Báo cáo khoa học: Mutagenesis of hydrogenase accessory genes of Synechocystis sp. PCC 6803 Additional homologues of hypA and hypB are not active in hydrogenase maturation ppt

Mutagenesis of hydrogenase accessory genes
of Synechocystis sp. PCC 6803
Additional homologues of hypA and hypB are not active in
hydrogenase maturation
Do
¨
rte Hoffmann, Kirstin Gutekunst, Monika Klissenbauer, Ru
¨
diger Schulz-Friedrich and Jens Appel
Botanisches Institut, Christian-Albrechts University, Kiel, Germany
The large subunit of heterodimeric NiFe-hydrogenases
contains a metal complex of a nickel and an iron ion.
The two are held in close proximity by two disulfide
bridges provided by two cysteine residues of the pro-
tein. The iron has two cyanide ions and one carbon
monoxide as ligands, whereas the nickel ion is coordi-
nated by two additional cysteines [1,2]. This metal cen-
tre is at the heart of hydrogen oxidation and proton
reduction. Its assembly depends upon the presence of
at least six genes collectively called hydrogenase pleio-
tropic (hyp) because of the pleiotropic effect of their
deletion on the synthesis of all hydrogenases in Escheri-
chia coli [3]. In a last step, a hydrogenase-specific prote-
ase cleaves a C-terminal peptide from the protein.
Many investigations, especially into the processing
of the large subunit of hydrogenase 3 (HycE) from
E. coli, have unraveled the role of the proteins enco-
ded by the hyp genes [3]. Although the origin of the
carbon monoxide is still not known, the cells have
to provide carbamoylphosphate for the production of
Keywords

hyp genes; cobalt transport; arginase;
agmatinase; cyanobacteria
Correspondence
J. Appel, Botanisches Institut, University of
Kiel, Am Botanischen Garten 1–9,
24118 Kiel, Germany
Fax: +49 431 880 4238
Tel: +49 431 880 4237
E-mail:
(Received 13 May 2006, revised 27 June
2006, accepted 9 August 2006)
doi:10.1111/j.1742-4658.2006.05460.x
Genes homologous to hydrogenase accessory genes are scattered over the
whole genome in the cyanobacterium Synechocystis sp. PCC 6803. Deletion
and insertion mutants of hypA1 (slr1675), hypB1 (sll1432), hypC, hypD,
hypE and hypF were constructed and showed no hydrogenase activity.
Involvement of the respective genes in maturation of the enzyme was con-
firmed by complementation. Deletion of the additional homologues hypA2
(sll1078) and hypB2 (sll1079) had no effect on hydrogenase activity. Thus,
hypA1 and hypB1 are specific for hydrogenase maturation. We suggest that
hypA2 and hypB2 are involved in a different metal insertion process.
The hydrogenase activity of DhypA1 and DhypB1 could be increased by the
addition of nickel, suggesting that HypA1 and HypB1 are involved in the
insertion of nickel into the active site of the enzyme. The urease activity of
all the hypA and hypB single- and double-mutants was the same as in wild-
type cells. Therefore, there seems to be no common function for these two
hyp genes in hydrogenase and urease maturation in Synechocystis. Similar-
ity searches in the whole genome yielded Slr1876 as the best candidate for
the hydrogenase-specific protease. The respective deletion mutant had no
hydrogenase activity. Deletion of hupE had no effect on hydrogenase activ-

ity but resulted in a mutant unable to grow in a medium containing the
metal chelator nitrilotriacetate. Growth was resumed upon the addition of
cobalt or methionine. Because the latter is synthesized by a cobalt-requiring
enzyme in Synechocystis, HupE is a good candidate for a cobalt transpor-
ter in cyanobacteria.
Abbreviation
hyp, hydrogenase pleiotropic.
4516 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS
the cyanide ligands [4,5]. Corresponding homologues
of the genes of the carbamoylphosphate synthase
genes (carAB) can be found in all cyanobacteria
sequenced to date. The carbamoyl group is trans-
ferred to the C-terminal cysteine of HypE. This step
is catalysed by HypF via a carbamoyl-AMP interme-
diate. In an ATP-dependent dehydration reaction the
C-terminal thiocarboxamide of HypE is then trans-
formed into a thiocyanate, which is suggested to be
the precursor of the cyanide ligands [6,7].
Iron is probably introduced into this process by a
complex of HypC and HypD [8]. At this complex, the
coordination of the CN and CO ligands to iron might
be accomplished. HypC was also shown to form a
complex with the large subunit of the hydrogenase,
thus serving as a kind of chaperone [9,10]. In Thio-
capsa roseopersicina, two homologues of HypC have
been shown to be necessary for the expression of all
three hydrogenases. It was discussed that one of them
works as a chaperone and the other could be part of a
complex with HypD [11].
HypA and HypB are responsible for the insertion of

nickel. A number of bacterial sequences reveal a
N-terminal domain containing stretches of histidine
residues in HypB. These residues have been shown to
bind up to 18 nickel ions per dimer in Bradyrhizobium
japonicum, thus functioning as a storage site [12]. The
C-terminal domain has a high similarity to GTPases.
HypB of E. coli hydrolyses GTP when processing the
large subunit of hydrogenase 3 [13,14]. The N-terminal
histidine residue of HypA also takes part in the pro-
cess and seems to play an essential role during nickel
insertion [15]. In Helicobacter pylori, HypA and HypB
have been shown to be part of the maturation of
urease also. This result is surprising because all the
genes for processing urease are found in the genome
of H. pylori [16,17].
In the final step of the maturation process, a
hydrogenase-specific protease cleaves the C-terminal
peptide from the large subunit. For each hydrogenase
there is a specific protease, and the uncleaved peptide
seems to stabilize the protein during the maturation
process [3]. Bioinformatic analysis suggests that the
two hydrogenases of cyanobacteria also need two dif-
ferent proteases for their proper processing [18].
Synechocystis sp. PCC 6803 harbours a single bidi-
rectional NiFe-hydrogenase. All the homologues of the
hyp genes are spread over the chromosome as single
genes or in different gene clusters [19]. Two homo-
logues of hypA and hypB are present. Because of
sequence similarities, we tentatively named the genes
slr1675 hypA1, sll1078 hypA2, sll1432 hypB1 and

