Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx

A chimeric scorpion a-toxin displays
de novo
electrophysiological
properties similar to those of a-like toxins
Balkiss Bouhaouala-Zahar
1
, Rym Benkhalifa
1
, Najet Srairi
1
, Ilhem Zenouaki
1
, Caroline Ligny-Lemaire
2
,
Pascal Drevet
2
, Franc¸ois Sampieri
3
, Marcel Pelhate
4
, Mohamed El Ayeb
1
, Andre
´
Me
´
nez
2
, Habib Karoui
1

and Fre
´
de
´
ric Ducancel
2
1
Laboratoire des Venins et Toxines, Institut Pasteur de Tunis, Tunisia;
2
De
´
partement d’Inge
´
nierie et d’E
´
tude des Prote
´
ines,
CEA, Saclay, France;
3
UMR 6560, Universite
´
de la Me
´
diterrane
´
e, CNRS, Inge
´
nierie des Prote
´

ines, Laboratoire de Biochimie,
IFR Jean-Roche, Faculte
´
de Me
´
decine Nord, Marseille, France;
4
Laboratoire de Neurophysiologie UPRES EA 2647,
UFR Sciences, Angers, France
BotXIV and LqhaIT are two structurally related long chain
scorpion a-toxins that inhibit sodium current inactivation in
excitable cells. However, while LqhaIT from Leiurus
quinquestriatus hebraeus is classified as a true and strong
insect a-toxin, BotXIV from Buthus occitanus tunetanus is
characterized by moderate biological activities. To assess the
possibility that structural differences between these two
molecules could reflect the localization of particular func-
tional topographies, we compared their sequences. Three
structurally deviating segments located in three distinct and
exposed loops were identified. They correspond to residues
8–10, 19–22, and 38–43. To evaluate their functional role,
three BotXIV/LqhaIT chimeras were designed by transfer-
ring the corresponding LqhaIT sequences into BotXIV.
Structural and antigenic characterizations of the resulting
recombinant chimera show that BotXIV can accommodate
the imposed modifications, confirming the structural flexi-
bility of that particular a/b fold. Interestingly, substitution of
residues 8–10 yields to a new electrophysiological profile of
the corresponding variant, partially comparable to that one
of a-like scorpion toxins. Taken together, these results

suggest that even limited structural deviations can reflect
functional diversity, and also that the structure–function
relationships between insect a-toxins and a-like scorpion
toxins are probably more complex than expected.
Keywords: chimeric scorpion toxin; insect sodium channel;
sodium current kinetics; molecular modelling.
Long-chain scorpion toxins isolated from Androctonus
australis hector and Buthus occitanus tunetanus scorpions
[1,2] are responsible for human envenomation, a public
heath problem in Tunisia [3]. These small and basic
polypeptides, composed of a globular core compacted by
four disulfide bridges, bind and modulate sodium channels
in excitable cells [4,5]. They have been divided into a- [6,7]
and b-toxins [8,9] according to their mode of action and
binding properties [10,11].
Whereas b-toxins interfere with the current activation
stage, a-toxins inhibit sodium current inactivation in
excitable cells (reviewed in [10,11]). a-Toxins have been
instrumental in functional mapping of voltage gated sodium
channels [12,13] and display a wide array of preferences on
interaction with sodium channels of different animal phyla
[10].
Scorpion a-toxins are classically divided into the follow-
ing three groups: (a) mammal a-toxins that are highly active
on mammals, and display very low toxicity to insects,
e.g. AahII toxin from the venom of the scorpion Androct-
onus australis hector; (b) insect a-toxins that are highly toxic
to insect and shows weak activity in mammalian central
nervous system, e.g. LqhaIT from Leiurus quinquestriatus
hebraeus scorpion; (c) a-like toxins, that display similar high

toxicity to both mammals and insects, e.g. BomIII and
BomIV [11,14] from Buthus occitanus mardochei and LqhIII
from Leiurus quinquestriatus hebraeus scorpions [15].
Classically, binding of scorpion a-toxins to the receptor
site 3 on the extracellular surface of sodium channels
induces prolongation of action potentials due to selective
inhibition or slowing of the fast inactivation process of the
sodium current in vertebrate and insect electrophysiological
preparations [12,16,17]. Interestingly, and despite some
differences in their primary structure, all scorpion a-toxins
that compete for binding to receptor site 3 on sodium
channel reveal similar effects of inhibition [11,12,14,18].
However, some comparative studies make uncertain the
strict assignment of many toxins to a particular pharmaco-
logical group [11,17]. Thus, scorpion a and a-like toxins
share similar and competitive binding activities towards
insect sodium channels, when this is not the case in rat brain
synaptosomes [17]. These observations support the existence
of two distinct receptor sites for a and a-like toxins on
sodium channels, the latter being more or less related in
mammals or insects. On the other hand, LqhaIT one of the
most studied insect a-toxins, seems to share some pharma-
cological properties with a-like toxins [17], suggesting that
the receptor sites recognized by both families of toxins either
Correspondence to B. Bouhaouala-Zahar, Laboratoire des Venins
et Toxines, Institut Pasteur de Tunis, 13 Place Pasteur, Belve
´
de
`
re,

