Báo cáo khoa học: Outer sphere mutagenesis of Lactobacillus plantarum manganese catalase disrupts the cluster core pptx

Outer sphere mutagenesis of
Lactobacillus plantarum
manganese
catalase disrupts the cluster core
Mechanistic implications
Mei M. Whittaker
1
, Vladimir V. Barynin
2,3
, Takao Igarashi
1
and James W. Whittaker
1
1
Department of Environmental and Biomolecular Systems, OGI School of Science and Engineering at OHSU, Oregon;
2
The Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, Sheffield;
3
The Institute of Crystallography, Russian Academy of Sciences, Moscow, Russia
X-ray crystallography of the nonheme manganese catalase
from Lactobacillus plantarum (LPC) [Barynin, V.V., Whit-
taker, M.M., Antonyuk, S.V., Lamzin, V.S., Harrison,
P.M., Artymiuk, P.J. & Whittaker, J.W. (2001) Structure 9,
725–738] has revealed the structure of the dimanganese
redox cluster together with its protein environment. The
oxidized [Mn(III)Mn(III)] cluster is bridged by two solvent
molecules (oxo and hydroxo, respectively) together with a
l
1,3
bridging glutamate carboxylate and is embedded in a
web of hydrogen bonds involving an outer sphere tyrosine

residue (Tyr42). A novel homologous expression system has
been developed for production of active recombinant LPC
and Tyr42 has been replaced by phenylalanine using site-
directed mutagenesis. Spectroscopic and structural studies
indicate that disruption of the hydrogen-bonded web signi-
ficantly perturbs the active site in Y42F LPC, breaking one
of the solvent bridges and generating an ÔopenÕ form of the
dimanganese cluster. Two of the metal ligands adopt alter-
nate conformations in the crystal structure, both conformers
having a broken solvent bridge in the dimanganese core. The
oxidized Y42F LPC exhibits strong optical absorption
characteristic of high spin Mn(III) in low symmetry and
lower coordination number. MCD and EPR measurements
provide complementary information defining a ferromag-
netically coupled electronic ground state for a cluster con-
taining a single solvent bridge, in contrast to the diamagnetic
ground state found for the native cluster containing a pair of
solvent bridges. Y42F LPC has less than 5% of the catalase
activity and much higher K
m
for H
2
O
2
(%1.4
M
)atneutral
pH than WT LPC, although the activity is slightly restored at
high pH where the cluster is converted to a diamagnetic
form. These studies provide new insight into the contribu-

tion of the outer sphere tyrosine to the stability of the
dimanganese cluster and the role of the solvent bridges in
catalysis by dimanganese catalases.
Keywords: manganese; redox; catalase; spectroscopy; X-ray
structure.
Catalases (E.C. 1.11.1.6) are antioxidant defence enzymes
that catalyze the redox disproportionation of the toxic
oxygen metabolite, hydrogen peroxide, into dioxygen and
water [1]. Two distinct families of catalases are known,
differing in both the architecture of the folded protein and
in the nature of the catalytic redox cofactor, heme iron or
nonheme manganese. While the heme-containing catalase
family has been well characterized both structurally [2,3]
and biochemically [4], the alternative, nonheme dimanga-
nese catalases or ÔpseudocatalasesÕ are less extensively
studied, although they appear to be widespread among
prokaryotes. Manganese catalases have been isolated from
bacteria (Thermus thermophilus [5], Thermoleophilum album
[6], and Lactobacillus plantarum [7,8]) and a hyperthermo-
philic archeon (Pyrobaculum caldifontis [9]). X-ray crystal
structures have been reported recently for the enzymes
from T. thermophilus (TTC) [10] and L. plantarum (LPC)
[11]. Both enzymes are hexamers of identical subunits
organized around a catalytic core of close-packed four-
helix bundle domains. Each of these coiled-coil domains
binds two manganese ions forming novel redox-active
binuclear manganese complexes that serve as the catalytic
active sites.
The dimanganese complexes of LPC and TTC are
templated by their environment in the protein, being

bound by five amino acid side chains arising within the
four-helix bundles (Fig. 1). A l
1,3
-bridging glutamate
carboxylate (Glu66, LPC numbering) anchors the two
ions in the binuclear cluster (Fig. 2). Each Mn ion is further
coordinated by one histidine (His69 to Mn1 and His181 to
Mn2) and one glutamate (Glu35 to Mn1 and Glu148 to
Mn2) bound to opposite faces of the cluster, and the
manganese core is completed by two solvent-derived l
1,1
Correspondence to J. W. Whittaker, Department of Environmental
and Biomolecular Systems, OGI School of Science and Engineering
at OHSU, 20000 NW. Walker Road, Beaverton, Oregon 97006.
Fax: + 1 503 748 1464; Tel.: + 1 503 748 1065;
E-mail:
Abbreviations: LPC, Lactobacillus plantarum manganese catalase;
TTC, Thermus thermophilus manganese catalase; LT-MCD, low
temperature magnetic circular dichroism; MCD, magnetic circular
dichroism; MPD, 2-methyl-2,4-pentanediol; ABS, optical absorption.
Enzyme: catalases (E.C. 1.11.1.6).
Note: Atomic coordinates for Y42F and Lactobacillus plantarum
manganese catalase have been deposited in the Protein Data Bank
(accession number, 1O9I).
(Received 24 September 2002, revised 15 December 2002,
accepted 10 January 2003)
Eur. J. Biochem. 270, 1102–1116 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03459.x
oxygen atom bridges. Analysis of the metal-ligand bond
distances and hydrogen-bonding patterns in the crystalline
complex shows that the two solvent bridges are structurally

distinct, one (W2, trans to the coordinated histidine
imidazoles) occurring as a protonated (aquo/hydroxo)
group in the oxidized (3,3) state of the cluster, while the
other (W1, trans to the pair of coordinated carboxylates)
occurs as an unprotonated oxo ion (O
2–
). The glutamate
coordinated to the Mn2 subsite is bidentate in LPC,
chelating the metal center, while the Mn1 subsite has a
monodentate glutamate ligand which allows a third,
terminal solvent molecule to bind in the apical position.
A nonligating glutamate Glu178 is poised above the
cluster, forming a hydrogen bond to the apical water.
The binuclear active site is embedded in a web of
hydrogen bonds that radiate from the metal cluster into the
outer sphere protein environment. Arg147 anchors a
network of hydrogen bonds on the side trans to the
coordinated histidines, with the guanidinium NH2 group
bound to Glu148 and the bridging hydroxide (W2), while
the guanidinium NH1 is hydrogen bonded to Glu35. In
addition, the phenolic hydroxyl of Tyr42 is a hydrogen
bond acceptor to the NE of Arg147 and a donor to Glu148.
The arginine residue is unique to LPC but the same
hydrogen bonding pattern involving tyrosine and a gluta-
mate ligand is observed in TTC [10] and corresponding
residues can be identified in a number of sequence homologs
[11], suggesting that this interaction is a conserved feature of
manganese catalase structures.
This conserved outer sphere interaction between a
tyrosine residue and a glutamate ligand is particularly

interesting in the context of related motifs that are
important functional elements in other, more distantly
related enzymes [14]. For example, the E. coli Class I
ribonucleotide reductase (RNR) is based on a similar four-
helix bundle domain architecture templating a binuclear
iron (rather than manganese) active site complex. The outer
sphere of this redox active metal center includes a tyrosine
residue (Y122) that forms a catalytically essential free
radical [15]. Likewise, the manganese cluster of the photo-
synthetic oxygen evolving complex is associated with a
redox-active outer sphere tyrosine (Y
Z
) which is involved in
electron transfer and hydrogen atom abstraction steps of the
oxygen synthesis reactions [16,17]. While there is no
evidence for involvement of free radicals in manganese
catalase turnover, the conservation of the outer sphere
tyrosine within this family of enzymes [10,11], as well as the
occurrence of a redox-active outer-sphere tyrosine in the
heme catalases [18], suggests that this residue may make
essential contributions to the stability or reactivity of the
manganese active site. Attempts to express active manga-
nese catalase in E. coli have been unsuccessful [19]. Devel-
opment of a novel homologous expression system for
recombinant manganese catalase (using a catalase-negative
strain of L. plantarum) has made possible the dissection of
the active site structure and function by site-directed
mutagenesis. In this study we describe the detailed spectro-
scopic, biochemical and structural characterization of
recombinant Y42F L. plantarum manganese catalase,

Fig.2. TheactivesiteofLactobacillus plantarum manganese catalase.
Manganese ions (Mn1, Mn2) and coordinated solvent molecules (W1,
W2, W3) are labeled. Dashed lines define the hydrogen bond network
surrounding the active site (Based on PDB ID 1JKU). The structure
was rendered using
ORTEP
-3 [13].
Fig. 1. Subunit structure for Lactobacillus plantarum manganese catalase. The ribbon diagram (left) illustrates the organization of a single subunit
from the hexameric protein. Secondary structural elements are color-coded: a-helix (magenta); b-sheet (yellow). The dimanganese catalytic core
(cyan) is embedded in the center of a coiled-coil a-helical domain. (Right) Stereoview of dimanganese active site embedded in the interior of the
four-helix bundle catalytic domain. (Based on PDB ID 1JKU). Rendered using
MIDASPLUS
[12].
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1103
exploring the role of Tyr42 in stabilizing the dimanganese
cluster and implications for the involvement of the bridging
ligands in the catalytic mechanism.
Materials and methods
Molecular biology and biochemical preparations
Genomic DNA was isolated from Lactobacillus plantarum
(ATCC 14431) and Lactobacillus brevis (ATCC 8727) by
standard methods. The pG
+
host5 plasmid [20,21] was
kindly provided by Emmanuelle Maguin, INRA, France.
The Mn catalase structural gene with its native promoter
was PCR amplified from L. plantarum genomic DNA
(using the primers 5¢-GCGAGGATCCAACCGACTATT
GACTGGTAAAAAAGCAGTTACCCCTAACCAG-3¢
and 5¢-GAGCGAATTCCCACCTCCAATTTGAAATA

