiology 5, 5741–5758.
4. Varki, A. (1994) Selectin ligands. Proc.NatlAcad.Sci.USA91,
7390–7397.
5. Schauer, R. (2000) Biochemistry of sialic acid diversity. In
Carbohydrates in Chemistry and Biology Part II, Biology of the
Saccharides, V (Ernst,B.,Hart,G.W.&Sinay,P.,eds),Vol.3,
pp. 227–243. Wiley-VCH, Wienhein, Germany.
6. Vallejo, V., Reyes-Leyva, J., Hernandez, J., Ramirez, H., Delan-
noy, P. & Zenteno, E. (2000) Differential expression of sialic acid
on porcine organs during the maturation process. Comp. Biochem.
Phys. B126, 415–424.
7. Hakomori, S.I. (1991) Possible functions of tumor-associated

carbohydrate antigens. Curr. Opin. Immunol. 3, 646–653.
8. Finne, J., Finne, U., Deagostini-Bazin, H. & Goridis, C. (1983)
Occurrence of a2–8 linked polysialosyl units in a neural cell
adhesion molecule. Biochem. Biophys. Res. Commun. 112, 482–
487.
9. Gyorgy, P., Jeanloz, R.W., von Nicolai, H. & Zilliken, F. (1974)
Undialyzable growth factors for Lactobacillus bifidus var. penn-
sylvanicus. Protective effect of sialic acid bound to glycoproteins
and oligosaccharides against bacterial degradation. Eur. J. Bio-
chem. 43, 29–33.
10. Prieto, P.A. & Smith, D.F. (1985) A new ganglioside in human
meconium detected by antiserum against the human milk sialy-
loligosaccharide, LS-tetrasaccharide b. Arch. Biochem. Biophys.
241, 281–289.
11. Green, E.D. & Baenziger, J.U. (1988) Asparagine-linked oligo-
saccharides on lutropin, follitropin, and thyrotropin. I. Structural
elucidation of the sulfated and sialylated oligosaccharides on
bovine, ovine, and human pituitary glycoprotein hormones. J.
Biol. Chem. 263, 25–35.
12. Harduin-Lepers, A., Vallejo-Ruiz, V., Krzewinski-Recchi, M.A.,
Samyn-Petit, B., Julien, S. & Delannoy, P. (2001) The human
sialyltransferase family. Biochimie 83, 727–737.
13. Coutinho, P.M. & Henrissat, B. (1999) Carbohydrate-active
enzymes: an integrated database approach. In Recent Advances in
Carbohydrate Bioengineering (Gilbert, H.J., Davies, G., Henrissat,
B. & Svensson, B., eds), pp. 3–12. The Royal Society of Chemistry,
Cambridge, UK.
14. Paulson, J.C., Weinstein, J. & Schauer, A. (1989) Tissue-specific
expression of sialyltransferases. J. Biol. Chem. 264, 10931–10934.
15. Datta, A.K. & Paulson, J.C. (1995) The sialyltransferase Ôsialyl-

motifÕ participates in binding the donor substrate CMP-NeuAc.
J. Biol. Chem. 270, 1497–1500.
16. Datta, A.K., Sinha, A. & Paulson, J.C. (1998) Mutation of the
sialyltransferase S-sialylmotif alters the kinetics of the donor and
acceptor substrates. J. Biol. Chem. 273, 9608–9614.
17. Geremia, R.A., Harduin-Lepers, A. & Delannoy, P. (1997) Iden-
tificationoftwonovelconservedaminoacidresiduesineukaryotic
sialyltransferases; implications for their mechanism of action.
Glycobiology 7, 5–7.
18. Paulson, J.C., Rearick, J.I. & Hill, R.L. (1977) Enzymatic prop-
erties of b-
D
-galactoside a2 leads to 6 sialytransferase from bovine
colostrum. J. Biol. Chem. 252, 2363–2371.
19. Nemansky, M. & Van den Eijnden, D.H. (1992) Bovine colostrum
CMP-NeuAc: Gal b (1–4) GlcNAc-R. a(2–6)-sialyltransferase is
involved in the synthesis of the terminal NeuAca (2–6) GalNAcb
(1–4) GlcNAc sequence occurring on N-linked glycans of bovine
milk glycoproteins. Biochem. J. 287, 311–316.
960 M A. Krzewinski-Recchi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
20. Mercier, D., Wierinckx, A., Oulmouden, A., Gallet, P.F., Palcic,
M.M.,Harduin-Lepers,A.,Delannoy,P.,Petit,J.M.,Leveziel,H.
& Julien, R. (1999) Molecular cloning, expression and exon/intron
organization of the bovine b-galactoside a2,6-sialyltransferase
gene. Glycobiology 9, 851–863.
21. Weinstein,J.,Lee,E.U.,McEntee,K.,Lai,P.H.&Paulson,J.C.
(1987) Primary structure of b-galactoside a2,6-sialyltransferase.
Conversion of membrane-bound enzyme to soluble forms by
cleavage of the NH
2