Tunis, 1002 Tunisia.
Fax: + 216 71 791 833, Tel.: + 216 71 1843 755,
E-mail:
Abbreviations:BotXIV,a-toxin from the venom of Buthus occitanus
tunetanus;LqhaIT, a-toxin from the venom of Leiurus quinquestriatus
hebraeus; TSB, tryptic soy broth; AP, action potential.
(Received 26 November 2001, revised 13 March 2002,
accepted 5 April 2002)
Eur. J. Biochem. 269, 2831–2841 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02918.x
partially overlap, or are closely localized on insect sodium
channels. Furthermore, recent data mentioned the possibility
that LqhaIT could have a weak effect on sodium channels
activation, an activity classically attributed to a-like toxins
even if such activity is not very significant [17]. Clearly,
additional data are necessary to tentatively elucidate the
structure–function relationship of a-toxins in general, and
between insect a-toxins and a-like toxins in particular.
Recently, we cloned and characterized a new insect
a-toxin from the venom of the scorpion Buthus occitanus
tunetanus called BotXIV [19]. We showed that BotXIV
shows 49.25 and 52.23% identities with LqhaIT and
LqqIII, respectively, and is not toxic on mice even at high
concentration [up to 2.5 lg per 20 g of body weight at
intracerebroventricularly (i.c.v.) route]. However, unlike
other insect a-toxins, BotXIV displays a weak anti-insect
activity, a moderate toxicity to cockroach and slows only
the inactivation process of insect sodium channels. Also,
comparison of BotXIV with BomIV, a classical member of
a-like toxins [11] revealed 57% of amino-acid identity, as
compared to the 73% existing identity between LqhaIT and

BomIV. These data suggest that a-like toxins form a large
family of structurally related compounds, displaying similar
basic biological properties, but susceptible also of expressing
particular activities.
The aim of this paper was to tentatively explore the
possibility that subtle structural deviations between BotXIV
and LqhaIT, could reflect the localization of a particular
functional topography. Such a relation was recently
evidenced in the case of three fingered toxins from snakes
[20,21]. To investigate this hypothesis, we compared in
detailed the amino-acid sequences of BotXIV and LqhaIT,
and searched for significant differences. Thus, we identified
three different stretches of amino acid residues located in
three distinct exposed areas on the surface of the toxins: the
first five-residue turn, the N-terminal part of a helix and the
b turn between the two last b strands. Using site-directed
mutagenesis, three BotXIV variants were constructed by
replacement of residues 8–10, 19–22, or 38–43 with those
found in LqhaIT. These three BotXIV/LqhaIT chimeras
together with the native BotXIV recombinant toxin were
expressed in Escherichia coli. Their overall structural and
detailed electrophysiological properties were studied and
compared. Interestingly, in this paper we show that
substitution of residues 8–10 is associated with de novo
electrophysiological properties partially comparable with
those of BomIV, an a-like scorpion toxin. Implications of
that particular functional anatomy elucidation regarding
the classification of a-toxins of scorpions will be discussed.
MATERIALS AND METHODS
Materials

Enzymes were purchased from Boehringer–Mannheim and
Biolabs. Oligonucleotides were synthesized by Genset.
HPLC separation procedure was performed using a Merck
system (L-4250 UV/Vis detector and L-6200 intelligent
pump). N-Terminal sequencing was carried out using an
Applied Biosystem sequencer (477A protein sequencer) on
line with a phenylthiohydantoin analyser (120A analyser).
Dichroic spectra were recorded at 20 °C on a Jobin–Yvon
CD6 using toxin solutions which concentrations were
determined by spectrometry. SDS/PAGE was performed
using the Phast System from Pharmacia.
Bacterial strains and plasmids
The E. coli strain MV1190 was used as the host strain for
transformations by M13-derived vectors. The strain CJ236
[dut
–
, ung
–
, thi1, relA1/pCJ105 (Cm
r
)] was used to prepare
single-stranded template DNA for mutagenesis, as des-
cribed by Kunkel [22]. The bacterial host used for expres-
sion was E. coli HB101 [F
–
D(mcrC-mrr) leu supE44 ara14
galK2 lacY1 proA2 rpsL20 (Str
r
) xyl-5 mtl-1 recA13 23].
Expression vector pEZZ18 was obtained from Pharmacia.