sll1079 hypB2. The only hyp genes encoded in the same
gene cluster are hypA2 and hypB2. A similarity search
in the complete genome did not uncover a second copy
of hypC. In addition to these genes, slr2135 was anno-
tated as hydrogenase accessory (hupE) in the cyano-
base ( All the HupE
homologues are membrane proteins and are predicted
to contain at least six transmembrane helices. The
hupE of Rhizobium leguminosarum was hypothesized to
encode a nickel transporter [20].
In an attempt to characterize the genes needed for
the expression of an active hydrogenase in Synechocys-
tis, we deleted all of the hyp genes and hupE, and
characterized the corresponding mutants. Because it is
known that different copies of hypA and hypB can
complement each other in Ralstonia eutropha (now
renamed Cupriavidus necator) [21], the corresponding
double mutants were also constructed.
Results and Discussion
Characterization of hyp mutants
Deletion and insertion mutants of hypA1 (slr1675),
hypA2 (sll1078), hypB1 (sll1432), hypB2 (sll1079),
hypC, hypD, hypE, hypF, slr1876, and hupE were cre-
ated. The vectors constructed and the primers used to
amplify the DNA fragments are listed in Tables 1 and
2. After streaking transformants 5–6 times on agar
plates, they were tested for proper segregation by
Southern blotting or PCR. All mutants could be segre-
gated completely.
Hydrogenase activity measurements revealed that

the enzyme was only active in wild-type cells,
hypA2::Km, hypB2::Km and DhupE. None of the other
mutants exhibited hydrogenase activity (Fig. 1A). It
could thus be concluded that all of the investigated
hyp genes, apart from hypA2 and hypB2, are essential
for hydrogenase processing in Synechocystis.
Similarity searches in the genome of Synechocystis
using HoxW of R. eutropha and HycI of E. coli yielded
Slr1876 as the best candidate for a hydrogenase-speci-
fic protease with a similarity of 54 and 43%, respect-
ively. Because deletion of slr1876 resulted in a mutant
without hydrogenase activity, Slr1876 can be tenta-
tively assigned to the proteases needed to cleave the
C-terminus of the large hydrogenase subunit. It seems
appropriate to name it HoxW.
In order to rule out that any of the mutations affec-
ted the transcription of the hydrogenase structural
genes, all mutants were tested by RT-PCR. A hoxH
transcript was detected in all of them (Fig. 1B), con-
firming that the phenotype of the investigated hyp
mutants is not due to an abolished transcription.
D. Hoffmann et al. Cyanobacterial hydrogenase accessory genes
FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4517
Table 1. Bacterial strains and plasmids used in this study.
Strain or plasmid Description Source or reference
E. coli
DH5a Cloning strain
F
–
u80 dLacZM15 (lacZYA-argF) Invitrogen, Karlsruhe, Germany

U169 recA1 endA1 hsdR17(r
k
–
,m
k
+
)
phoA supE44
–
thi-1 gyrA96 relA1
Synechocystis
sp. PCC 6803
Wild-type, Lee McIntosh, East Lansing, MI, USA [41]
Plasmids
pBlueGM Source of Gm
r
cassette; amplified with
with Gen-up, Gen-down-primers, digested
with SalI and inserted in the SalI site of the pBlueskript SK
Derivative of pBlueskript
SK- with the Gm
r
-cassette
from pUC119 [42]
pBluescript SK- pUC19-derivative, with bla- and lacZ gene, Amp
r
Stratagene, Heidelberg, Germany
pGEM-T Cloning vector with T-overhangs at the
3¢-ends; T7- and Sp6-promotors;
lacZ gene; Amp

r
Promega, Madison,WI, USA
pHP45W Source of Sp
r
cassette Accession number K02163 [43]
pKS-CAT pBluescript SK-containing SspI–NaeI fragment of
pBR322 with Cm
r
cassette inserted into EcoRV site
This study
pMOSblue-T Cloning vector, Amp
r
Amersham, Freiburg, Germany
pUC-4K Source of Km
r
; Amp
r
Accession number X06404 [44]
phypA1 pGEM-T vector containing hypA1 (slr1675),
amplified with NhypA1 and ChypA1-primers
This study
phypA2 pGEM-T vector containing hypA2 (sll1078),
amplified with NhypA2 and ChypA2-primers
This study
phypB1 pMOSblue-T vector containing hypB1 (sll1432),
amplified with NhypB1 and ChypB1-primers
This study
phypB2 pMOSblue-T vector containing hypB2 (sll1079),
amplified with NhypB2 and ChypB2-primers
This study

phypC pGEM-T vector containing hypC (ssl3580),
amplified with NhypC and ChypC-primers
This study
phypD pGEM-T vector containing hypD (slr1498),
amplified with NhypD and ChypD-primers
This study
phypE pGEM-T vector containing hypE (sll1462),
amplified with NhypE and ChypE-primers
This study
phypF pGEM-T vector containing hypF (sll0322),
amplified with NhypF and ChypF-primers
This study
phoxW pGEM-T vector containing hoxW (slr1876),
amplified with NhoxW and ChoxW-primers
This study
pDA1 pGEM-T vector with DNA-fragments of
hypA1 for homologous recombination and an inserted Cm
r
cassette
This study
pDA2 pGEM-T vector with the hypA2 gene and an
inserted Km
r
cassette in the BclI –site
This study
pDB1 pMOSblue-T vector with the hypB1 gene and
an inserted Sp
r
cassette in the BalI sites
This study

pDB2 pMOSblue-T vector with the hypB2 gene and
an inserted Km
r
cassette in the EcoRI site
This study
pDC pGEM-T vector with DNA-fragments of hypC for
homologous recombination and an inserted Gm
r
cassette
This study
pDD pGEM-T vector with the hypD gene and an
inserted Sp
r
cassette in the Eco91I site
This study
pDE pGEM-T vector with the hypE gene and an
inserted Km
r
cassette in the BclI sites
This study
pDF pGEM-T vector with the hypF gene and an inserted Sp
r
cassette in the HindIII sites
This study
pDW pGEM-T vector with DNA-fragments of hoxW for
homologous recombination and an inserted Sp
r
cassette
This study
Cyanobacterial hydrogenase accessory genes D. Hoffmann et al.