GCCACCGCC-3¢), BamHI/EcoRI digested and ligated
into similarly digested pG
+
host5 plasmid. The
pG
+
host5LPC product was recovered from an E. coli
transformant and transformed into a kat
–
strain of
L. plantarum (NCDO 1193) by electroporation. Electro-
competent L. plantarum cells were prepared as previously
described [22]. The protein expression level was subse-
quently improved by construction of a second expression
vector based on the pMG36e plasmid [23], using the
L. brevis surface layer protein promoter (P
slpA
) [23,24] in
place of the native katM promoter. A 267 nucleotide
fragmentofthe5¢ UTR for L. brevis slpA including the dual
slpA promoter was PCR amplified from genomic DNA
using the primers 5¢-CGTGAATTCGATTACAAAGG
CTTTAAGCAGGTTAGTGACGTTTTAG-3¢ and 5¢-C
GTTCTAGACATATGCTTTCTTCCTCCAAACATAA
AATATGTAATTTATCAAGCAAG-3¢, the latter provi-
ding a convenient NdeI/XbaI linker site for ligating inserts
for expression, precisely aligning the start codon under the
ribosomal binding site in the slpA 5¢ UTR. The PCR
product was digested (EcoRI/XbaI) and ligated to similarly
digested pMG36e to form pMG36ePslpA. A single NdeI

site occurring in the transcriptional repressor gene (repA)
coding region in the vector arms was eliminated by silent
mutagenesis using the QuikChange site directed mutagen-
esis procedure (Stratagene, La Jolla) using the primer 5¢-GT
TGAGATACTTGATTATATCAAAGGTTCTTATGA
ATATTTGACTCATGAATC-3¢ and its complement. The
LPC structural gene (katM) was PCR amplified from
pG
+
host5LPC using the primers 5¢-CCGCATATGTTC
AAACATACAAGAAAACTGCAATACAACGCAAA
ACC-3¢ and 5¢-CGCTCTAGATTATTAACCTTGGTGG
TTGTGTAATCTAGGATCACCCG-3¢, the latter inclu-
ding a double terminator sequence (TAATAAT). The
instability of the pMG36ePslpA plasmid that has
been observed in E. coli [25] was eliminated by reversing
the orientation of the expression cassette in the plasmid
(details to be reported elsewhere). The latter plasmid
(pVMG36PslpA-LPC) was used for all protein expression
described in this study. The Y42F mutation was introduced
in this plasmid by QuikChange site directed mutagenesis
using the mutagenic primer 5¢-CCACTGGGATGATG
TCTTTTCTCTCACAAGGTTGGGCG-3¢ and its com-
plement.
Protein expression
L. plantarum was grown at 37 °CinaNewBrunswick
Scientific BioFlo 3000 Bioreactor equipped with a 14-L
fermentation vessel. The culture medium was 10 L of MRS
medium supplemented with 2% glucose, 1%
L

-(–)-malic
acid, 5 m
M
MnSO
4
,0.5m
M
CaSO
4
, 1 g Tween 80, 30 mg
thiamine hydrochloride, and 50 mg erythromycin. The pH
of the culture was regulated (pH 5.5) by addition of 15%
NH
4
OH and sparged with air to maintain 20% dissolved
oxygen level. Cells were collected by centrifugation at late
log phase (D
1
600
> 10) yielding approximately 400 g of
slimy wet cells. Manganese catalase was isolated as
previously described [7,8,26]. The Y42F mutant protein
was detected in chromatographic fractions and its purity
estimated during purification by electrophoresis (SDS/
PAGE). The Mn content of the purified protein was
determined by atomic absorption analysis using a Varian
Instruments SpectrAA 20B graphite furnace atomic
absorption spectrometer. Catalase activity was measured
by the optically detected decomposition of hydrogen
peroxide [8] and the K

m
for H
2
O
2
was determined using
a Clark oxygen electrode [7]. The homogeneous reduced
(2,2) state of manganese catalase was prepared by treating
the protein with a five-fold excess of (NH
2
OH)
2
ÆH
2
SO
4
for
a half hour followed by desalting on a gel filtration
column. To convert the enzyme to the homogeneous (3,3)
state, a solution of the reduced protein (10 mgÆmL
)1
in
50 m
M
potassium phosphate buffer pH 7, total volume
<5 mL) was sealed in a 125-mL serum bottle under pure
oxygen at 8 °C for one week. The oxidation half-time at
room temperature was estimated by following the optical
absorption of the enzyme in a sealed cuvette under O
2

purge following reduction and anaerobic desalting. The
reductive titration of manganese (3,3) catalase was per-
formed as previously described [27] using (NH
2
OH)
2
Æ
H
2
SO
4
as titrant.
Spectroscopic measurements
Optical absorption spectra were recorded on a Varian
Instruments Cary 5E UV-vis-NIR absorption spectro-
meter. CD and MCD spectra were recorded using an
AVIV Associates model 40DS UV-vis-NIR dichrometer
as previously described [28]. An Oxford Instruments
SM4-6T magnetocryostat provided the magnetic field
and temperature control during the MCD experiments.
EPR measurements were performed using a Bruker E500
X-Band EPR spectrometer equipped with a SuperX high
stability bridge and a Bruker ER4116 D
M
bimodal
microwave resonator and an Air Products helium flow
cryostat.
X-ray crystallography
Crystallization. Crystals of Y42F LPC were grown from
14% PEG 8000 in 0.1

M
Taps buffer pH 8.7 by the vapor
diffusion technique at 18 °C. Crystals used for structural
studies were 0.4 · 0.2 · 0.15 mm belonging to space group
P21 with unit cell dimensions a ¼ 73.49, b ¼ 95.27,
c ¼ 105.00, b ¼ 106.55°.
1104 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Data collection and processing. Data was collected on a
magenta crystal of Y42F manganese catalase flash-frozen
at 100 K nitrogen stream after soaking for 1 min in a
cryoprotectant solution [12% PEG 8000, 0.1
M
Mes
pH 5.5 and 30% (v/v) 2-methyl-2,4-pentandiol (MPD)].
Data sets at 1.75 A
˚
(low resolution) and at 1.33 A
˚
(high
resolution) were collected at 100 K on station PX 14.2 at
the Daresbury Laboratory (UK) equipped with an
ADSC Quantum4 CCD detector on the same crystal
and the two datasets were indexed and integrated using
the program
DENZO
[29] and scaled separately by
SCALE-
PACK
[29]. Scaled data were merged by
SCALEPACK

to
construct a complete high-resolution dataset. Intensities
were transformed into amplitudes using the program
TRUNCATE
of CCP4 suit [30]. The details of data
collection statistics are presented in Table 1. Microscopic
inspection of the crystal after data collection showed no
difference in color between exposed and unexposed parts
of the crystal, confirming the absence of significant
photoreduction of Mn(III) centers during the X ray
measurements.
Structure determination. The structure of LPC Y42F
mutant was solved using coordinates of the WT LPC
structure [PDB ID 1JKV] as the initial model for program
REFMAC
[31] in Rigid Body mode, followed by positional
and temperature factor refinement. Atomic positions and
individual temperature factors were refined simultaneously
using
REFMAC
with the maximum-likelihood target function
for amplitudes and the exponential bulk-solvent and
anisotropic overall temperature factor correction. The six
monomers of the Y42F homohexamer were refined inde-
pendently. Water molecules were improved using the
program ARP [32]. Mes buffer molecules and multiple side
chain conformations were modeled in this stage during
inspection of waters. Occupancy of multiple side chain
conformation was validated manually by investigating the
difference density of F

o
–F
c
maps. Rebuilding of model was
carried out with the program O [33]. Hydrogen atoms in
standard positions were included in the final stages of
refinement followed by anisotropic B-factor refinement by
REFMAC
[34]. The current R factor of this model is 11.5%
(R
free
¼ 14.5%). An example of the final 2F
obs
– F
cal
Table 1. Summary of crystallographic statistics for Y42F Lactobacillus p lantarum manganese catalase.
Data sets Y42F LPC Low resolution High resolution Merging of two data sets
Space group P2
1
P2
1
Unit cell parameters A
˚
a 73.49 73.49
b 95.27 95.27
c 105.00 105.00
b 106.55 106.55
Temperature (K) 100 100
mosaicity (degrees) 1.05
B-value from Wilson plot (A

˚
2
) 14.28
Resolution limits (A
˚
) 50.0–1.75 23.00–1.33
Last shell limits (A
˚
) 1.79–1.75 1.35–1.33
Completeness (%)
a
86.3 (71.7) 86.7 (80.7)
Reflections 305406 588079 395381
Unique reflections 120714 274725 282601
Redundancy 2.53 2.14
I/s 14.2 (2.8) 14.9 (1.7)
R
sym
(%)
b
4.3 (22.0) 4.1 (34.0) R
merge
3.9
Final refinement statistics Y42F LPC
Resolution limits (A
˚
) 48.0–1.33
Refined number of reflections 268292
Number of reflections for R
free

14165
Overall R
cryst
(%)
c
11.5
Overall R
free
(%)
d
14.5
Number protein residues 1596
RMS bonds (A
˚
) 0.014
RMS angles (degrees) 1.522
Average B-value (A
˚
2
) 16.28
Total nonhydrogen refined atoms 13957
Protein Atoms 12450
Solvent Atoms 1507
Mn
+3
Ions 12
Ca
+2
Ions 6
a