Molecular biology
Manipulations of DNA were performed according to
published procedures [24]. Single- and double-stranded
DNA sequencing procedures were performed by the
dideoxynucleotide method [25] using the T7 sequencing kit
from Pharmacia and [
35
S]dATP (Amersham). Site-directed
mutagenesis assays were performed according to Kunkel
et al. [22] using a Bio-Rad kit. The cDNA encoding the
precursor of BotXIV [19] was modified as follows: a KpnI/
BamHI fragment carrying the sequence encoding BotXIV
was inserted into the corresponding restriction sites of
M13mp19 to produce M13mp19-BotXIV template for
mutagenesis. Phages from an individual lysis plaque were
used to re-infect fresh host cells to produce high-titer phage
stock. This stock was then passed through two rounds of
infection of E. coli CJ236 dut
–
ung
–
host. Single-stranded
phage DNA was then isolated from a large volume of
phage-containing supernatant. Substitutions of BotXIV
amino-acid stretches: Q
8
-P-H
10
,I
19

-S-S-G
22
or G
38
-H-K-S-
G-H
43
by the corresponding sequences in LqhaIT were
performed using the following oligonucleotides: 5¢-GGTTA
TATTGCCAAGAACTATAACTGTGCATAC-3¢,5¢-C
ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT
A-3¢,and5¢-ACGAGTGGCCACTGCGGACATAAATC
TGGACACGGAAGTGCCTGCTGG-3¢, respectively.
Production of recombinant chimera toxins in
E. coli
Bacteria E. coli HB101 transformed by the expression
vectors pEZZ-M8-10, pEZZ-M19-22 or pEZZ-M38-43
were grown in a 5-L fermentor (LSL Biolafitte, Saint
Germain en Lay, France) with an initial culture volume of
4-L of tryptic soy broth (TSB) medium (Difco) supple-
mented with 5 gÆL
)1
of glucose and 200 lgÆmL
)1
ampicillin.
Conditions of production were performed as previously
described [19]. Hybrid recombinant proteins contained in
extracted periplasmic fractions and in the culture medium
were purified by affinity chromatography on an IgG-
Sepharose column according to Ducancel et al. [26], then,

lyophilized. The procedure followed to cleave the fusion
proteins by CNBr treatment was previously described by
Boyot et al. [27]. Purification of cleaved recombinant
chimeras was performed as previously described [19].
Electrophysiological techniques
Adult male cockroaches (Periplaneta americana)wereused.
A segment (1.5–2.5 mm) of one giant axon was isolated
2832 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002
from a connective linking the fourth and fifth abdominal
ganglia. The preparation was immersed in paraffin oil and
an Ôartificial node of RanvierÕ was created [28]. Active
membrane area of 0.01–0.02 mm
2
(node) was superfused
with saline or test solutions. Membrane potentials and
transmembrane currents of this small surface of axonal
membrane were recorded in current-clamp or voltage-clamp
using the double oil-gap single fiber technique as described
in detail earlier [29,30]. Normal physiological saline had the
following composition (in m
M
):NaCl,200;KCl,3.1;CaCl
2
,
5.4; MgCl
2
, 5.0; Hepes buffer, 1.0; pH 7.2. Lyophilized M8-
10 and BotXIV were dissolved in the saline solution to final
concentrations of 0.5 or 2.0 · 10
)6

M
, in the presence of
bovine serum albumin (0.25 mgÆmL
)1
) before tests. Potas-
sium currents were blocked by 0.5 · 10
)3
M
3,4-diamino-
pyridine (Sigma Chemical, France), and when needed
sodium currents were blocked by 5 · 10
)7
M
tetrodotoxin
(Sigma Chemical, France).
Sodium conductance (g
Na
) can be calculated as a function
of the membrane potential according to the equation:
g
Na
¼ I
Na
=ðE
m
À E
Na
Þ
where E
m

and E
Na
are the membrane potential, and the
reversal potential for Na
+
current, respectively. Smooth
curves correspond to the best fit through the mean data
points according to the Boltzmann distribution:
g
Na
=g
Na
max ¼ 1=f1 þ exp½ðE
0:5
þ E
m
Þ=kg
where E
0.5
is the potential at which 50% of the maximal
sodium conductance are reached, k is the slope factor.
Voltage-dependence of steady-state inactivation of Na
+
channels was determined using a conventional two-pulses
protocol: the test pulse to )10 mV is preceded by long
(40 ms) prepulses from )80 to +30 mV, and the relative
amplitude of the peak Na
+
current during the test pulse is
plotted according to the prepulse value. Smooth curves

correspond to the best fit through the mean data points
according to the Boltzmann distribution:
I
Na
=I
Na
max ¼ 1=f1 þ exp½ðE
m
þ E
0:5
Þ=kg
where E
0.5
is the potential at which 50% of the sodium
channels are inactivated, k is the slope factor.
Enzyme-linked-immuno-sorbent-assays
ELISAs were used to assess cross antigenicity of each
purified recombinant BotXIV mutant towards different
polyclonal antibodies. Some were raised against toxic
fractions BotG-50 and AahG-50 from Buthus occitanus
tunetanus and Androctonus australis hector venoms, respect-
ively; or against BotI and AahII purified toxins. For this
purpose, optimization of the previously described proce-
dures [19,31] was carried out.
In vivo
insect and mammal toxicities (biological assays)
For LD
50
determination, groups of four female C57/B16
mice (22 ± 0.2 g) were individually i.c.v. injected under