4518 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS
To perform complementation studies a vector
(pDH1) was constructed that allows the expression of
any ORF under the control of the psbAII promotor.
Constructs of all different hyp genes were made.
Because pDH1 confers resistance to kanamycin it
could not be used to complement the DhypE mutant.
All constructs except those containing hypA2 and
hypB2 were able to restore hydrogenase activity to the
wild-type level in the respective mutants. This confirms
that the absence of hydrogenase activity was due to
the specific mutation and not to some unpredictable
side effects.
Function of hypA and hypB in hydrogenase
maturation
The function of hypA and hypB was investigated in
more detail. Because HypA and HypB were shown to
be involved in the insertion of nickel into the active
site of hydrogenases in E. coli [13–15], the respective
Synechocystis single- and double-mutants of hypA and
hypB were grown in medium supplemented with nickel.
Because we found nickel to inhibit growth and elicit
cell death at 50 lm, its concentration was not raised
above 15 lm to keep cells growing. Hydrogenase activ-
ity could be increased from 0% of the wild-type level
in the DhypA1 and DhypB1 to 19 and 30%, respect-
ively (Fig. 2). This suggests that hypA1 and hypB1 play
a role in the insertion of Ni
2+
into the cyanobacterial

hydrogenase.
As no changes in hydrogenase activity were detected
in hypA2 and hypB2 mutants compared with wild-type
cells, and neither was able to complement their respect-
ive counterparts in the DhypA1 and DhypB1, the tran-
scription of both genes was tested by RT-PCR. Both
hypA2 and hypB2 were shown to be transcribed, thus
ruling out that these additional homologues are silent
in Synechocystis (Fig. 3).
In H. pylori it was shown that the hydrogenase-
processing genes hypA and hypB have a dual func-
tion, as they are also necessary for proper processing
of the nickel-containing urease, despite, as in Syn-
echocystis, the respective genes ureE and ureG being
present in this organism [16,17]. The urease activity
of all hypA and hypB mutants (DhypA1,hypA2::Km,
DhypA1hypA2::Km, DhypB1,hypB2::Km, DhypB1-
hypB2::Km) was investigated. An enzyme activity of
0.025 UÆmg
)1
protein was measured, showing no dif-
ference compared with wild-type cells. Interference of
the urease- and hydrogenase-processing pathways in
Synechocystis, as described for H. pylori, was there-
fore excluded.
Table 1. (Continued).
Strain or plasmid Description Source or reference
pDhupE pGEM-T vector with DNA-fragments of hupE for homologous
recombination and an inserted Gm
r

cassette
This study
pSBA2 pCRII-TOPO with fragment amplified with the
primers N-PsbA2 and C-psbA2
This study
pDH1 pIGA [37] with KpnI
fragment of pSBA2 inserted into KpnI site cut with ScaI religated,
partially digested with SalI and religated, Km
r
This study
pDHA1 pDH1 vector containing SalI ⁄ NdeI hypA1 gene
of the phypA1vector inserted in the SalI ⁄ NdeI site
This study
pDHA2 pDH1 vector containing SalI ⁄ NdeI hypA2 gene
of the phypA2 vector inserted in the SalI ⁄ NdeI site
This study
pDHB1 pDH1 vector containing SalI ⁄ NdeI hypB1 gene
of the phypB1 vector inserted in the SalI ⁄ NdeI site
This study
pDHB2 pDH1 vector containing SalI ⁄ NdeI hypB2 gene
of the phypB2 vector inserted in the SalI ⁄ NdeI site
This study
pDHC pDH1 vector containing SalI ⁄ NdeI hypC gene
of the phypC vector inserted in the SalI ⁄ NdeI site
This study
pDHD pDH1 vector containing SalI ⁄ NdeI hypD gene
of the phypD vector inserted in the SalI ⁄ NdeI site
This study
pDHE pDH1 vector containing SalI ⁄ NdeI hypE gene
of the phypE vector inserted in the Sal

I ⁄ NdeI site
This study
pDHF pDH1 vector containing SalI ⁄ NdeI hypF gene
of the phypF vector inserted in the SalI ⁄ NdeI site
This study
pDHW pDH1 vector containing SalI ⁄ NdeI hoxW gene
of the phoxW vector inserted in the SalI ⁄ NdeI site
This study
D. Hoffmann et al. Cyanobacterial hydrogenase accessory genes
FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4519
Table 2. Primers used for the amplification of deletion constructs and RT-PCR. Underlined sequence corresponds to tag.
Name Gene Sequence Position
NhypA1 slr1675 AGTTAATCATATGCACGAAG 1955211–1955230
ChypA TAGGACTTGGTCGACGCTCAACTCAGT 1955553–1955579
P1hypA1 slr1675 ACCATCAGCACTAGCCGGGA 1954925–1954945
P2hypA1 AGCGAGGTGCCGCCATCAAGCTTAAC 1955528–1955555
AGTTGGAACTAGCATCCCTAGAAC
P3hypA1 TCAATAATATCGAATTCCTGCAGTTTGC 1955222–1955249
TCCATCAGACTAACTTCGTGCA
P4hypA1 CTCCTTCCGTTTTTCCGGTT 1955838–1955858
NhypA2 sll1078 CATATGCATGAAACAGACATGACCA 799958–799936
ChypA2 AGTGGATCCGTTAATAAAAAATTTAGTCTCG 799562–799583
NhypB1 sll1432 CATATGTGCCAAAACTGCGGTT 1908622–1908603
ChypB1 TTTTTCCTTCAACTCTTAG 1907749–1907767
NhypB2 sll1079 CATATGCACCAATCCATTGAC 799536–799518
ChypB2 TTTTACTGTGTTGATTTTGA 798812–798831
NhypC ssl3580 TCCTTTCCTCATATGTGTCTAGCC 1757503–1757526
ChypC TCTTAACTCGTCGACTTAAACTCCCAT 1754355–1754367
P1hypC ssl3580 TTGGGCATACTTTATCTGGC 1757218–1757238
P2hypC CGCCACCTAACAATTCGGTCGACTGAT 1757716–1757743