Numbers in parentheses indicate values for the highest resolution shell.
b
R
sym
¼ S[|I
I
) ÆI
i
æ|]/S[ÆI
i
æ];
c
R
cryst
¼ S||F
obs
| )
|F
calc
||/S|F
obs
|;
d
R
free
[35] is the same as R
cryst
[36] for a random subset not included in the refinement of 5% of total reflections.
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1105
electron density map at 1.33 A

˚
resolution is shown in Fig. 3.
The model of Y42F LPC has 91.8% of the residues in the
most favored regions of the Ramachandran plot and 8.2%
in the additionally allowed regions. Some characteristics of
the refined models are presented in Table 1.
Results
Biochemical characterization
The yield of purified manganese catalase was approximately
120 mg from 10 L of culture for homologous expression of
recombinant enzyme from L. plantarum containing the
pVMG36PslpA-LPC expression plasmid, five times higher
than observed for cells containing the pG
+
host5LPC vector
where the LPC gene expression is under the control of the
native promoter. Y42F LPC exhibits a slightly lower metal
content (1.4 Mn/active site) than is found in the recombi-
nant WT protein (1.7 Mn/active site). Manganese clusters in
the as-isolated recombinant WT and Y42F LPC are
predominantly in the oxidized (3,3) state, based on optical
absorption measurements (vide infra). EPR spectra of the
as-isolated Y42F LPC (data not shown) indicate that a
significant fraction of sites (although less than 10% of the
total) are present in the superoxidized, mixed valent (3,4)
state. As previously found for WT manganese catalase [27],
the (3,3) and (3,4) clusters in the Y42F LPC can be reduced
by hydroxylamine to a homogeneous (2,2) state. The
reduced clusters may then be cleanly reoxidized by O
2

to a
homogeneous (3,3) state at pH 7 or higher (to pH % 9.5). At
8 °C, the oxidation approaches completion after 1 week at
pH 7 for both WT and Y42F LPC (data not shown). The
half-time (t
½
) for the re-oxidation reaction was estimated as
24 h for WT and 23 h for Y42F LPC at 8 °C,and8hfor
WT enzyme and 14 h for Y42F LPC at room temperature.
Y42F LPC retains a few per cent of the catalase activity
exhibited by the WT enzyme (Table 2), with catalytic
activity increasing at elevated pH. This small residual
activity of the mutant enzyme has been consistently
observed for all preparations, and is not observed in the
extracts of cells not expressing Y42F LPC. The pH
sensitivity of the catalase activity of Y42F LPC contrasts
with the behavior of the WT enzyme whose activity varies
only slightly over the pH range 5–10. At neutral pH the K
m
value for Y42F LPC was significantly higher than that of
WT enzyme (1.4
M
vs. 220 m
M
). At pH 10, on the other
hand, the K
m
value of Y42F LPC was dramatically lowered
(to 220 m
M

), becoming comparable with that of the WT
enzyme which was relatively unaffected by raising the pH.
X-ray crystal structure of Y42F LPC
The structure of Y42F LPC is nearly identical to that of the
WT LPC, with a RMS deviation between the aligned
polypeptide chains of only 0.26 A
˚
over all backbone atoms.
Even in the region of the mutation, the basic fold of the WT
protein is preserved, but the deletion of the hydroxyl group
in the aromatic side chain on substitution of phenylalanine
for tyrosine in Y42F LPC perturbs the hydrogen bonding
interactions in the outer sphere environment of the active
site manganese cluster, locally altering the protein structure
(Fig. 4). Loss of hydrogen bonding interactions with its
donor/acceptor partners (Arg147/Glu148) has only a small
Table 2. pH Dependence of catalytic activity for WT and Y42F man-
ganese catalase.
Specific activity (UÆmg
)1
)
Assay pH Recombinant WT LPC Y42F LPC
5.0
a
7688 ± 107 57 ± 2
6.0
b
8416 ± 329 178 ± 6
7.0
b

8859 ± 536 252 ± 3
8.0
b
8258 ± 413 452 ± 5
9.0
c
7957 ± 376 584 ± 10
10.0
d
8914 ± 528 898 ± 24
a
50 m
M
sodium dimethylsuccinate, 0.1 m
M
EDTA;
b
50 m
M
potassium phosphate, 0.1 m
M
EDTA;
c
50 m
M
Taps/KOH, 0.1 m
M
EDTA;
d
50 m

M
Caps/KOH, 0.1 m
M
EDTA.
Glu65
Phe42
Glu66
W2
W1
W3
Glu35
His181
Mn2
Arg147
Mn1
Glu148
His69
Glu65
Phe42
Glu66
W2
W1
W3
Glu35
His181
Mn2
Arg147
Mn1
Glu148
His69

Fig. 3. Stereoview of fragments of the electron-density maps including the dimanganese active site. The omit map was calculated with the complete
Y42F LPC model not including the alternative conformation for the Glu35 and Glu148 side chains. The electron-density of 2F
o
–F
c
map is
contoured at 1.3 r (light blue line) and 10.0 r (dark blue line). The difference density of F
o
–F
c
mapisrenderedasredlinesat4.0r.Thisfigurewas
generatedwiththeprogram
BOBSCRIPT
[37,38].
1106 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003
affect on the conformation of residue-42 itself. Phe42 in
Y42F LPC is only slightly shifted relative to the framework
of the polypeptide backbone from the position occupied by
the aromatic sidechain of Tyr42 in WT LPC, apparently
being held in place by buttressing contacts with a cluster of
buried residues. Deletion of the phenolic hydroxyl in the
Y42F mutant protein leaves a void between the aromatic
side chain of Phe42 and the Glu148 carboxylate that is not
occupied by solvent. Based on the intense color of the
crystalline protein and the relatively short metal-ligand
bond distances observed in the structure, the dimanganese
sites are assigned the oxidized (3,3) state in the crystal. All
Mn sites in the crystal appear to be fully occupied. The
mean temperature factor of the Mn ions is 19.5 A
˚

2
(close
to the mean temperature factor for the protein structure,
18.0 A
˚
2
), and no negative difference electron density is
detected in the F
obs
–F
calc
map of the cluster core assuming
full occupancy of the metal binding sites. As the metal
content of the as-isolated Y42F LPC is substoichiometric
(70–88% Mn depending on method of analysis), this
suggests that crystallization selects fully metallated hexa-
mers in the lattice. The average inner sphere bond distances
for the two manganese subsites in the cluster (Table 3) are
nearly identical to those found for the native LPC dima-
ganese complex, confirming that the fully oxidized
Mn(III)Mn(III) core is represented in the crystal structure.
The slight decrease in average metal-ligand distance for
subsite 2 is consistent with the lower coordination number
(CN) for that metal center in Y42F LPC (CN ¼ 5forMn2
in Y42F LPC, compared to CN ¼ 6inWTLPC).The
perturbation of the cluster core results in a disruption of the
Mn2-W2 bond and leads to smaller changes in several other
ligand interactions, which combine to produce the overall
shift of Mn2 towards the Glu148 carboxylate headgroup.
Arg147 is released from its interactions with residue-42 in

Y42F LPC, and its guanidinium headgroup undergoes a
shift (0.28 A
˚
) away from the cluster, perturbing its hydrogen
bonding interactions with the solvent bridge (W2) and one
of the metal ligands (Glu35). The latter side chain is slightly
displaced away from the cluster (by 0.33 A
˚
)alongthe
cluster axis. The nonligand carboxylate Glu178 headgroup
also shifts away from the cluster (by 0.63 A
˚
) through a small
(11°) twist in the extended sidechain. In spite of these
significant perturbations of the active site environment, both
ligating histidine residues (His69 and His181) as well as
Glu66, which contributes the bridging carboxylate for metal
binding, are nearly invariant between the WT and Y42F
Fig. 4. Stereoview of aligned WT and Y42F LPC structures showing the affect of Y42F mutagenesis on the extended outer sphere environment of the
dimanganese cluster. The region shown represents residues within a 10-A
˚
of the CD carbon atom of Glu66 following alignment (superposition) of all
backbone atoms of the enzyme (with an RMS deviation of 0.14 A
˚
). Color coding is used to distinguish the individual protein chains [WT LPC
(PDB ID 1JKU), red; Y42F LPC (PDB ID 1O9I), green] and heteroatoms (WT LPC: Mn ions, red; solvent molecules, violet; Y42F LPC: Mn ions,
blue; solvent molecules, yellow). Alternative conformations of the Glu35 and Glu148 side chains are rendered in blue.
Table 3. Inner sphere bond distances for WT and Y42F LPC Mn
centers.
Bond vector

Metal-ligand bond distance (A
˚
)
a
WT LPC
b
Y42F LPC
c
Subsite 1
Mn1-W1 1.91
2.09
Mn1-W2 2.10 2.07
Mn1-W3 2.06 2.09
Mn1-Glu35OE2 1.88 1.87
Mn1-Glu66OE1 2.13 2.12
Mn1-His69ND2 2.20 2.18
Avg 2.05 2.07
Subsite 2
Mn2-W1 2.00
2.11
Mn2-Glu66OE2 2.08 2.01
Mn2-Glu148OE1 2.44 2.30
Mn2-Glu148OE2 2.36
2.13
Mn2-His181ND2 2.14 2.10
Avg 2.20 2.13
a
Underlined values represent distances with >5% change between
WT and Y42F LPC structures;
b