light diethyl ether anesthesia with 20 ng to 2.5 lgof
recombinant proteins. Toxicity of purified BotXIV mutants
were assessed on four Blatella germanica males per dose
(50 mg body weight). A volume of 0.5–2 lL was injected in
the abdominal segments, and the lethality was monitored
after 1 h. For all injections, the solvent used was 0.15
M
NaCl containing 1 mg BSA per mL. The LD
50
values were
calculated according to Reed & Muench method [32].
Molecular modelling of BotXIV and m8–10 mutant
Molecular modelling of both BotXIV and its 8–10 mutant
were based on the experimentally determined three-dimen-
sional structures of two templates: toxin II of Androctonus
australis hector (AahII) solved at 1.3 A
˚
(PDB entry 1ptx
[33]), and toxin V (CsV; PDB entry 1nra [34]), of Centruro-
ides sculpturatus, by using the program
MODELLER
3 [35],
running on a silicon Graphics Indigo R3000 workstation.
The first set of models was obtained from manual sequence
alignment. To limit the problems with backbone dihedrals
of nonGly residues, we avoided to aligning the Gly residues
with nonGly residues. The 40 first models (20 in each
protein) were screened with the programs
PROCHECK
[36],

PROSA I
[37] and
INSIGHT II
(Molecular Simulation Inc.),
from which only four models for each protein were selected
and then used as templates in the final subsequent series.
Electrostatic properties
The electrostatic potential and outside isopotential gradients
on the molecule surfaces were computed with the program
GRASP
[38]. The ionic strength was 0.145
M
and the probe
radius was 1.4 A
˚
. The dielectric constant was 2 inside and 80
outside the solute molecules. Except the His residues, all
acidic and basic residues were set in their ionized form.
RESULTS
Identification of divergent regions
To tentatively clarify the structure–function relationships
existing between a-like and a-insect scorpion toxins, we
compared in details the primary structures of BotXIV and
representative a-toxins. Thus, LqqIII, BotIT1, BomIV and
Bom III display 49, 53, 54, 57 and 73% identities with
LqhaIT, respectively. These data suggest that BotXIV
occupies an intermediate position between strictly insectici-
dal a-toxins (LqhaIT, LqqIII, and BotIT1) and typical
a-like toxins (BomIV and BomIII). This confirms our
previous experimental results, which established that

BotXIV was inactive towards mammals and weakly toxic
for Blatella cockroaches [19]. Thus, a precise comparison of
BotXIV and LqhaIT primary sequences essentially revealed
three divergent regions containing most of the amino acid
variations noticed between these two functionally unrelated
molecules. It is noteworthy, that these divergent regions
mostly correspond to three exposed to solvent loops
connecting conserved a helix and b sheet elements (Fig. 1).
Thus, segment 8–10 is part of the b turn (8–12) following
the first b strand (residues 1–5). Interestingly, the sequence
found in BotXIV (Q
8
-P-H
10
) is similar to the corresponding
ones in BomIII and BomIV toxins (Q
8
-P-E
10
)twotypical
a-like toxins, when totally different from those ones of true
insecticidal toxins (LqhaIT, LqqIII, and BotIT1), K/Q
8
-N-
Y
10
. The second main divergent region is constituted of the
loop preceding the unique a helix. Classically, it displays
variable length and amino acid content from one toxin to
Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2833

another. Thus, the sequence I-S-S-G(19–22) found in
BotXIV is replaced by D-A-Y in LqhaIT. Finally, the third
variable segment corresponds to residues 38–43, and
includes three amino acids of the second LqhaIT b strand
(34–39) and the following bturn. Here also, BotXIV and
a-insect toxins display totally different sequences:
GHKSGH(38–43) vs. QWAGKY in LqhaIT for instance.
Based on these observations, we built three BotXIV/
LqhaIT chimeric molecules corresponding to the individual
substitution of deviating and exposed to the solvent regions
8–10, 19–22 or 38–43 in BotXIV by the equivalent sequences
found in LqhaIT (Fig. 1). The latter should be noted:
BotXIVM8-10, M19-22, and M38-43.
Production, purification and characterization
of recombinant chimera
Mutated DNA fragments surrounded by KpnI(5¢)and
BamHI (3¢) restriction site sequences were excised from
M13mp19-BotXIV vectors and inserted into the corres-
ponding sites in the pEZZ18 expression vector [39]. The
three BotXIV variants were produced as recombinant ZZ
fusion proteins as previously described [19]. Briefly, fusion
proteins were mainly found in the culture medium of
bacterial suspensions, as expected from pEZZ-18 expression
vector [39]. Affinity chromatography performed on IgG–
Sepharose allowed as expected, recovery of recombinant
hybrid proteins having an apparent 22-kDa molecular mass
(not shown). We noticed also the presence of few low
molecular weight fragments resulting probably from pro-
teolytic degradation events of the toxin moiety, as previ-
ously and classically observed for such compounds