AGACTTGGCAGAAATGGGAGTTT
P3hypC GGTTCGTGCCTTCATCCGTCGACCAAC 1757515–1757542
CTGGCCAGGTAGGGCTAGACACA
P4hypC CATGGTTAGCCCCATTCATA 1758035–1758055
NhypD slr1498 CATATGAAATACGTTGATGAATATC 54533–54554
ChypD ATTGTCGGATCCCAGCAAAACT 55677–55656
NhypE sll1462 CATATGAACTTAGTCTGTCCCGTTCCC 992771–992749
ChypE CTTGTCGACTGGAGTCCTAACAAATACGG 991728–991747
NhypF sll0322 CATATGTTAAAAACCGTTGCCATACAG 2434762–2434739
ChypF GGATCCAGTTGAGTTAACAGATATATTGC 2432452–2432474
NhoxW slr1876 CATATGCCAGGCCAATCCACCA 1227090–1227108
ChoxW ATTTTGAGGATCCCTTGGCTTTATC 1227559–1227583
P1hoxW slr1876 GTGGACTTGATTAGTTAATT 1226794–1226814
P2hoxW TGCTCAATCAATCACCGGATCCCTCCG 1227535–1227562
CCCCTTGGTATTGGGGGAGAGAT
P3hoxW TTGGCACCCAGCCTGCGCGATTAAAGT 1227091–1227121
GGACTTGGTGGATTGGCCTGGCA
P4hoxW AGTTACCAAATACCAAGAAT 1227841–1227861
P1hupE slr2135 ACATCTACCACCGCCACAGG
1260919–1260938
P2hupE GGTTCGTGCCTTCATCCGTCGACTTTCCT 1261212–1261192
CCCTTTTTCCACAGG
P3hupE CGCCACCTAACAATTCGGTCGACCTTATG 1261997–1262016
GGATAATAGGTTGC
P4hupE TTGTAATTTCTGCTTGATATC 1262321–1262301
Gm-up TGACGCACCTCGAGTCGACGGATGA
AGGCACGAACCCAGT
Gm-down GAAGCCGATCTAGAGTCGACCGAATT
GTTAGGTGGCGGTACTT
F-psbA2 GATTGCGGCTTTAGGGTACCAGTG 6721–6744

R-psbA2 TGTTGGAGAGTCGGTACCATATGGTTA 7222–7248
Primer for RT-PCR:
og46–57
tag1 sll1226 CTGAGACCGTGTGCGTTGCGAATGTAGTGT
a
1672231–1672245
og46–57
tag2 sll1226 CTGAGACCGTGTGCGTTGCGAAT 1672231–1672238
og46–7a sll1226 TATGGGCTTAGTTGGGAAAA 1672805–1672824
hypB1-
tag1 sll1432 AGACCGTGTGCGAGTTGCCATTGATCCAAA 1907805–1907821
hypB1-
tag2 sll1432 AGACCGTGTGCGAGTTGCCATT 1907805–1907814
hypB1 sll1432 CGGTTGTAGTGCGGTGGGAA 1908607–1908588
hypB2-
tag1 sll1079 AGACCGTGTGCGAAACTATCATCGGTACTTTA 798855–798873
Cyanobacterial hydrogenase accessory genes D. Hoffmann et al.
4520 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS
Investigations of the immediate vicinity of hypA2
and hypB2 on the chromosome revealed an ORF
annotated as an agmatinase (speB2, sll1077) directly
upstream of hypA2. Studies on arginine catabolism in
Synechocystis could not clearly assign the substrate of
SpeB2 [22]. Agmatinases belong to arginase-related
enzymes that catalyse the splitting of guanidinium
groups to urea and amino compounds. Arginases are
known to contain a binuclear manganese active site
[23–25]. The complete sequences of all available cyano-
bacterial strains show homologues to speB2 in
Synechococcus WH 8102, Synechococcus WH 5701,

Synechococcus CC 9605, and Synechococcus sp.
PCC 7002. Strikingly, in all cases, genes highly sim-
ilar to hypA and hypB are situated immediately
downstream on the chromosome (Fig. S1). The trans-
ition metal inserted into the active site of SpeB2 might
be manganese, nickel or cobalt. Whether HypA2 and
HypB2 are metallochaperones involved in the process-
ing of this enzyme needs to be further investigated.
Table 2. (Continued).
Name Gene Sequence Position
hypB2-
tag2 sll1079 AGACCGTGTGCGAAACTATCA 798855–798862
hypB2 sll1079 AAGTGAGTTAAAAATGGCGGTT 799362–799341
hypA2 sll1078 CATATGCATGAAACAGACATGACCAA 799958–799936
ureC-
tag1 sll1750 AGACCGTGTGCGATTAACATGTCTAGATG 560216–560231
ureC-
tag2 sll1750 AGACCGTGTGCGATTAACATG 560216–560223
ureC sll1750 AGCTACGCCCACACCTTT 561146–561129
ureG-
tag1 sll0643 AGACCGTGTGCGA 430737–430758
CACTCTCCAAAAACACCATATCCA
ureG-
tag2 sll0643 AGACCGTGTGCGACTCTCCAA 430737–430744
ureG sll0643 AAGCCTTGAGGCAAAAATATCAATTG 430965–430940
Fig. 1. (A) Hydrogenase activity of wild-type cells and of deletion mutants of the hydrogenase accessory genes and DhupE. (B) RT-PCR with
RNA of wild-type and all the deletion mutants of the hyp genes and hoxW. For each strain, the reaction including reverse transcription (+)
and a negative control without reverse transcription was applied.
D. Hoffmann et al. Cyanobacterial hydrogenase accessory genes
FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4521