PDB ID 1JKU;
c
PDB ID 1O9I.
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1107
LPC. More surprisingly, the Glu148 ligand, which loses one
of its hydrogen bonding interaction in the mutant, remains
rigidly fixed relative to the polypeptide framework in the
major conformation present in the crystal. (An alternate
conformation of the Glu35/Glu148 pair is also detected in
the crystal structure.)
Although the position of Glu148 in the major conformer
is not significantly affected by Y42F mutagenesis, its altered
reactivity is reflected in dramatic changes in the cluster core
(Fig. 5). Only one of the solvent molecules (W1) associated
with the dimanganese core remains bridging in the Y42F
LPC cluster. The solvent (W2), which formed a second
bridge in the WT structure, is terminally bound to Mn1 in
the mutant complex to form an octahedral coordination
polyhedron for this subsite. The position of W2 in Y42F
LPC is roughly the same as found for the corresponding
atom in WT LPC, but the second manganese ion (Mn2) is
displaced towards Glu148 ligand in the Y42F LPC complex,
allowing it to be more symmetrically chelated by the
carboxylate headgroup. In the WT enzyme, the OE1 oxygen
of Glu148 is closest to Mn2, while in Y42F LPC the OE2
oxygen is closest, resulting in distorted trigonal bipyramidal
coordination for the Mn2 subsite, the OE2-Mn2-W1
direction defining the trigonal axis. This change in coordi-
nation chemistry for Glu148 suggests that an increase in
ligand basicity resulting from loss of the tyrosine hydrogen

bond underlies the reorganization of the cluster core. The
detailed metric features of the dimanganese core for Y42F
LPC are indicated in Scheme 1.
In addition to the active site conformation (A) which
closely resembles the organization of the WT LPC active
site, the ligating glutamate residues Glu35 and Glu148 are
found to adopt a second conformation (B) in the crystal
(Fig. 5), based on a distinct pattern of hydrogen bonds. In
conformation B, both carboxylate head groups are rotated
approximately 90° [with OW3-Mn1-OE2-OE1
35
dihedral
changing from 89.12° (A) to )15.3° (B) and N
181
-Mn2-
OE2-OE1
148
dihedral changing from )96.3° (A) to 167.4°
(B)], allowing the OE2 oxygen of Glu148 to serve as a
hydrogen bond acceptor to both the NE and NH2 nitrogens
of Arg147, substituting for the missing Y42 phenolic
oxygen. This structural variation is reminiscent of the
carboxylate shift isomerism observed in the diiron carboxy-
late family of proteins [39–42]. The change in binding mode
of Glu148 from bidentate chelating to monodentate syn
coordination lowers the coordination number of the Mn2
subsite to four, with distorted tetrahedral geometry. Metal-
ligand bond distances for Glu35 and Glu148 OE2 carboxy-
late donor atoms are slightly longer in conformation B
[Mn1-O

35
(B) 2.23 A
˚
,Mn2-O
148
(B) 2.22 A
˚
]. Reorientation
of Glu35 allows a hydrogen bond to be formed with the
terminally bound solvent (W3). Conformation A is expected
to be stabilized relative to conformation B by two additional
hydrogen bonds in the outer sphere of the cluster, which
may account for its slight predominance in the mixture (a
60 : 40 ratio based on occupancy estimates in the crystal-
lographic analysis). The uniform behavior of Y42F LPC in
spectroscopic measurements and active site titration experi-
ments (see below) suggests that it is not possible to
distinguish these two conformers in solution samples.
Fig.5.TheactivesiteofY42FLactobacillus p lantarum manganese
catalase. Manganese ions (Mn1, Mn2) and coordinated solvent mole-
cules (W1, W2, W3) are labeled and hydrogen bonds inferred from the
structure are shown. Conformations A (top) and B (bottom) are
shown (based on PDB ID 1O9I). The structures were rendered using
ORTEP
-3 [13]. Scheme 1.
6
Metric parameters of the Y42F LPC dimanganese core.
1108 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003
Spectroscopic characterization – optical absorption
spectroscopy

The optical absorption spectrum of Y42F LPC in the (3,3)
state (Fig. 6, spectrum 1) exhibits an absorption maximum
near 480 nm with an extinction coefficient of 1100
M
)1
Æcm
)1
at pH 6 (e
480
¼ 700
M
)1
Æcm
)1
per Mn) and weaker absorp-
tion maximum at 750 nm (Table 4). The stronger absorp-
tion band includes a shoulder near 560 nm and fine
structure features between 500 and 530 nm arising from
spin-forbidden electronic transitions. A quantitative stoi-
chiometric redox titration of the O
2
re-oxidized Y42F
mutant protein with (NH
2
OH)
2
ÆH
2
SO
4

demonstrates a
uniform reduction process yielding an estimate of 0.88 ±
0.03sitesinthe(3,3)stateperLPCmonomer(Fig.6,inset).
The optical extinction coefficient for the visible absorption
bands decrease with increasing pH, and at pH 10 the
spectrum (Fig. 6, spectrum 2) resembles that of the WT
enzyme but with higher absorptivity (e
480
¼ 350
M
)1
Æcm
)1
compared to200
M
)1
cm
)1
for WT LPC)(Fig. 6, spectrum3).
CD and MCD Spectra
The CD spectrum (data not shown) of Y42F LPC ligand-
free enzyme in the (3,3) state shows a doublet pattern of
negatively signed intensity at 490 and 560 nm as well as
weaker positively signed ellipticity near 750 nm (Table 4).
The high pH complex exhibits dramatically lower CD
intensity near 500 nm and loss of the doublet splitting
pattern.
At low temperatures (5 K) and high magnetic fields (4 T)
(3,3) Y42F LPC complex exhibits unusually strong MCD
spectra, with well-resolved features at 460 and 560 nm

and a pairof weak, sharp featuresat 505 and 515 nm (Fig. 7).
Fig. 6. Optical absorption spectra for Lactobacillus p lantarum man-
ganese catalase (3,3) complexes. (1) Native Y42F LPC (0.25 m
M
active
sites) in 50 m
M
potassium phosphate pH 6; (2) Y42F LPC (0.25 m
M
active sites) in 50 m
M
Caps/KOH pH 10; (3) Native WT LPC man-
ganese catalase (1 m
M
active sites) in 50 m
M
Mops pH 7. (Insert) Stoi-
chiometric redox titration of Y42F (3,3) LPC (0.23 m
M
active sites in
50 m
M
potassium phosphate pH 7) under argon was titrated with ali-
quot addition of an anaerobic aqueous solution of (NH
2
OH)
2
ÆH
2
SO

4
.
Table 4. Spectroscopic properties of Y42F LPC (3,3) complexes.
ABS
4
CD MCD
Y42F LPC k (nm) e (
M
)1
Æcm
)1
) k (nm) De (
M
)1
Æcm
)1
) k (nm) De (
M
)1
Æcm
)1
)
pH 6
480 1100 490 )8.3 350 )9.7
750 100 560 )9.8 395 )4.7
750 +1.7 460 +47.8
505 )3.5
515 +8.5
560 )32.4
735 +2.1

pH 10
475 490 450 +2.8 – –
500 )2.5
550 )3.4
Fig. 7.
5
Magnetic circular dichroism data for Y42F Lactobacillus plan-
tarum manganese catalase. (Left) MCD data for native Y42F LPC
(top) Variable-magnetic field MCD spectra for (3,3) Y42F LPC
(1.2 m
M
active sites) in 50 m
M
potassium phosphate pH 6, 50% gly-
cerol glass, T ¼ 5K.(ÆÆÆ)4TLT-MCDspectrumforWTLPC(3,3)
complex included for comparison. (Insert) Saturation-magnetization
profiles for low temperature (2–8 K) variable magnetic field (0–5 T)
MCD. A splitting diagram for non-Kramers ground state with large
fine structure splitting (d)isshown.
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1109
A saturation profile for the 460 nm MCD feature (Fig. 7,
insert) reveals strongly nested magnetization curves for
temperatures between 2 and 8 K. The high pH form of the
(3,3) Y42F LPC complex shows virtually no paramagnetic
MCD over the entire UV-vis-NIR absorption range (Fig. 8),
although a pattern of weak features closely resembling the
oxidized (3,3) complex of WT LPC [27] in both transition
energies and intensities remains: De
L-R
¼ )2.4

M
)1
Æcm
)1
ÆT
)1
(350 nm); +3.1
M
)1
Æcm
)1
ÆT
)1
(430 nm); )1.5
M
)1
Æcm
)1
ÆT
)1
(495 nm); )1.6
M
)1
Æcm
)1
ÆT
)1
(550 nm).
EPR spectra of the (3,3) complex
Low temperature (10 K) EPR spectra for oxidized (3,3)

Y42F LPC (Fig. 9) exhibit an intense, extremely low-field
resonance (g
eff
¼ 20) extending to the zero-field limit of the
spectrum. This feature appears in both perpendicular
(Fig. 9, solid line) and in parallel (Fig. 9, dashed line)
EPR polarization. In parallel polarization, extended hyper-
fine modulation of the resonance is partly resolved, with an
average effective hyperfine splitting a
Mn
¼ 37 G. In addi-
tion to this dominant resonance feature, a number of other
spectral components centered near g
eff
¼ 6(sextet),
g
eff
¼ 4.3 (complex multiplet) and g ¼ 2 (sextet) are also
observed in perpendicular polarization, consistent with the
presence of several minority species in the enzyme sample.
The weakest component, near g
eff
¼ 6, is observed in both
parallel and perpendicular polarization, and the modulation
pattern is consistent with an average hyperfine coupling
a
Mn
¼ 85 G. A complex pattern of hyperfine features
centered near g
eff

¼ 4.3 in perpendicular polarization
appears to be comprised of two overlapping subspectra of
similar intensity (Fig. 9, A and A¢), each exhibiting a sextet
multiplet splitting (a
Mn
¼ 93 G). An EPR signal near g ¼ 2
present in the spectrum of Y42F LPC also clearly exhibits
sextet multiplet splittings, and neither the g
eff
¼ 4.3 nor
g ¼ 2 spectra are observed in parallel polarization. Thus,
polarization experiments allow the even-electron systems
[mononuclear Mn(III), and homovalent (2,2) and (3,3)
complexes] to be distinguished from mononuclear Mn(II)
sites in the protein.
High pH converts the (3,3) Y42F LPC to a distinct
complex, with relatively weak low-field EPR resonances in
both parallel and perpendicular polarizations (Fig. 10). In
parallel polarization a distinct hyperfine pattern is resolved
in the low-field resonance, with an average a
Mn
¼ 32 G.