[19,26,40,41]. The three IgG-purified fractions revealed
similar proteic profiles and overall yields were estimated
between 16 and 18 mg of fusion proteins per litre of culture.
Recombinant variant fused molecules were treated by
cyanogen bromide as previously described [27]. The average
efficiency of the CNBr cleavage was estimated to 35%
(Fig. 2, lanes 3 and 4), and the products were purified by
cation HPLC (data not shown). Recombinant chimera
displayed an apparent 7 kDa molecular mass as showed in
the case of BotXIVM8-10 variant (Fig. 2, lane 2). The
three recombinant chimera comigrated with recombinant
BotXIV on a 20% SDS/polyacrylamide gel, and shown the
expected amino acid composition and N-terminal amino-
acid sequences (data not shown). The circular dichroic
spectra of the recombinant and chimeric BotXIV proteins
revealed similar overall profiles (Fig. 3), associated however,
Fig. 2. SDS/PAGE (20% Phast-gel) of a cleaved M8-10 variant. Lane
2 represents the cleaved and HPLC-purified recombinant M8-10
variant. Chimeric protein BotXIVM8-10 appears as a proteic band of
% 7 kDa. Lanes 3 and 4 correspond to crude cleavage mixtures of
HPLC-purified hybrid fractions. Lanes 1 and 5, correspond to medium
and low molecular mass markers, respectively.
Fig. 1. Alignment of principal scorpion a-neurotoxins amino acid sequences. The amino-acid sequences are aligned according to their cysteine
residues (orange) and their three-dimensional structures (in italic for known three-dimensional structures). Disulfide bridges are indicated in dashed
lines. Positively charged residues (K/R) are indicated in blue, negatively charged residues (D/E) in red, and aromatic residues in green. Consensus
numbering is displayed under the sequences. The secondary structures are indicated in the top line. Deletions are indicated by (–). The three main
divergent regions involved in the building of BotXIV/LqhaIT chimeric molecules are in boxes. LqhaIT, Leiurus quinquestriatus hebraeus a-insect
toxin; LqqIII, Leiurus quinquestriatus quinquestriatus toxin III; BotI, IT1, and XIV, Buthus occitanus tunetanus toxin I, insect toxin I, and XIV,
respectively; BomIII and BomIV, Buthus occitanus mardochei toxins III and IV.
2834 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002

to a weak increase in the positive 190-nm band coupled to a
more significant one in the negative 205-nm band of the CD
spectra. Finally, about 1 mg of each recombinant BotXIV
variants was obtained from 20 mg of initial fusion protein.
Cross antigenicity and biological toxicity of purified
recombinant BotXIV mutants
To establish the antigenic profiles of the three HPLC-
purified BotXIV mutants, we performed ELISA using
various scorpion antitoxins sera [42]. Thus, BotXIVM8-10,
BotXIVM19-22 and BotXIVM38-43 variants, were simi-
larly recognized by the polyclonal antibodies raised against
BotG-50 (a partially purified mixture of Buthus occitanus
tunetanus venom) or BotI toxin. On the contrary, very low
cross antigenicity was observed with anti-AahII toxin or
AahG-50 toxic fraction (data not shown). A similar result
was initially observed for recombinant BotXIV [19].
Together, these data indicate that the three substitutions
introduced within BotXIV did not modify significantly its
overall antigenic profile [19]. Furthermore, they indicate
that these three BotXIV mutants as BotXIV all belong to
the same antigenic group related to Buthus occitanus
tunetanus (Bot) scorpion a-toxins, which is different from
those of Androctonus australis hector [42].
I.c.v. injections in C57/Black 6 mice of purified Bot-
XIVM8-10, M19-22, or M38-43 variant ranging from 2 ng
to 2.5 lg did not cause any toxic effect. These results clearly
established that the three BotXIV/LqhaIT chimeric mole-
cules are devoided of any toxicity towards mammal, because
aweaklytoxicLD
50

value in mammals corresponds on an
average to 100 ng. This result was not surprising, because
the starting toxin BotXIV was already inactive towards
mammals [19], and the three chimeras were obtained by
limited substitution of equivalent regions between BotXIV
(as starting molecule) and LqhaIT (as donor molecule),
which is classically reported as a potent anti-insect toxin
[14,15,43]. Unexpectedly however, injection to Blatella of
1 lg of each of the three recombinant chimera did not
induce any additional insect lethality, when in the particular
case of BotXIVM8-10 variant, a contractive effect of
injected Blatella was noticed. Thus, when substitution of
19–22 and 38–43 regions completely affected the initial
insect toxicity of BotXIV, BotXIVM8-10 variant is charac-
terized by an intermediate biological mode of action
towards insects.
Electrophysiological results
To compare the effects of native and mutated BotXIV
molecules on the insect channels, we carried out standard
current- and voltage-clamp experiments on cockroach
axonal preparations, as described in Materials and methods.
As previously reported, BotXIV has typical a-toxins effects
as it was shown to slow down the sodium current
inactivation [19]. First of all, both BotXIVM19-22 and
M38-43 did not show any effect neither on action potential
or sodium current decay as compared to BotXIV (data not
shown). These data confirm the absence of insect toxicity
noticed previously. On the other hand, in the case of
BotXIVM8-10 variant, modifications of the initial electro-
physiological properties of BotXIV were observed in