Effect of deletion of hupE on metal uptake
Homologues of hupE ⁄ ureJ are widespread among
bacteria and are frequently found in hydrogenase or
urease gene clusters. Because urease and hydrogenase
are nickel-dependent enzymes, the encoded proteins
were suggested to belong to a family of nickel ⁄ cobalt
transporters with six to seven transmembrane helices,
and were subsequently shown to transport nickel in
the proteobacterium Rhodopseudomonas palustris
[26,27]. Moreover, because hupE is annotated as a
hydrogenase accessory gene in the cyanobase, we
investigated the effect of its deletion on hydrogenase
and urease activity and metal transport.
Surprisingly, DhupE did not show a difference com-
pared with wild-type cells concerning its hydrogenase
activity (Fig. 1A) or its urease activity (data not
shown), although the nickel content of the BG-11 med-
ium used was beyond the detection limit (1.7 nm).
Moreover, its growth did not differ from that of wild-
type cells under normal conditions (Fig. 4). We there-
fore used the metal chelator nitrilotriacetate added to
the medium to compare the growth of mutant and
wild-type cells. Whereas the growth rate of wild-type
cells was reduced to about half that of the control, the
mutant was no longer able to grow at all, supporting
the hypothesis that HupE is a metal transporter
(Fig. 4).
As shown in Fig. 4A, the growth inhibitory effect
of nitrilotriacetate in case of the hupE mutant was
partially antagonized by the addition of methionine,

whereas the effect on wild-type cells was only margi-
nal. In Synechocystis, methionine is synthesized by the
methionine synthase MetH, which catalyses a cobal-
amin-dependent methyl transfer from methyl tetra-
hydrofolate to homocysteine. In the total genome no
other enzymes catalysing the last step of methionine
synthesis, for example MetE, could be found. There-
fore, this experiment suggests that the mutant is
suffering from cobalt limitation. It also shows that
nickel-dependent enzymes like hydrogenase and urease
are not essential for growth in Synechocystis, because
under these conditions trace amounts of nickel should
be masked quantitatively by nitrilotriacetate. This is in
accordance with previous results showing that lack of
NiFe-hydrogenase has no influence on growth in Syn-
echocystis [28] and that deletion of the urease yields
viable mutants in Synechococcus sp. PCC 7002 [29].
Growth of the mutant was also resumed by the
addition of cobalt at a concentration of 100 lm. This
is in clear contrast to wild-type cells, in which no
Fig. 2. Hydrogenase activity of cultures of wild-type cells and the
hypA- and hypB-deletion mutants grown with the addition of nickel
up to a concentration of 15 l
M.
Fig. 3. Agarose gel electrophoresis of RT-PCRs of transcripts of hypB1, hypB2, hypA2B2, ureG and ureC. RT-PCR of wild-type RNA was
performed as described in the Experimental procedures. For each RT-PCR a reaction including reverse transcription (+), and a negative con-
trol without reverse transcription (–) was applied. On the left marker bands are indicated.
Cyanobacterial hydrogenase accessory genes D. Hoffmann et al.
4522 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS
difference could be detected in the presence of nitrilo-

triacetate with or without the addition of cobalt
(Fig. 4B). By adding 200 lm cobalt, the growth of the
mutant could be increased further, but above this con-
centration toxic effects began to show, and no increase
in growth rate could be attained at 300 lm cobalt. A
growth-inhibitory effect was detectable at 200 lm in
wild-type cells (data not shown). Therefore, DhupE is
dependent on additional supplementation, whereas
wild-type cells do not suffer from cobalt limitation.
The addition of nickel to the medium supplemented
with nitrilotriacetate increased growth of both the
hupE deletion mutant and wild-type cells. Addition of
100 lm Ni
2+
allowed wild-type cells to grow almost as
fast as controls, whereas the growth-inhibitory effect
of nitrilotriacetate could not be abolished in DhupE.
However, by adding 200 and 300 lm, growth could be
continuously increased. Above 300 lm Ni
2+
no further
increase could be elicited, probably because of toxic
effects (data not shown). Because nickel is bound by
nitrilotriacetate with a six times higher affinity than
cobalt [30], the addition of nickel shifts the binding
equilibrium of the cobalt in the medium to higher con-
centrations of the free ion. The added nickel also
allows the expression of urease and hydrogenase in the
cells and leads to an increased growth rate in wild-type
cells. Taking these results into consideration, we

assume that HupE is a cobalt transporter. Whether
HupE is also able to transport nickel remains to be
shown. Nevertheless, it should be concluded from our
results that there is another uptake pathway apart
from HupE for nickel in Synechocystis that allows the
mutant to take up nickel at concentrations < 1.7 nm.
Recent bioinformatic analysis of a large set of bacterial
genomes suggests that the five genes sll0381 to sll0385
encode an ATP-dependent nickel transporter in Syn-
echocystis [31].
Transport of cobalt by HupE is supported by a
suggested vitamin B12-dependent riboswitch which was
detected upstream of its gene [32]. This type of
riboswitch is thought to be involved in the vitamin B12-
dependent transcriptional regulation of downstream
genes. Our growth analysis supports the suggestion that
HupE is needed for the expression of a functional
methionine synthase that is dependent on vitamin B12.
These results are also very interesting regarding
investigations of the demand for cobalt in marine
cyanobacteria [33,34]. It is plausible that the investi-
gated strains Prochlorococcus and Synechococcus need
a specific cobalt transporter. Similarity searches in the
Fig. 4. Growth curves of wild-type cells and DhupE in the absence or presence of nitrilotriacetate (NTA). (A) Growth of wild-type cells and
DhupE in the presence of nitrilotriacetate supplemented with 0.25 l
M methionine. (B) Wild-type cells and DhupE grown in the presence of
nitrilotriacetate and different cobalt concentrations. (C) Wild-type cells and DhupE grown in the presence of nitrilotriacetate and different
nickel concentrations. The control curves in normal medium without additions are shown for comparison.
D. Hoffmann et al. Cyanobacterial hydrogenase accessory genes
FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4523