Fig. 8. Magnetic circular dichroism data for Y42F Lactobacillus
plantarum manganese catalase (3,3) high pH form. Variable-magnetic
field MCD spectra for native Y42F LPC (1 m
M
active sites) in 30 m
M
Caps/KOH pH 10, 50% glycerol glass, T ¼ 5 K. Dashed line, 10 ·

expansion(righthandscale).
Fig. 9. EPR polarization spectra for Lactobacillus p lantarum mangan-
ese catalase (3,3) complex. Native Y42F LPC (3,3) (2.5 m
M
active sites)
in 50 m
M
potassium phosphate pH 6. A, A¢ denote sextet components.
Solid line, perpendicular polarization; dashed line, parallel polariza-
tion. Instrumental parameters: microwave frequency, 9.68 GHz (per-
pendicular) or 9.41 GHz (parallel); microwave power, 10 mW;
modulation amplitude, 5 G; modulation frequency, 100 kHz; tem-
perature 8.5 K.
Fig. 10. EPR polarization spectra for Y42F Lactobacillus plantarum
manganese catalase (3,3) hydroxide complex. Native Y42F LPC (3,3)
(2.3 m
M
active sites) in 50 m
M
Caps/KOH pH 10. Solid line, per-
pendicular polarization; dashed line, parallel polarization. Instru-
mental parameters: microwave frequency, 9.68 GHz (perpendicular)
or 9.41 GHz (parallel); microwave power, 10 mW; modulation
amplitude, 5 G; modulation frequency, 100 kHz; temperature 8.5 K.
1110 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003
The A + A¢ multiplet persists in this sample, and the region
near g ¼ 2 appears to be a superposition of the sextet
feature observed at neutral pH and the multiline spectrum
from a minor mixed-valent (3,4) component.
Discussion

Conserved tyrosine residues are present in the outer sphere
of metal centers in a wide range of metalloproteins,
including ribonucleotide reductase (RNR), the oxygen
evolving complex (OEC) of photosystem II, prostaglandin
H synthase, catalase, ferritin, and superoxide dismutase. In
some cases (e.g. the Tyr122 in RNR [43]; Y
Z
, assigned to
Tyr161 of the D1 protein in the OEC [44]; Tyr385 of ovine
prostaglandin H synthase-1 [45]) the tyrosine residues are
redox active, forming tyrosyl phenoxyl free radicals that
serve as hydrogen atom abstraction sites storing oxidation
equivalents in the protein. The function of conserved
tyrosines in other metalloproteins is less clear. In ferritin
[46], Tyr34, a residue adjacent to the binuclear iron
ferroxidase active site, has been proposed to serve an
electron transfer role in analogy to RNR where Tyr122
appearsinasimilarcontext.Inironandmanganese-
cofactored superoxide dismutases, the conserved tyrosine
residue occupies a position at the base of the substrate access
funnel [47,48], and may contribute to substrate interactions,
facilitate proton transfer steps, or serve as a safety valve
preventing permanent oxidative damage to the protein
through reversible formation of a phenoxyl species. Con-
servative substitution of phenylalanine for tyrosine in
ferritin [46] and manganese SOD [49,50] has negligible
effects on turnover under physiological conditions, suggest-
ing that evolution may have selected the conserved tyrosines
for function under extreme or unusual conditions. Sequence
correlations within the manganese catalase family of

enzymes have revealed a highly conserved tyrosine (Tyr42
in LPC sequence numbering) preceding the first EXXH
metal binding motif by approximately 25 residues. X-ray
crystallography of both Thermus thermophilus [10] and
Lactobacillus plantarum [11] manganese catalases has shown
that this tyrosine is intimately associated with the diman-
ganese core, lying in the outer sphere of the metal cluster
and forming a hydrogen bond with one of the manganese
ligands. The significance of this interaction is unknown, and
we have prepared Y42F LPC using site directed mutagen-
esis and expressed the mutant protein in a homologous
expression system in order to address the function of Tyr42
and investigate the role of the outer sphere tyrosine in
manganese catalase structure and reactivity.
Replacement of Tyr42 by phenylalanine does not inter-
fere with the assembly of the dimanganese center in LPC,
and recombinant Y42F LPC has only slightly less metal
content than recombinant WT LPC. X-ray crystallography
reveals that mutagenesis perturbs the structure of the
binuclear active site, breaking one of the solvent bridges
(W2). This loss of a bridge from the cluster core may be
traced, in turn, to a disruption of the hydrogen bonding web
around the active site. Deletion of the Tyr42 phenolic
hydroxyl in Y42F LPC removes the hydrogen bonding
contact with the Glu148 ligand to Mn2, altering the basicity
of the carboxylate group and significantly affecting its
coordination behavior (Fig. 5). This contributes to the
expansion of the intermanganese distance from 3.03 A
˚
in

the (3,3) state of the WT enzyme to 3.33 A
˚
in the
corresponding state of Y42F LPC, as Mn2 is drawn toward
the chelating Glu148 headgroup (Scheme 1). The W2 bridge
is further destabilized in the mutant by the loss of the
Arg147-Tyr42 hydrogen bond that rigidly anchors Arg147
in WT LPC, allowing W2 to dissociate as the Mn-O-Mn
angle is opened from 101.6° to 116.1°, resulting in extremely
asymmetric coordination of the W2 solvent in an ÔopenÕ
form of the cluster. An open, single-atom-bridged diman-
ganese cluster has previously been proposed to be the
catalytically active form of LPC and the major form of LPC
in solution [51], although the closed form of the cluster
(containing two atom bridges) has been reported for in the
WT LPC crystal structure [11] consistent with detailed
spectroscopic characterization of the WT LPC in solution
[27]. These effects of Y42F mutagenesis demonstrate a clear
role for Tyr42 in stabilizing the native bridged manganese
cluster structure in LPC.
Alteration of the dimanganese core structure in Y42F
LPC has dramatic effects on both the electronic structure of
the cluster (as reflected in the perturbed spectra) and its
catalytic reactivity. Although the open form of the cluster
can be readily converted between the (2,2) and (3,3)
oxidation states that form the basis for the catalytic reaction
cycle in the WT enzyme [52,53], Y42F LPC supports <1%
of the rate of WT peroxide dismutation at low pH (Table 2),
indicating that Tyr42 is required for full catalytic activity.
However, the rates for reoxidation of the WT and mutant

clusters by dioxygen, which likely occurs through the reverse
of the reductive turnover half-reaction, are similar for the
two proteins, although the reoxidation rates of both
proteins are much slower than the catalytic rates (data not
shown). One of the most dramatic effects of Y42F
mutagenesisisontheK
m
for substrate, H
2
O
2
,whichis
increased at neutral pH from 220 m
M
for WT enzyme to
% 1.4
M
in the mutant. At pH 10, the K
m
value for Y42F
LPC approaches the value for the WT enzyme, while the K
m
value for WT enzyme decreases only slightly (from 220 m
M
at pH 7 to 160 m
M
at pH 10). The specific activity of the
mutant protein also exhibits significant pH dependence
(Table 2), in contrast to the WT enzyme. These differences
in pH sensitivity reflect differences in coordination chem-

istry for the open and closed forms of the dimanganese
cluster.
Loss of one of the solvent bridges fundamentally alters the
properties of the manganese ions and their electronic
interactions within the cluster, as demonstrated by the
unique spectroscopic characteristics of the Y42F active site
complexes. The oxidized (3,3) Y42F LPC exhibits unusually
strong absorptivity in the ligand field spectra for the Mn(III)
centers at low pH (Fig. 6), at least fourfold higher than found
for the WT enzyme, consistent with a relaxation of the
Laporte (orbital parity) selection rules for the d(r)d transi-
tions under lower coordination number and lower symmetry
of the individual metal environments in the mutant protein
[28]. The CD spectrum of the ligand-free complex appears to
resolve spectra for Mn(III) in each of the subsites of the
cluster, giving rise to a distinctive ellipticity doublet.
The spectroscopic nonequivalence of the two Mn centers in
the Y42F LPC active site may be understood in terms of the
crystallographically determined metal environments. In the
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1111
Y42F LPC cluster, both metal centers have noncentrosym-
metric ligand distributions, with Mn2 (the five-coordinate
subsite) being chelated by Glu148 while Glu35 is bound to
Mn1 (the six-coordinate subsite) in a monodentate coordi-
nation mode, accounting for the differences in ligand field
strengths reflected in the spectroscopic splittings. Both major
and minor conformations of the two coordinating glutamate
side chains lead to distinct coordination numbers for the two
manganese ions in the cluster.
The ÔopenÕ cluster, containing a single atom bridge, also