current- and voltage-clamp conditions.
Current-clamp conditions. When BotXIV (1.4 · 10
)6
M
)
was devoid of any effect on the action potential (AP)
amplitude, or on the membrane resting potential value,
BotXIVM8-10 was applied at the same concentration;
BotXIVM8-10 caused an unusual and slight membrane
depolarization of about 5–8 mV (Fig. 4A,B). Furthermore,
BotXIV and BotXIVM8-10 both increase the action
potential duration and lead to a progressive prolongation
of the evoked AP with a more drastic effect in the case of the
native toxin. In fact, for the same toxin application time
(14 min) BotXIV induced a plateau potential lasting for
110 ms followed by a long lasting and a very slowly decayed
depolarization. In the case of the BotXIVM8-10, the evoked
ÔplateauÕ is only 3–6 ms duration with a normal repolariza-
tion phase (Fig. 4B). In addition, an artificial re-polarization
by-passing a constant hyperpolarizing current, did restore
neither the PA amplitude nor its initial duration.
Voltage-clamp conditions. Membrane sodium currents
were measured under voltage-clamp conditions in response
to a step depolarization from a holding potential
(E
h
) ¼ )60 mV to a membrane potential (E
m
) ¼
)10 mV, after suppression of the potassium current with

3.4-DAP 0.5 · 10
)3
M
. In normal conditions, and as shown
in Fig. 4C,D less than 3 ms were necessary to obtain a
complete I
Na
inactivation. Application of BotXIVM8-10
induced a progressive and dose-dependent development of a
maintained sodium current which was about 6% of the
peak at 0.7 · 10
)6
M
(Fig. 4D), and reached 12% at
1.4 · 10
)6
M
. Besides, this mutant slightly decreased the
initial peak amplitude of the inward sodium current by
about 20–24%. At the end of the voltage pulse, the
maintained current returned to 0 with a slightly slowed
deactivation. Finally, a 10-l
M
tetrodotoxin post-application
generated a constant but slight inward current of about )20
to )26 nA at the holding potential (Fig. 4D). In another
series of experiments, and after selective suppression of I
Na
Fig. 3. UV circular dichroism spectra of BotXIV toxin and its three
chimeric variants. The cell path length is 0.05 cm and the recording

temperature is 20 °C. The different CD spectra are shown as following:
native BotXIV toxin (––), M8-10 (ÆÆÆÆ), M19-22 (- - -), and M38-43
(- Æ - Æ -) BotXIV/LqhaIT chimera.
Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2835
with 10
)6
M
of tetrodotoxin, it was demonstrated that
BotXIVM8-10 (1.4 · 10
)6
M
) did not modify potassium
conductance (data not shown).
Effects on sodium activation and inactivation voltage
dependence. Sodium peak current measurements during
voltage pulses from )80 to 10 mV allowed us to calculate
sodium conductance (g
Na
) as a function of the membrane
potential as indicated in Materials and methods. Figure 5B
shows that, BotXIVM8-10 shifted the relative sodium
conductance by about 5 to 10 mV towards negative
potentials, whereas BotXIV had no effect on activation
(Fig. 5A). Figure 5 illustrates also the voltage dependence
of steady-state inactivation of Na
+
channels. Under normal
conditions, the sodium current inactivation was complete at
0to)10 mV, whereas with BotXIVM8-10 the inactivation
was almost complete but the curve is shifted by about 10–

20 mV towards negative potentials (Fig. 5B). On the other
hand, under BotXIV application the sodium current
inactivation remained partial and the curve was shifted by
about 10 mV towards more positive potentials (Fig. 5A).
It is important to notice that when using BotXIVM8-10,
the voltage dependence was decreased both during the
activation and inactivation mechanisms, in presence of
BotXIV the sodium current voltage dependence was
decreased only in the case of the inactivation process. These
data imply that the mutated toxin opens Na
+
channels at
very negative potential values, suggesting that sodium
current is activated and inactivated earlier than in normal
conditions. To summarize, BotXIVM8-10 variant affects in
the same time the sodium current activation and inactiva-
tion mechanisms, when BotXIV only affects the inactivation
process. Together, our results clearly show that the substi-
tution of segment 8–10 in BotXIV by its equivalent in
LqhaIT, yields to the acquisition by BotXIVM8-10 variant
of original electrophysiological properties. Molecular mode-
ling and electrostatic potential studies were then carried out
to tentatively explain the biological properties displayed by
BotXIVM8-10 variant.
Molecular modeling of native BotXIV
and BotXIVM8-10 variant
Figure 6 illustrates the best a-carbon BotXIV and M8-10
models we obtained. They are similarly oriented (face A
view) as the published experimental structures of CsEV3
[34] and AahII [44]. Clearly, the selected models predict