marine Synechococcus WH 8102 and the Prochlorococ-
cus strains available at cyanobase revealed the presence
of orthologues to hupE in all their genomes.
Experimental procedures
Cultivation and growth experiments
Synechocystis sp. PCC 6803 was grown in BG-11 medium
as described previously [28]. Transformants were selected
on BG-11 agar plates containing 50 lgÆmL
)1
kanamycin,
25 lgÆmL
)1
chloramphenicol, 20 lgÆmL
)1
spectinomycin or
5 lgÆmL
)1
gentamicin, respectively. Total segregation was
checked by PCR and Southern hybridization. For growth
experiments cultures were bubbled with air.
Cloning procedures
DNA cloning and PCR amplification were performed using
standard procedures [35]. In order to construct the deletion
mutants (Table 1) the primers listed in Table 2 were used
to amplify DNA fragments. Using two different strategies,
an antibiotic resistance cassette was transferred into the
respective gene for the following homologous recombina-
tion into the genome. The hypB1 and hypB2 genes were
cloned into the pMOSblue-T vector (Amersham, Freiburg,
Germany) and hypA2, hypD, hypE and hypF were cloned

into the pGEM-T vector (Promega, Madison, WI, USA).
The respective antibiotic resistance cassette was then inser-
ted after restriction digests. The mutants of hypA1, hypC
and hoxW were produced through a PCR fusion, adapted
from Chenchick et al. [36], of 300 bp PCR products made
from the regions up- and downstream of the gene with a
resistance cassette. The PCR fusion (step 1, 95 °C for
1 min; step 2, 95 °C for 30 s; step 3, 60 °C for 5 min; step
4, 68 °C for 25 min; 30 cycles from step 2 to step 4) was
accomplished by complementary overhangs of the primers
P2 and P3 (Table 2) with the antibiotic resistance cassette.
To express the hyp genes in a different locus a vector was
constructed using the constructed pIGA vector of Kunert
et al. [37]. For this purpose the psbAII promotor was ampli-
fied with the primers FpsbA2 and RpsbA2 (Table 1). The
resulting fragment was cut with KpnI and ligated in the KpnI
site of pIGA. This vector was digested with ScaI and religat-
ed. The resulting vector was partially digesting with SalI and
after blunt ending with Klenow religated to yield the vector
pMK1. In the NdeI and SalI of the pDH1 the amplified
ORFs of the different hyp genes were inserted. All constructs
were sequenced before transformation in Synechocystis.
Southern blot hybridization
For Southern analyses, genomic DNA was isolated from
Synechocystis cells grown on agar plates. Cells were
resuspended in 100 lL TE buffer (10 mm Tris, 1 mm Na
2
-
EDTA, pH 8.0) and the suspension was supplemented with
an equal volume of glass beads (0.5 mm diameter), 2 lLof

a 10% (w ⁄ v) SDS solution and 100 lL phenol ⁄ chloro-
form ⁄ isoamylalcohol (25 : 24 : 1 v ⁄ v ⁄ v). The mixture was
vortexed three times for 10 s and then centrifuged at
10 000 g for 10 min. The supernatant was extracted once
with phenol ⁄ chloroform ⁄ isoamylalcohol and twice with
chloroform ⁄ isoamylalcohol (24 : 1 v ⁄ v) and centrifuged at
10 000 g for 2 min, respectively. The DNA was precipitated
by the addition of 1 ⁄ 10 volume sodium acetate (3 m,
pH 6.5) and 2.5 · volume of 100% ethanol for 2 h at
)20 °C. After centrifugation (15 700 g for 15 min at )8 °C),
the pellet was washed with 70% ethanol. Then the pellet
was dried in a vacuum centrifuge and resuspended in 20 lL
TE buffer overnight at 4 °C. Southern hybridization was
carried out with the Dig-system (Roche Diagnostics GmbH,
Mannheim, Germany) as described by the manufacturer.
RNA isolation and RT-PCR
Total RNA from Synechocystis was isolated by phenol–
chloroform extraction [38]. After precipitating the nucleic
acids, the pellet was dried and resuspended in TE buffer.
An equal volume of 5 m LiCl was added and the mixture
was incubated for 1.5 h at )20 °C. The DNA-containing
supernatant was removed after centrifuging at 18 000 g for
30 min at )8 °C. The LiCl precipitation of RNA was
repeated with the pellet for a second time. The RNA pellet
was resuspended in a small volume of water and treated
with DNase I (Roche, Mannheim, Germany), extracted first
with phenol ⁄ chloroform ⁄ isoamylalcohol (25 : 24 : 1 v ⁄ v ⁄ v)
and then twice with chloroform ⁄ isoamylalcohol (24 : 1
v ⁄ v). Sodium acetate (3 m, pH 6.5) in an amount equalling
1 ⁄ 10 of the extract volume and ethanol ()20 °C) corres-

ponding to 2.5 times of the extract volume was added. The
mixture was incubated for 30 min at )80 °C. After centrifu-
gation (20 min at 15 000 g at 4 ° C) the RNA pellet was
washed with 70% ethanol, dried and resuspended in a small
volume of water.
cDNA was synthesized with a tagged primer (Table 2)
that annealed with 15–19 nucleotides specific to the cor-
responding gene and carried a tag of 13–14 nucleotides at
its 5¢-end as a target for subsequent PCR according to
the method of Cobley et al. [39]. Five hundred nanograms
of RNA were incubated with 5 pmol primer and 20 nm
dNTPs for 5 min at 65 °C. The reaction was chilled
on ice. Subsequently, 5· buffer (Invitrogen, Karlsruhe,
Germany) and 40 U RNase Inhibitor (MBI Fermentas,
St. Leon-Rot, Germany) were added. After incubating the
mixture at 42 °C for 2 min, 200 U Superscript II (Invitro-
gen) was added. In a control reaction the reverse tran-
scriptase was replaced by water. Reverse transcription was
performed at 42 °C for 50 min. The reaction was termin-
Cyanobacterial hydrogenase accessory genes D. Hoffmann et al.
4524 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS
ated by incubating at 70 °C for 15 min. Then the reaction
was immediately chilled on ice and treated with 3 U
RNaseH (Roche, Mannheim, Germany). An aliquot of
2 lL of the RT reaction was used to amplify the cDNA
with a gene specific and an adapter specific primer
(Table 2).
Hydrogen measurements
Hydrogenase activity was determined by a H
2