exhibits dramatically different ground state interactions
between the two Mn(III) ions, reflecting the electronic
coupling responsible for the two-electron reactivity of the
cluster. In contrast to the diamagnetic (S
T
¼ 0) ground state
characteristic of the (3,3) form of WT LPC (as well as TTC)
[27], the exceptionally strong paramagnetic MCD associ-
ated with (3,3) Y42F LPC (Fig. 5) implies a ferromagneti-
cally coupled ground state in which the S
T
¼ 4 multiplet is
lowest in energy as has been found for other binuclear
Mn(III) complexes with single atom bridges [54–56]. The
saturation magnetization curves for the ligand-free Y42F
complex (Fig. 7, insert) are strongly nested, typical of MCD
for ground states exhibiting thermally accessible zero field
splittings [57,58]. The S
T
¼ 4 state is a non-Kramers
(integer spin) multiplet comprising nine M
S
sublevels
(M
S
¼ 0, ± 1, ± 2, ± 3, ± 4) whose degeneracies may
be completely removed in the absence of a magnetic field by
ligand perturbations expressed in the zero field splittings (d).
The low temperature MCD behavior of Y42F LPC implies
relatively large initial splittings are present within the

electronic ground state multiplet, whether they are intra-
doublet zerofield splittings (d) or interdoublet fine structure
splittings, although complementary EPR measurements (see
below) appear to support the latter.
We have previously shown that the ratio of saturation
limit MCD intensity to absorptivity (the MCD saturation
ratio, De
MCD
/e
ABS
) may be useful as a measure of the
Faraday ratio C°/D° permitting a more quantitative inter-
pretation of paramagnetic MCD spectra that is essential for
interpretation of complex spectra from biological samples
[27]. MCD and optical absorption spectra for the Y42F
LPC complex (Fig. 7) yield De
MCD
/e
ABS
¼ 0.10, similar to
the values previously found for high spin Mn(III) complexes
of Mn superoxide dismutase [28] and the fluoride derivative
of WT LPC [27]. On the other hand, the value found for the
high pH form of Y42F LPC (Fig. 8) is relatively small
(approximately 0.01), consistent with £10% of the open
cluster remaining at pH 10. Similar evaluation of the small
paramagnetic MCD signal that is present in WT LPC (3,3)
samples allows us to estimate that less than 3% of the sites
occur in the ÔopenÕ form in the WT enzyme. This clearly
illustrates the importance of quantitative characterization of

MCD samples, as this minor impurity species was inter-
preted as the sole component in earlier studies of the
oxidized (3,3) state of LPC [51].
EPR spectra of the oxidized Y42F LPC complement the
MCD results and support assignment of a ferromagnetically
coupled ground state for the (3,3) complex in the mutant
protein (Fig. 9). Conventional low temperature EPR spec-
tra recorded in perpendicular polarization (H
1
^ H
0
)are
dominated by a strong resonance extending to the zero field
limit, which is also present in the parallel polarized spectra
(H
1
|| H
0
). Under selection rules for microwave absorption
in parallel polarization (DM
S
¼ 0) [59], transitions between
pure angular momentum states (different M
S
values) are not
allowed, and therefore spectral components associated with
minor impurities containing half-integer spin (Kramers)
metal ions (e.g. mononuclear Mn(II), 3d
5
,S¼ 5/2) are

strictly forbidden. Transitions between mixed M
S
states
(linear combinations of the pure angular momentum
functions that arise through orbital mixing) are, however,
allowed in parallel polarization if the same M
S
function
appears in both initial and final states, with the resonance
condition (Eqn 1).
DE ¼ðgbH
2
þ d
2
Þ
1=2
¼ hv ð1Þ
defining the effective g-value at which EPR transitions are
observed. As indicated in Eqn (1), Zeeman splitting of zero-
field split sublevels is a second-order process depending on
the magnitude of the initial splitting d whose sensitivity to
molecular environment leads to variation between indivi-
dual molecules in a sample, resulting in relatively broad
resonances. The behavior of the low-field resonance in (3,3)
Y42F LPC is consistent with a transition between sublevels
of a non-Kramers ground state with d % 0.3 cm
)1
(the
X-Band microwave photon energy). This feature has a very
strong temperature dependence, decreasing in intensity

more rapidly than predicted by the Curie Law, implying
that other nearby states are thermally accessible at low
temperature (10–25 K).
The extended hyperfine pattern associated with this
resonance has a major splitting (37 G) approximately half
the value expected for a Mn(III) center (a
Mn
¼ 80–90 G),
consistent with assignment to the coupled binuclear (3,3)
active site. In the exchange-coupled complex, the magnitude
of the hyperfine splitting is reduced by projection of the
individual ion spins (S
1
and S
2
) on the total cluster spin (S
T
)
[60]:
a
0
Mn1
¼ðS
1
ÁS
T
=S
2
T
Þa

Mn1
¼
1
2
½S
T
ðS
T
þ 1ÞþS
1
ðS
1
þ 1Þ

ÀS
2
ðS
2
þ 1Þ=S
T
ðS
T
þ 1Þ

a
Mn1
ð2Þ
As a consequence, the magnitude of the observed Mn
hyperfine splitting for each ion is approximately half the
single-ion intrinsic value within every multiplet state of the

coupled complex. The observed splitting implies an intrinsic
a
Mn
¼ 74 G which is low for Mn(III), and may reflect
relatively strong covalent delocalization associated with the
oxo bridge, as well as the other ligands binding the cluster.
In contrast, the EPR spectrum of the WT LPC (3,3)
complex lacks any significant resonance features in either
perpendicular or parallel polarization, other than a minor
mixed valent impurity signal [27].
In combination with the MCD results discussed above,
the EPR data indicate a paramagnetic ground state for the
exchange-coupled complex that requires ferromagnetic
exchange coupling of the two high spin Mn(III) metal ions
in Y42F LPC. In contrast, within the doubly bridged, WT
dimanganese core, the metal ions experience strong antifer-
romagnetic interactions, supported by the pair of atom
bridges. This difference emphasizes the importance of the
1112 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003
ground state magnetism as an indicator of the interactions
within the cluster core. The change in the sign of the
exchange coupling in the closed/open
2
transformation may
be traced to the loss of one of the atom bridges and its effect
on the electronic coupling between the two metal ions. The
orbital quantization axes of the two metal centers in the
cluster are defined by the Mn(III)-oxo overlaps, represent-
ing the strongest ligand interactions in the complex. These
strong r antibonding overlaps with the Mn(III) metal

centers destabilizes the d
z
2 valence orbitals on each ion,
leaving them unoccupied in the d
4
metal complex. The linear
combination of the (empty) d
z
2 metal orbitals and the p
r
on
the oxygen bridge comprises an MO that represents the
most important (r) pathway for electronic coupling between
the two metal centers, and the absence of unpaired electrons
in the metal contributions to this MO eliminates the major
antiferromagnetic contribution to exchange interactions in
the complex. The opening of the Mn-O-Mn bridge angle in
the cluster containing a single atom bridge further reduces
the contributions from p pathways, producing a ferromag-
netically coupled ground state for the l-oxo bridged Mn(III)
dimer. In the closed cluster, the second (hydroxo) atom
bridge mediates strong antiferromagnetic coupling. Thus,
spectroscopic and crystallographic results independently
lead to the conclusion that one of the solvent bridges is
broken in the oxidized Y42F LPC (3,3) complex.
In addition to the low-field EPR signal from the
ferromagnetically coupled di-Mn(III) active site, other
signals are also present in the sample (Fig. 9) that reflect a
degree of heterogeneity among the sites. Resonances near
g

eff
¼ 4.3 and g ¼ 2 appear exclusively in perpendicular
polarization, and exhibit the sextet hyperfine splitting
pattern expected for a mononuclear
55
Mn metal ion
(I ¼ 5/2; 2I + 1 ¼ 6). These components may be assigned
to a minor fraction of half-occupied sites containing Mn(II)
that is not readily oxidized by O
2
. The pattern of resonances
near g
eff
¼ 4.3 (A, A¢) reflect the presence of Mn(II) in two
similar but distinct metal environments, and may be
associated with active sites in which either the Mn1 or
Mn2 subsite is occupied. The large g
eff
value suggests a
relatively low-coordinate complex, similar to the five-
coordinate Mn(II) sites in Mn superoxide dismutase. A
third minor component, associated with resonances near
g
eff
¼ 6, also exhibits the sextet hyperfine splitting charac-
teristic of mononuclear Mn site, but has significant intensity
in the parallel polarized EPR spectrum, and therefore may
be assigned to a small fraction of mononuclear Mn
complexes containing an oxidized Mn(III) metal center.
TheactivesiteofY42FLPCismuchmoresensitivetopH

than that of the WT enzyme, and the optical absorption,
MCD and EPR spectra indicate that at high pH the
dimanganese complex in the mutant protein is converted to
a form closely resembling that of the WT enzyme at neutral
pH. This process likely involves coordination of hydroxide
ion (HO
–
) in the second bridge position, restoring the
bis-bridged Mn(III) core characteristic of the WT active site
(Scheme 2). Hydroxide binding would appear to be an
exception to the observation that access to the LPC active site
is restricted to neutral molecules [11,27], and a Grotthuss
proton relay conduction mechanism [61] may be involved in
this process. The high pH complex exhibits the relatively
weak optical absorption of a six-coordinated Mn(III) center,
and the absence of strong signals in either MCD (Fig. 8) or
EPR (Fig. 10) spectra for the complex are consistent with
antiferromagnetically coupled ground state as previously
found for the WT enzyme. This structural transformation at
high pH is mirrored in the pH dependence of the kinetic
constants for Y42FLPC. We finddistinct catalytic properties
for the open and closed forms of the cluster: K
m
for H
2
O
2
is
lowered (eightfold) and the specific activity increased (three-
fold) at high pH, indicating that the closed form of the cluster