-terminal signal anchor. J. Biol. Chem. 262,
17735–17743.
22. Grundmann, U., Nerlich, C., Rein, T. & Zettlmeissl, G. (1990)
Complete cDNA sequence encoding human b-galactoside a-2,6-
sialyltransferase. Nucleic Acids Res. 18, 667.
23. Hamamoto, T., Kawasaki, M., Kurosawa, N., Nakaoka, T., Lee,
Y.C. & Tsuji, S. (1993) Two step single primer mediated poly-
merase chain reaction. Application to cloning of putative mouse,
b-galactoside a2,6-sialyltransferase cDNA. Bioorg. Med. Chem. 1,
141–145.
24. Kurosawa, N., Kawasaki, M., Hamamoto, T., Nakaoka, T., Lee,
Y.C., Arita, M. & Tsuji, S. (1994) Molecular cloning and
expression of chick embryo Gal b1,4GlcNAc a2,6-sialyltrans-
ferase. Comparison with the mammalian enzyme. Eur. J. Biochem.
219, 375–381.
25. Lo, N.W. & Lau, J.T. (1996) Transcription of the b-galactoside
a2,6-sialyltransferase gene in B-lymphocytes is directed by a sep-
arate and distinct promoter. Glycobiology 6, 271–279.
26. Taniguchi, A., Hasegawa, Y., Higai, K. & Matsumoto, K. (2000)
Transcriptional regulation of human b-galactoside a2,6-sialyl-
transferase (hST6Gal I) gene during differentiation of the HL-60
cell line. Glycobiology 10, 623–628.
27. Dalziel, M., Lemaire, S., Ewing, J., Kobayashi, L. & Lau, J.T.
(1999) Hepatic acute phase induction of murine b-galactoside a2,6
sialyltransferase (ST6Gal I) is IL-6 dependent and mediated by
elevation of exon H-containing class of transcripts. Glycobiology
9, 1003–1008.
28. Lo, N.W., Dennis, J.W. & Lau, J.T. (1999) Overexpression of the
a2,6-sialyltransferase, ST6Gal I, in a low metastatic variant of a
murine lymphoblastoid cell line is associated with appearance of a

unique ST6Gal I mRNA. Biochem. Biophys. Res. Commun. 264,
619–621.
29. Dall’Olio, F., Chiricolo, M., Ceccarelli, C., Minni, F., Marrano,
D. & Santini, D. (2000) b-galactoside a2,6 sialyltransferase in
human colon cancer: contribution of multiple transcripts to
regulation of enzyme activity and reactivity with Sambucus nigra
agglutinin. Int. J. Cancer 88, 58–65.
30. Samyn-Petit, B., Krzewinski-Recchi, M A., Steelant, W.F.A.,
Delannoy, P. & Harduin-Lepers, A. (2000) Molecular cloning and
functional expression of human ST6GalNAc II. Molecular
expression in various human cultured cells. Biochim. Biophys. Acta
1474, 201–211.
31. Wen, D.X., Livingston, B.D., Medzihradszky, K.F., Kelm, S.,
Burlingame, A.L. & Paulson, J.C. (1992) Primary structure of
Galb1,3(4) GlcNAc a2,3-sialyltransferase determined by mass
spectrometry sequence analysis and molecular cloning. Evidence
for a protein motif in the sialyltransferase gene family. J. Biol.
Chem. 267, 21011–21019.
32. O’Reilly, D.R. & Miller, L.K. (1989) A baculovirus blocks insect
molting by producing ecdysteroid UDP-glucosyl transferase.
Science 245, 1110–1112.
33. Misse
´
,D.,Ce
´
rutti, M., Schmidt, I., Jansen, A., Devauchelle, G.,
Jansen, F. & Veas, F. (1998) Dissociation of the CD4 and CXCR4
binding properties of human immunodeficiency virus type 1 gp120
by deletion of the first putative alpha-helical conserved structure.
J. Virol. 72, 7280–7288.