-evolution
assay using dithionite and methylviologen as electron donor
as described by Appel et al. [28] but with a Clark-type elec-
trode from Hansatech (DW 1 Liquid Clark electrode, Hansa-
tech Institute, Norfolk, UK). The electrode was connected
to a lab-made control box with a voltage of )600 mV.
Urease measurements
Urease activity was determined according to the method of
Kaltwasser & Schlegel [40] with a 0.04 m Tris buffer
(pH 8.0), 0.8 mm alpha-ketoglutarate, 0.03 m urea and 9 U
glutamate dehydrogenase in the assay mixture of 1 mL.
The activity was measured at 366 nm with a spectropho-
tometer (Shimadzu UV-2501PC, Kyoto, Japan) at 30 °C.
Detection of nickel and cobalt
Nickel and cobalt concentrations were determined using
AAnalyst300 (Perkin-Elmer, Boston, MA, USA) with
standards of nickel and cobalt from Johnson & Matthey
(Zurich, Switzerland).
Acknowledgements
Financial support from Linde AG, Innovations-
Stiftung Schleswig-Holstein and Studienstiftung des
deutschen Volkes are gratefully acknowledged. Special
thanks to T. Eitinger (Humboldt-University, Berlin)
for helpful discussions. We thank Sabine Karg and
Monika Schneeweiss for excellent technical assistance.
References
1 Volbeda A, Charon MH, Piras C, Hatchikian EC, Frey
M & Fontecilla-Camps JC (1995) Crystal structure of
the nickel–iron hydrogenase from Desulfovibrio gigas.
Nature 373, 580–587.

2 Happe RP, Roseboom W, Pierik AJ, Albracht SPJ &
Bagley KA (1996) Biological hydrogen production.
Nature 385, 126.
3 Blokesch M, Paschos A, Theodoratou E, Bauer A,
Hube M, Huth S & Bo
¨
ck A (2002) Metal insertion into
NiFe-hydrogenases. Biochem Soc Trans 30, 674–680.
4 Paschos A, Glass RS & Bo
¨
ck A (2001) Carbamoylpho-
sphate requirement for synthesis of the active center of
[NiFe]-hydrogenases. FEBS Lett 488, 9–12.
5 Paschos A, Bauer A, Zimmermann A, Zehelein E &
Bo
¨
ck A (2002) HypF, a carbamoyl phosphate-convert-
ing enzyme involved in [NiFe] hydrogenase maturation.
J Biol Chem 277, 49945–49951.
6 Reissmann S, Hochleitner E, Wang H, Paschos A,
Lottspeich F, Glass RS & Bo
¨
ck A (2003) Taming of a
poison: biosynthesis of the NiFe-hydrogenase cyanide
ligands. Science 299, 1067–1070.
7 Blokesch M, Paschos A, Bauer A, Reissmann S, Drapal
N&Bo
¨
ck A (2004) Analysis of the transcarbamoyla-
tion–dehydration reaction catalyzed by the hydrogenase

maturation proteins HypF and HypE. Eur J Biochem
271, 3428–3436.
8 Blokesch M & Bo
¨
ck A (2002) Maturation of [NiFe]-hy-
drogenases in Escherichia coli: the HypC cycle. J Mol
Biol 324, 287–296.
9 Drapal N & Bo
¨
ck A (1998) Interaction of the hydroge-
nase accessory protein HypC with HycE, the large sub-
unit of Escherichia coli hydrogenase 3 during enzyme
maturation. Biochemistry 37, 2941–2948.
10 Magalon A & Bo
¨
ck A (2000) Analysis of the HypC–
hycE complex, a key intermediate in the assembly of the
metal center of the Escherichia coli hydrogenase 3.
J Biol Chem 275, 21114–21120.
11 Maroti G, Fodor BD, Rakhely G, Kovacs AT, Arvani
S & Kovacs KL (2003) Accessory proteins functioning
selectively and pleiotropically in the biosynthesis of
[NiFe] hydrogenases in Thiocapsa roseopersicina. Eur J
Biochem 270, 2218–2227.
12 Fu C, Olson JW & Maier RJ (1995) HypB protein of
Bradyrhizobium japonicum is a metal-binding GTPase
capable of binding 18 divalent nickel ions per dimer.
Proc Natl Acad Sci USA 92, 2333–2337.
13 Maier T, Jacobi A, Sauter M & Bo
¨

ck A (1993) The
product of the hypB gene, which is required for
nickel incorporation into hydrogenases, is a novel
guanine nucleotide-binding protein. J Bacteriol 175,
630–635.
14 Maier T, Lottspeich F & Bo
¨
ck A (1995) GTP
hydrolysis by HypB is essential for nickel insertion
into hydrogenases in E. coli. Eur J Biochem 230, 133–
138.
15 Blokesch M, Rohrmoser M, Rode S & Bo
¨
ck A (2004)
HybF, a zinc-containing protein involved in NiFe
hydrogenase maturation. J Bacteriol 186, 2603–2611.
16 Olson JW, Metha NS & Maier RJ (2001) Requirement
of nickel metabolism proteins HypA and HypB for full
activity of both hydrogenase and urease in Helicobacter
pylori. Mol Microbiol 39, 176–182.
17 Mehta N, Olson JW & Maier RJ (2003) Characteriza-
tion of Helicobacter pylori nickel metabolism accessory
D. Hoffmann et al. Cyanobacterial hydrogenase accessory genes
FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4525
proteins needed for maturation of both urease and
hydrogenase. J Bacteriol 185, 726–734.
18 Wu
¨
nschiers R, Batur M & Lindblad P (2003) Pre-
sence and expression of hydrogenase specific C-terminal