three-dimensional structures similar to the related a-toxins.
The main differences affect the C-terminal region especially
Fig. 5. Effects on sodium activation and inactivation voltage dependence.
Sodium peak current measurements during voltage pulses from )80 to
10 mV allowed us to calculate sodium conductance (g
Na
) as a function
of the membrane potential (see Method paragraph). Control meas-
urements are represented by open symbols. (A) 10 min after BotXIV
application, the sodium current steady state inactivation curve (d)is
slowed and is shifted to more positive potentials while the sodium
current activation curve (m) remains unchanged. (B) Ten minutes after
M8-10 application, both sodium inactivation and activation curves
(d,m) are shifted to more negative potentials.
Fig. 4. Effects of native and M8-10 chimeric BotXIV proteins on the
action potential and the sodium current of isolated cockroach axons.
(A,B) Current-clamp experiments: superimposed records of action
potentials evoked by a short (0.5 ms) depolarizing current pulse of 18
to 20 nA, at initial time: control (C), after BotXIV (A) and M8-10 (B)
application. Note the progressive evolution of the action potential
durations under BotXIV (A) and the axonal membrane depolarization
under M8-10 associated to a slight prolongation of AP duration and a
AP amplitude decrease. An artificial repolarization (AR) does not
restitute the initial AP (B). (C,D) Voltage-clamp experiments: cock-
roach axonal sodium current recordings are evoked by voltage pulses
of )10 mV from a holding potential E
h
¼ )60 mV. In normal con-
ditions, I
Na

completely inactivates in less than 3 ms (C). BotXIV
application induces a maintained inward sodium current without
affecting the inward peak sodium current (C). M8-10 application
induces a decrease of the peak sodium current amplitude associated
with a maintained inward sodium current (D). Tetrodotoxin applica-
tion reveals a slight holding inward sodium current (D).
2836 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002
for BotXIV, the latter being predicted larger in the case of
BotXIVM8-10 variant. It is noteworthy, that in the 40
BotXIV and M8-10 variant models, the C-terminus
extremity displayed the homogenous organization shown
on Fig. 6.
Electrostatic properties of the models
The existence onto the surface of scorpion a-neurotoxins of
an electrostatic potential is suspected to contribute to the
recognition of the receptor site [45]. By resolving the
Boltzman–Poisson equation, the program
GRASP
is capable
of calculating the electrostatic potential at any point of a
grid in the space surrounding a protein molecule [38].
Applied to BotXIV and BotXIVM8-10 mutant, the
program allowed the visualization of several charged amino
acid residues susceptible to form an electrostatic potential
gradient on the surface of the molecule in the solvent space
(Fig. 7). The positively and negatively charged residues are
in blue and red, respectively, whereas the neutral side-chains
are indicated in white. Figure 7A shows the face A
(hydrophobic face) of BotXIV and BotXIVM8-10, com-
paratively to the published RMN structure of LqhaIT [46].

On the contrary of the clear dipolar charge repartition of
LqhaIT (with positive charges localized in C-terminal
region: R3, K42, K62 R65 and negative charges: D4,
D20, D54), BotXIV and BotXIVM8-10 display a different
and less homogenous repartition of charges. However, the
global charge (+1) of the face A of these three molecules
remains unchanged. BotXIVM8-10 and BotXIV display a
conserved charge distribution except for the C-terminal
region, the orientation of which was modified upon substi-
tution of segment 8–10, as predicted from modeling. Finally,
analysis of the B faces (Fig. 7B) revealed that the main
differences between LqhaIT, BotXIV and BotXIVM8-10
molecules, rely upon the substitutions K28/E29 in BotXIV
and BotXIVM8-10, together with K9/Q8 in the particular
case of BotXIVM8-10 (Fig. 7B).
DISCUSSION
The aim of this paper was to explore the possibility that
subtle structural deviations between BotXIV and LqhaIT,
could reflect the localization of a particular functional
topography. Based on sequence analysis and the identifica-
tion of three divergent regions between these two a-toxins,
we explored the biological implications of these segments by
building corresponding chimeric molecules. From a general
point of view and as compared to rBotXIV, the substitu-
tions performed did not modify the yield of production of
the three recombinant chimera. This suggests that the
variants display a structural stability and a proteolytic
sensitiveness similar to those of the starting recombinant
molecule. This is partially corroborated by the CD spectra
of the three purified recombinant variants that reveal

similar, but not identical, profiles as compared to rBotXIV.
This observation suggests that the three recombinant
BotXIV variants probably adopt a similar overall spatial
arrangement as the unmodified compound, characterized
by a similar overall secondary structure content; however,
the local structural features may be different. Furthermore,
each chimeric molecule shares an identical antigenic profile
and cross-reactivity pattern with BotXIV. Together, these
results strongly suggest that the transfer of residues 8–10,
19–22 or 38–43 has a limited effect on the overall three-
dimensional structure adopted by the three recombinant
molecules generated and tested in the present study. This
further illustrates the stability and the structural flexibility of
the a/b scorpion motif [47].
When the three segments were substituted to form the
BotXIV variants, M8-10, M19-22 and M38-43 form a
homogenous area largely overlapping the putative toxic
Fig. 6. Homology molecular modeling of
BotXIV and M8-10 mutant. Ribbon
representations of experimentally determined
structures of AahII (cyan), CsV (red), and
best models of BotXIV (orange) and its
M8-10 variant (pink).
Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2837
surface of scorpion a-neurotoxins affecting sodium channel
gating [45]. Unexpectedly, however, when the three substi-
tutions were performed independently in BotXIV, the weak
lethality initially observed after abdominal injection to
Blatella cockroaches was totally abolished. More surpris-
ingly, when BotXIVM19-22 and M38-43 mutants are