34. Felgner, P.L. & Ringold, G.M. (1989) Cationic liposome-medi-
ated transfection. Nature 337, 387–388.
35. Giordanengo, V., Bannwarth, S., Laffont, C., Van Miegem, V.,
Harduin-Lepers, A., Delannoy, P. & Lefebvre, J C. (1997)
Cloning and expression of cDNA for a human Gal (b1–3) Gal-
NAc a2,3-sialyltransferase from the CEM T-cell line. Eur J. Bio-
chem. 247, 558–566.
36. Harduin-Lepers, A., Stokes, D.C., Steelant, W.F., Samyn-Petit,
B.,Krzewinski-Recchi,M A.,Vallejo-Ruiz,V.,Zanetta,J P.,
Auge
´
, C. & Delannoy, P. (2000) Cloning, expression and gene
organization of a human Neu5Aca2–3Galb1–3GalNAc a2,6-
sialyltransferase: hST6GalNAc IV. Biochem. J. 352, 37–48.
37. Weinstein, J., de Souza-e., -Silva, U. & Paulson, J.C. (1982) Sia-
lylation of glycoprotein oligosaccharides N-linked to asparagine.
Enzymatic characterization of a Galb1–3 (4) GlcNAc a2,3-sial-
yltransferase and a Galb1–4GlcNAc a2,6-sialyltransferase from
rat liver. J. Biol. Chem. 257, 13845–13853.
38. Nagase, T., Nakayama, M., Nakajima, D., Kikuno, R. & Ohara,
O. (2001) Prediction of the coding sequences of unidentified
human genes. The complete sequences of 100 new cDNA clones
from brain which code for large proteins in vitro. DNA Res. 8, 85–95.
39. Kitagawa, H. & Paulson, J.C. (1994) Differential expression of five
sialyltransferase genes in human tissues. J. Biol. Chem. 269, 17872–
17878.
40. Gross, H.J., Rose, U., Krause, J.M., Paulson, J.C., Schmid, K.,
Feeney,R.E.&Brossmer,R.(1989)Transferofsyntheticsialic
acid analogues to N- and O-linked glycoprotein glycans using four
different mammalian sialyltransferases. Biochemistry 28, 7386–

7392.
41. Williams, M.A., Kitagawa, H., Datta, A.K., Paulson, J.C. &
Jamieson, J.C. (1995) Large-scale expression of recombinant sia-
lyltransferases and comparison of their kinetic properties with
native enzymes. Glycoconj. J. 12, 755–761.
42. Nakano, T., Sugawara, M. & Kawakami, H. (2001) Sialic acid in
human milk: composition and functions. Acta Paediatr. Taiwan
42, 11–17.
43. Smith, D.F. & Ginsburg, V. (1980) Antibodies against sialyl-
oligosaccharides coupled to protein. J. Biol. Chem. 255, 55–59.
44. Ma, J. & Colley, K.J. (1996) A disulfide-bonded dimer of the
Golgi b-galactoside a2,6-sialyltransferase is catalytically inactive
yet still retains the ability to bind galactose. J. Biol. Chem. 271,
7758–7766.
45. Chen, C. & Colley, K.J. (2000) Minimal structural and glycosy-
lation requirements for ST6Gal I activity and trafficking. Glyco-
biology 10, 531–583.
46. Rivero-Urgell, M. & Santamaria-Orleans, A. (2001) Oligo-
saccharides: application in infant food. Early Hum. Dev. 65,S43–
S52.
47. Bushway, A.A., Park, C.S. & Keenan, T.W. (1979) Effect of
pregnancy and lactation on glycosyltransferase activities of rat
mammary gland. Int. J. Biochem. 10, 147–154.
48. Dalziel, M., Huang, R.Y., Dall’Olio, F., Morris, J.R., Taylor-
Papadimitriou, J. & Lau, J.T. (2001) Mouse ST6Gal sialyl-
transferase gene expression during mammary gland lactation.
Glycobiology 11, 407–412.
49. Cserzo, M., Wallin, E., Simon, I., von Heijne, G. & Elofsson, A.
(1997) Prediction of transmembrane alpha-helices in prokaryotic
membrane proteins: the dense alignment surface method. Protein

Eng. 10, 673–676.
50. Spiro, R.G. & Bhoyroo, V.D. (1974) Structure of the O-glycosi-
dically linked carbohydrate units of fetuin. J. Biol. Chem. 249,
5703–5717.
Ó FEBS 2003 Characterization of the human ST6Gal II (Eur. J. Biochem. 270)961