endopeptidases in cyanobacteria. BMC Microbiol 3,8.
19 Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E,
Nakamura Y, Miyajima N, Hirosawa M, Sugiura M,
Sasamoto S et al. (1996) Sequence analysis of the gen-
ome of the unicellular cyanobacterium Synechocystis sp.
PCC 6803. II. Sequence determination of the entire gen-
ome and assignment of potential protein-coding regions.
DNA Res 3, 109–136.
20 Ruiz-Argu
¨
eso T, Palacios JM & Imperial J (2000)
Uptake hydrogenases in root nodule bacteria. In Pro-
karyotic Nitrogen Fixation. A Model System for the
Analysis of a Biological Process (Triplett EW, ed.),
pp. 489–507. Horizon Scientific Press, Norfolk.
21 Wolf I, Buhrke T, Dernedde J, Pohlmann A &
Friedrich B (1998) Duplication of hyp genes involved in
maturation of [NiFe] hydrogenases in Alcaligenes eutro-
phus H16. Arch Microbiol 170, 451–459.
22 Quintero MJ, Muro-Pastor AM, Herrero A & Flores E
(2000) Arginine catabolism in the cyanobacterium Syne-
chocystis sp. strain 6803 involves the urea cycle and
arginase pathway. J Bacteriol 182, 1008–1015.
23 Perozich J, Hempel J & Morris SM Jr (1998) Roles of
conserved residues in the arginase family. Biochim
Biophys Acta 1382, 23–37.
24 Kanyo ZF, Scolnick LR, Ash DE & Christianson DW
(1996) Structure of a unique binuclear manganese clus-
ter in arginase. Nature 383, 554–557.
25 Christianson DW & Cox JD (1999) Catalysis by metal-

activated hydroxide in zinc and manganese metallo-
enzymes. Annu Rev Biochem 68, 33–57.
26 Eitinger T, Suhr J, Moore L & Smith AC (2005) Sec-
ondary transporters for nickel and cobalt ions: theme
and variations. Biometals 18, 399–405.
27 Hebbeln P & Eitinger T (2004) Heterologous production
and characterization of bacterial nickel ⁄ cobalt permeases.
FEMS Microbiol Lett 230, 129–135.
28 Appel J, Phunpruch S & Schulz R (2000) The bidirec-
tional hydrogenase of Synechocystis sp. PCC 6803
works as an electron valve during photosynthesis. Arch
Microbiol 173, 333–338.
29 Sakamoto T, Delgaizo VB & Bryant DA (1998) Growth
on urea can trigger death and peroxidation of the cyano-
bacterium Synechococcus sp. strain PCC 7002. Appl
Environ Microbiol 64, 2361–2366.
30 Schwarzenbach G & Biedermann W (1948) Titration
von Metallen mit Nitrilotriessigsa
¨
ure H
3
X. Endpunkts-
indikation durch pH-Effekte. Helv Chim Acta 31, 331–
340.
31 Rodionov DA, Hebbeln P, Gelfand MS & Eitinger T
(2006) Comparative and functional genomic analysis of
prokaryotic nickel and cobalt transporters: evidence for
a novel group of ATP-binding cassette transporters.
J Bacteriol 188, 317–327.
32 Rodionov DA, Vitreschak AG, Mironov AA & Gelfand

MS (2003) Comparative genomics of the vitamin B12
metabolism and regulation in prokaryotes. J Biol Chem
278, 41148–41159.
33 Saito MA, Moffett JW, Chisholm SW & Waterbury JB
(2002) Cobalt limitation and uptake in Prochlorococcus.
Limnol Oceanogr 47, 1629–1636.
34 Saito MA, Rocap G & Moffett JW (2005) Production
of cobalt ligands in a Synechococcus feature, the
Costa Rica upwelling dome. Limnol Oceanogr 50,
279–290.
35 Sambrook J & Russell DW (2001) Molecular Cloning:
A Laboratory Manual. Cold Spring Habor Laboratory
Press, Cold Spring Harbor, NY.
36 Chenchik A, Moqadam F & Siebert PD (1996) A new
method for fullength cDNA cloning by PCR. In A
Laboratory Guide to RNA: Isolation, Analysis and Synth-
esis (Krieg PA, ed.), pp. 273–321. Wiley-Liss, New York.
37 Kunert A, Hagemann M & Erdmann N (2000) Con-
struction of promoter probe vectors for Synechocystis
sp. PCC 6803 using the light-emitting reporter systems
GFP and LuxAB. J Microbiol Methods 41, 185–194.
38 Golden SS, Brusslan J & Haselkorn R (1987) Genetic
engineering of the cyanobacterial chromosome. Methods
Enzymol 153, 228–229.
39 Cobley JG, Clark AC, Weerasurya S, Queseda FA,
Xiao JY, Bandrapali N, D’Silva I, Thounaojam M,
Oda JF, Sumiyoshi T et al. (2002) CpeR is an activa-
tor required for expression of the phycoerythrin
operon (cpeBA) in the cyanobacterium Fremyella dip-
losiphon and is encoded in the phycoerythrin linker–

polypeptide operon (cpeCDESTR). Mol Microbiol 44,
1517–1531.
40 Kaltwasser H & Schlegel HG (1966) NADH-dependent
coupled enzyme assay for urease and other ammonia-
producing systems. Anal Biochem 16, 132–138.
41 Smart LB, Anderson SL & McIntosh L (1991) Genetic
inactivation of the photosystem I reaction center in the
cyanobacterium Synechocystis sp. PCC 6803. EMBO J
10, 3289–3296.
42 Wohlleben W, Arnold W, Bissonnette L, Pelletier A,
Tanguay A, Roy PH, Gamboa GC, Barry GF, Aubert
E, Davies J et al. (1989) On the evolution of Tn21-like
multiresistance transposons: sequence analysis of the
gene (aacC1) for gentamicin acetyltransferase-3-I
(AAC(3)-I), another member of the Tn21-based expres-
sion cassette. Mol Gen Genet 217, 202–208.
43 Prentki P & Krisch HM (1984) In vitro insertional
mutagenesis with a selectable DNA fragment. Gene 29,
303–313.
44 Taylor LA & Rose RE (1988) A correction in the
nucleotide sequence of the Tn903 kanamycin resistance
determinant in pUC4K. Nucleic Acids Res 16, 358.
Cyanobacterial hydrogenase accessory genes D. Hoffmann et al.
4526 FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS
Supplementary material
The following supplementary material is available
online:
Fig. S1. All the available cyanobacterial genomes were
screened for the presence of speB2 homologs. The
genetic maps of regions in the vicinity of all the speB2

found in other cyanobacteria and in Rhizobium species
NGR234 are shown.
This material is available as part of the online article
from
FEBS Journal 273 (2006) 4516–4527 ª 2006 The Authors Journal compilation ª 2006 FEBS 4527
D. Hoffmann et al. Cyanobacterial hydrogenase accessory genes