is more effective in supporting peroxide dismutation. Note
that WT LPC does not exhibit this type of pH sensitivity, so it
seems unlikely that these properties are directly related to
substrate ionization at high pH.
The combined structural, spectroscopic and biochemical
characterization of the dimanganese clusters in Y42F and
WT LPC allow us to relate cluster structure to catalytic
reactivity. The (3,3) state of the WT enzyme contains a
catalytically active ÔclosedÕ cluster, associated with an
antiferromagnetically coupled electronic groundstate medi-
ated by a pair of solvent bridges. This structure is stabilized
by the outer sphere hydrogen bonding network, including
interactions with Tyr42. Disruption of the outer sphere
hydrogen bonding network in Y42F LPC stabilizes a
catalytically impaired ÔopenÕ form of the oxidized (3,3)
cluster at neutral pH, reflected in the unique optical and
magnetochemical properties of this site. The broken bridge
(W2) appears to be rescued by exogenous hydroxide at high
Scheme 2. Catalytic reaction cycle for manganese catalase turnover.
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1113
pH, regenerating the native, bis-atom bridged ÔclosedÕ form
of the cluster core and slightly restoring catalytic function.
In addition to this essential structural contribution of Tyr42,
the proximity to the dimanganese cluster and the well-
established redox properties of tyrosine residues in, e.g.
ribonucleotide reductase, the outer sphere tyrosine in LPC
may serve as a sacrificial redox site, a Ôsafety valveÕ capable
of reversible one-electron oxidation protecting the inner
sphere of the metal complex (particularly the histidine
ligands) during relatively rare, high potential oxidative

processes in the active site.
The observations described above for the Y42F LPC
mutant provide the basis for new mechanistic insights,
illustrated in Scheme 2. Each of the two solvent bridges in
the WT LPC can serve as a single-base equivalent in
proton-coupled electron transfer within the active site, with
protonation being driven by perturbation of the bridge pK
a
by ligation or oxidation state changes at the metal centers.
The pendant glutamate residue Glu178 that lies above the
Mn
2
O
2
core is positioned to form hydrogen bonds to
ligands occupying the axial position on Mn1 (e.g. Fig. 1,
W3) facilitating proton transfers between nonadjacent
atoms in the complex. These proton transfer processes
may involve formation of bifurcated hydrogen bonds
between Glu178 carboxylate and two other donor/acceptor
atoms. Two successive proton transfers from a terminally
bound peroxide substrate are required for completion of
the substrate oxidation half-reaction and reduction of the
dimanganese(III) core. In Y42F LPC, one of the intrinsic
bases is missing from the catalytic core, blocking the
second proton transfer step. In addition, the pK
a
of the
remaining oxo bridge and the redox potentials of the metal
centers may be altered in the site containing a single atom

bridge, interfering with turnover processes. Insertion of
hydroxide at elevated pH to form the bis-atom-bridged
cluster in Y42F LPC restores the two-proton reactivity of
the WT complex.
The WT and Y42F LPC active sites are also expected to
exhibit differences in substrate interactions. Substrate may
bind to the ÔopenÕ form of the oxidized (3,3) Y42F cluster
terminally, as predicted for the WT (3,3) complex, or by
peroxide insertion in a l
1,1
bridging mode previously
predicted for the reduced (2,2) form of the cluster in the
WTenzyme.l-bridging coordination is expected to polarize
the O-O bond and favor heterolytic bond cleavage coupled
to cluster oxidation. As the (3,3) cluster is already oxidized,
the bridging geometry may be unproductive, decreasing the
catalytic efficiency of the enzyme, or may even lead to an
inactivation pathway involving further oxidation of the
cluster to the (4,4) state, contributing to the superoxidized
(3,4) component in Y42F. These observations support a
mechanism in which the solvent bridges serve as proton
storage sites, directing the coordination chemistry of the
dimanganese cluster for maximum catalytic efficiency.
Acknowledgements
The staff at the Daresbury Laboratory is acknowledged for operation
of the synchrotron facility. Support for this project from the National
Institutes of Health (GM 42680 to J.W.W) and BBSRC (GRN 50/
B05117 to V.V.B) is gratefully acknowledged.
References
1. Nicholls, P. & Schonbaum, G.R. (1963) Catalases. In The

Enzymes,Vol.VIII,2ndedn(Boyer,P.D.,Lardy,H.&Myrback,
K., eds), pp. 147–225. Academic Press New York, New York.
2. Melik-Adamyan, W.R., Barynin, V.V., Vogin, A.A., Borisov,
V.V., Vainshtein, B.K., Fita, I., Marthy, M.R.N. & Rossmann,
M.G. (1986) Comparison of beef liver and Penicillium vitale
catalases. J. Mol. Biol. 188, 63–72.
3. Bravo, J., Mate, M.J., Schneider, T., Switala, J., Wilson, K.,
Loewen, P.C. & Fita, I. (1999) Structure of catalase HPII from
Escherichia coli at 1.9 A
˚
resolution. Proteins 34, 155–166.
4. Zamocky, M. & Koller, F. (1999) Understanding the structure and
function of catalases: clues from molecular evolution and muta-
genesis. Prog. Biophys. Mol. Biol. 72, 19–66.
5. Barynin, V.V. & Grebenko, A.I. (1986) T-catalase is nonheme
catalase of the extremely thermophilic bacterium Thermus ther-
mophilus HB8. Dokl. Akad. Nauk.SSSR286, 461–464.
6. Allgood, G.S. & Perry, J.J. (1986) Characterization of a manga-
nese-containing catalase from the obligate thermophile Thermo-
leophilum album. J. Bacteriol. 168, 563–567.
7. Kono, Y. & Fridovich, I. (1983) Isolation and characterization of
the pseudocatalase of Lactobacillus plantarum. J. Biol. Chem. 258,
6015–6019.
8. Beyer, W.F. & Fridovich, I. (1985) Pseudocatalase from Lacto-
bacillus plantarum: evidence for a homopentameric structure
containing two atoms of manganese per subunit. Biochemistry 24,
6460–6467.
9. Amo, T., Haruyuki, A. & Imanaka, T. (2002) Unique presence
of a manganese catalase in a hyperthermophilic archaeon,
Pyrobaculum calidifontis VA1. J. Bacteriol. 184, 3305–3312.

10. Antonyuk, S.V., Melik-Adamyan, V.R., Popov, A.N., Lamzin,
V.S.,Hempstead,P.D.,Harrison,P.M.,Artymiuk,P.J.&
Barynin, V.V. (2000) Three-dimensional structure of the enzyme
dimanganese catalase from Thermus thermophilus at 1 A
˚
resolu-
tion. Crystallogr. Reports 45, 105–116.
11. Barynin, V.V., Whittaker, M.M., Antonyuk, S.V., Lamzin, V.S.,
Harrison, P.M., Artymiuk, P.J. & Whittaker, J.W. (2001) Crystal
structure of manganese catalase from Lactobacillus plantarum.
Structure 9, 725–738.
12. Ferris, T.E., Huang, C.C. & Jarvis, L.E. (1988) The MIDAS
display system. J. Mol. Graphics 6, 13–27.
13. Farrugia, L.J. (1997) Ortep-3 for Windows. J. Appl. Cryst.
30,565.
14. Kurtz, D.M. Jr (1997) Structural similarity and functional diver-
sity in diironoxo proteins. J. Biol. Inorg. Chem. 2, 159–167.
15. Nordlund, P. & Eklund, H. (1993) Structure and function of the
Escherichia coli ribonucleotide reductase protein R2. J. Mol. Biol.
232, 123–164.
16. Gilchrist, M.L. Jr, Ball, J.A., Randall, D.W. & Britt, R.D.
(1995) Proximity of the manganese cluster of photosystem II
totheredox-activetyrosineYZ.Proc. Natl Acad. Sci. USA 92,
9545–9549.
17. Tommos, C., Hoganson, C.W., Valentin, M.D., Lydakis-
Simantiris, N., Dorlet, P., Westphal, K., Chu, H.A., McCracken, J.
& Babcock, G.T. (1998) Manganese and tyrosyl radical function
in photosynthetic oxygen evolution. Curr. Opin. Chem. Biol. 2,
244–252.
18. Ivanovich, A., Jouve, H.M., Sartor, B. & Gaillard, J. (1997) EPR

investigation of compound I in Proteus mirabilis and bovine liver
catalases: formation of porphyrin and tyrosyl radical inter-
mediates. Biochemistry 36, 9356–9364.
19. Igarashi, T., Kono, Y. & Tanaka, K. (1996) Molecular cloning of
manganese catalase from Lactobacillus plantarum. J. Biol. Chem.
271, 29521–29524.
1114 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003
20. Biswas, I., Gruss, A., Ehrlich, S.D. & Maguin, E. (1993) High-
efficiency gene inactivation and replacement system for gram-
positive bacteria. J. Bacteriol. 175, 3628–3635.
21. Maguin, E., Pre
´
vost, H., Ehrlich, D. & Gruss, A. (1996) Efficient
insertional mutagenesis in lactococci and other gram-positive
bacteria. J. Bacteriol. 178, 931–935.
22. Aukrust, T.W., Brurberg, M.B. & Nes, I.F. (1995) Transforma-
tion of Lactobacillus by electroporation. Methods Mol. Biol. 47,
201–208.
23. Kahala, M. & Palva, A. (1999) The expression signals of the
Lactobacillus brevis slpA gene direct efficient heterologous protein
production in lactic acid bacteria. Appl. Microbiol. Biotechnol. 51,
71–78.
24. Kahala, M., Savijoki, K. & Palva, A. (1997) In vivo expression of
the Lactobacillus brevis S-layer gene. J. Bacteriol. 179, 284–286.
25. Savijoki, K., Kahala, M. & Palva, A. (1997) High level hetero-
logous protein production in Lactococcus and Lactobacillus using
a new secretion system based on the Lactobacillus brevis S-layer
signals. Gene 186, 255–262.
26. Meier, A., Whittaker, M.M. & Whittaker, J.W. (1996) EPR
polarization studies on Mn catalase from Lactobacillus plantarum.

Biochemistry 35, 348–360.
27. Whittaker, M.M., Barynin, V.V., Antonyuk, S.V. & Whittaker,
J.W. (1999) The oxidized (3,3) state of manganese catalase.
Comparison of enzymes from Thermus thermophilus and Lacto-
bacillus plantarum. Biochemistry 38, 9126–9136.
28. Whittaker, J.W. & Whittaker, M.M. (1991) Active site spectral
studies on manganese superoxide dismutase. J. Am. Chem. Soc.
113, 5528–5540.
29. Otwinowski, Z. & Minor, W. (1997) Processing of X-ray diffrac-
tion data collected in oscillation mode. Methods Enzymol. 276,
307–315.
30. Collaborative Computational Project, Number 4.
3
(1994) The
CCP4 suite: Programs for protein crystallography. Acta Crystal-
logr. D50, 760–763.
31. Murshudov, G.N., Vagin, A.A. & Dodson, E.T. (1997) Refine-
ment of Macromolecular Structures by the Maximum-Likelihood
Method. Acta Crystallogr. D53, 240–255.
32. Lamzin, V.S. & Wilson, K.S. (1993) Automated Refinement of
Protein Models. Acta Crystallogr. D49, 129–147.
33. Jones, T.A., Zou, J.Y., Cowan, S.W. & Kjeldgaard, M. (1991)
Improved methods for building protein models in electron density
maps and the location of errors in those models. Acta Crystallogr.
A47, 110–119.
34. Murshudov, G.N., Vagin, A.A., Lebedev, A., Wilson, K.S. &
Dodson, E.J. (1999) Efficient anisotropic refinement of macro-
molecular structures using FFT. Acta Cryst. D55, 247–255.
35. Brunger, A.T. (1992) The Free R. value: a novel statistical quan-
tity for assessing the accuracy of crystal structures. Nature 355,

472–474.
36. Stout, G.H. & Jensen, L.H. (1989) X-ray structure determination, a
practical guide. 2ndEdn.Wiley,NewYork,USA.
37. Kraulis, P.J. (1991) MOLSCRIPT: a program to produce both
detailed and schematic plots of protein structures. J. Appl. Cryst.
24, 946–950.
38. Esnouf, R.M. (1997) An extensively modified version of MOL-
SCRIPT that includes greatly enhanced coloring capabilities.
J. Mol. Graph. Model. 15, 132–134.
39. Nordlund, P. & Eklund, H. (1995) Di-iron-carboxylate proteins.
Curr. Opin. Struct. Biol. 5, 758–766.
40. Rozenzweig, A.C., Nordlund, P., Takahara, P.M., Frederick,
C.A. & Lippard, S.J. (1995) Geometry of the soluble methane
monooxygenase catalytic diiron center in two oxidation states.
Chem. Biol. 2, 409–418.
41. Logan, D.T., Su, X D., A
˚
berg, A., Regnstro
¨
m, K., Hajdu,
J., Eklund, H. & Nordlund, P. (1996) Crystal structure of
reduced protein R2 of ribonucleotide reductase: the structural
basis for oxygen activation at a dinuclear iron site. Structure 4,
1053–1064.
42. Elango, N., Radhakrishnan, R., Froland, W.H., Wallar, B.J.,
Earhart, C.A., Lipscomb, J.D. & Ohlendorf, D.H. (1997) Crystal
structure of the hydroxylase component of methane mono-
oxygenase from Methylosinus trichosporium OB3b. Protein Sci. 6,
556–568.
43. Larsson, A

˚
.&Sjo
¨
berg, B M. (1986) Identification of the stable
free radical tyrosine residue in ribonucleotide reductase. EMBO J.
5, 2037–2040.
44. Debus, R.J., Barry, B.A., Stihole, I., Babcock, G.T. & McIntosh,
L. (1988) Site-directed mutagenesis identifies a tyrosine radical
involved in the photosynthetic oxygen-evolving system. Biochem-
istry 27, 9071–9074.
45. Tsai, A., His, L.C., Kulmacz, R.J., Palmer, G. & Smith, W.L.
(1994) Characterization of the tyrosyl radicals in ovine pros-
taglandin H synthase-1 by isotope replacement and site-directed
mutagenesis. J. Biol. Chem. 269, 5058–5091.
46. Chen-Barrett, Y., Harrison, P.M., Treffry, A., Quail, M.A.,
Arosio,P.,Santambrogio,P.&Chasteen,N.D.(1995)Tyrosyl
radical formation during the oxidative deposition of iron in
human apoferritin. Biochemistry 34, 7847–7853.
47. Whittaker, J.W. (1999) Manganese superoxide dismutase. Met.
Ions Biol. Syst. 37, 587–611.
48. Lah, M.S., Dixon, M.M., Pattridge, K.A., Stallings, W.C., Fee,
J.A. & Ludwig, M.A. (1995) Structure-function in Escherichia coli
iron superoxide dismutase: comparisons with the manganese
enzyme from Thermus thermophilus. Biochemistry 34, 1646–1660.
49. Whittaker, M.M. & Whittaker, J.M. (1997) Mutagenesis of a
proton linkage pathway in Escherichia coli manganese superoxide
dismutase. Biochemistry 36, 8923–8931.
50. Guan, Y., Hickey, M.J., Borgstahl, G.E., Hallewell, R.A.,
Lepock, J.R., O’Connor, D., Hsieh, Y., Nick, H.S., Silverman,
D.N. & Tainer, J.A. (1998) Crystal structure of Y34F mutant

human mitochondrial manganese superoxide dismutase and the
functional role of tyrosine 34. Biochemistry 37, 4722–4730.
51. Brunold, T.C., Gamelin, D.R., Stemmler, T.L., Mandal, S.K.,
Armstrong, W.H., Penner-Hahn, J.E. & Solomon, E.I. (1998)
Spectroscopic Studies of Oxidized Manganese Catalase and
l-Oxo-Bridged Dimanganese (III) Model Complexes: Electronic
Structure of the Active Site and Its Relation to Catalysis. J. Am.
Chem. Soc. 120, 8724–8738.
52. Dismukes, G.C. (1996) Manganese Enzymes with Binuclear
Active Sites. Chem. Rev. 96, 2909–2926.
53. Yoder, D.W., Hwang, J. & Penner-Hahn, J.E. (1999) Manganese
catalases. Met. Ions Biol. Syst. 37, 527–557.
54. Wieghardt,K.,Bossek,U.,Nuber,B.,Weiss,J.,Bonvoisin,J.,
Corbella, M., Vitols, S.E. & Girerd, J.J. (1988) Synthesis, crystal
structures, reactivity, and magnetochemistry of a series of
binuclear complexes of manganese (II) -(III), and -(IV) of biolo-
gical relevance. The crystal structure of [L’MnIV(l-O)
3
MnIVL¢]
(PF
6
).2H
2
O containing an unprecedented short Mn…Mn distance
of 2.296 A
˚
. J. Am. Chem. Soc. 110, 7398–7411.
55. Vincent, J.B., Tsai, H L., Blackman, A.G., Wang, S., Boyd,
P.D.W., Folting, K., Huffman, J.C., Lobkovsky, E.B.,
Hendrickson, D.N. & Christou, G. (1993) Models of the manga-

nese catalase enzymes. Dinuclear manganese (III) complexes with
the [Mn
2
(l-O)(l-O
2
CR)
2
]
2
+
core and terminal monodentate lig-
ands: preparation and properties of [Mn
2
O(O
2
CR)
2
X
2
(bpy)
2
]
(X ¼ chloride, azide, water). J. Am. Chem. Soc. 115, 12353–12361.
56. Toftlund, H., Markiewicz, A. & Murray, K.S. (1990) Acta Che-
mica Scand. 44, 443–446.
57. Thomson, A.J. & Johnson, M.K. (1980) Magnetization curves of
haemoproteins measured by low-temperature magnetic-circular-
dichroism spectroscopy. Biochem. J. 191, 411–420.
Ó FEBS 2003 Mutagenesis of Lactobacillus manganese catalase (Eur. J. Biochem. 270) 1115
58. Whittaker, J.W. & Soloman, E.I. (1988) Spectroscopic studies on

ferrous nonheme iron active sites: magnetic circular dichroism of
mononuclear iron sites in superoxide dismutase and lipoxygenase.
J. Am. Chem. Soc. 110, 5329–5339.
59. Hendrich, M.P. & Debrunner, P.G. (1989) Integer-spin electron
paramagnetic resonance of iron proteins. Biophys. J. 56, 489–506.
60. Dismukes, G.C. & Siderer, Y. (1981) Intermediates of a poly-
nuclear manganese center involved in photosynthetic oxidation of
water. Proc. Natl Acad. Sci. USA 78, 274–278.
61. Pomes, R. & Roux, B. (1998) Free energy profiles for H
+
con-
duction along hydrogen-bonded chains of water molecules Bio-
phys. J. 75, 33–40.
1116 M. M. Whittaker et al.(Eur. J. Biochem. 270) Ó FEBS 2003