characterized by an absolute lack of electrophysiological
effects on cockroach giant axons, M8-10 variant shows
controversies effects. Assuming the absence of major
structural change as discussed above, the loss of toxicity
suggests that subtle structural deviations might have
affected the structural integrity of the Ôminimal toxicÕ surface
characterizing BotXIV. Numerous studies are consistent
with a multipoint receptor recognition site onto the surface
of scorpion a-neurotoxins including residues at positions: 8,
10, 17, 18, 58, 59, 62, and 64 in interaction with the receptor
[45,48–50]. In addition, the spatial arrangement of the toxin
polypeptide chain together with the formation of an
electrostatic potential are also predicted to participate to
the capacity of these compounds to interact specifically and
with high affinity with voltage-sensitive sodium channels. In
this respect, our results are not surprising, because the
substitutions we performed are only partial, and thus too
limited to yield to the design of a LqhaIT-like toxic site
Fig. 7. Electrostatic gradient potential obtained with
GRASP
program. The gradient potential surfaces were computed from the modeled structures of
BotXIV (top left), M8-10 mutant (top right), comparatively to that experimentally determined of recombinant LqhaIT (bottom). Faces A and B of
thetoxinsareshownin(A)and(B),respectively.
2838 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002
respecting the structural integrity of the transferred region.
Recently, we have shown the importance of such a
structural respect in the case of the successful design of a
recombinant fasciculin-like molecule obtained by transfer-
ring the structural-deviating segments that exist between
fasciculins and short-chain neurotoxins from snakes [20,21].

Clearly, substitution of residues QPH(8–10) in BotXIV
by the segment KNY (LqhaIT), which was recently
reported as playing a major role in the biological activity
of LqhaIT [45], results in de novo electrophysiological
properties of BotXIVM8-10 variant as compared to
BotXIV. Indeed, and as classically observed with scorpion
a-toxins, BotXIVM8-10 variant induces a prolongation of
the action potential duration on cockroach giant axons.
Furthermore under voltage-clamp conditions, the voltage
dependence is decreased both during the activation and
inactivation mechanisms when in the same conditions
BotXIV toxin only slows the sodium current inactivation
process. Thus, the sodium current activation and the
inactivation mechanisms, are both and uniquely modified
in presence of BotXIVM8-10. Such results were sometimes
observed after LqhaIT application, but in a much less
significant manner [51]. Sodium current activation is also
affected in the case of a-like toxins. Thus, it was recently
shown that BomIV tested on the same insect preparations
inhibits the sodium current inactivation process with
additional effects on the sodium current activation [17]. In
the presence of BotXIVM8-10 mutant, as with BomIV, we
observed a resting depolarization due to the induced
constant holding current, which is also responsible of the
shift of the sodium current voltage dependence to negative
potentials. Furthermore, this shift induces an ÔearlyÕ inacti-
vating sodium current, which has not been seen until now
with a and a-like neurotoxins. Thus, a part of the affected
sodium channels might be unable to participate in the fast
transient current. This hypothesis could explain, at least

partially, the decrease of the peak sodium current.
For the first time, a shift of inactivation curve towards
negative potentials can be unambiguously attributed to the
substitution of residues 8–10 within the first b turn of a
scorpion a-neurotoxin. That result provides a second
example of how a structural deviation can be associated
to a particular functional topography. It also emphasizes the
unique analytical power of a ÔpositiveÕ functional mapping
strategy based on the identification of a particular biological
property absent in the host scaffold, i.e. BotXIV. However,
the reasons for the dual effect observed upon transfer of the
segment 8–10 from LqhaIT to BotXIV (i.e., the loss of
insect toxicity and the de novo acquisition of particular
electrophysiological properties) remains unclear. Interest-
ingly, it was recently proposed that the pharmacological
versatility displayed by scorpions a-neurotoxins might be
related to the structural configuration of the C-terminal tail
[50]. Indeed, based on structure comparisons and bioactive
surface identifications, it was hypothesized that the highly
variable and dynamic C-terminal tail together with the
spatially vicinal residues, form the interacting areas onto the
surface of scorpion a-neurotoxins. Thus, the C-termini of
scorpion a-neurotoxins in general, and of LqhaIT in
particular, is positioned between the five-residue turn
(8–12) and the b turn formed by residues 40–43. If the first
one is identical between BotXIVM8-10 and LqhaIT, the
second turn displays several differences; AGK(40–43) vs.
KSG(40–43) in LqhaIT and BotXIVM8-10, respectively.
Furthermore, Lys58, which is conserved within scorpion
a-neurotoxins and predicted to form a network stabilizing

the C-terminus, is replaced by an isoleucine in BotXIVM8-
10. Finally, the length and amino-acid composition of
the C-termini of LqhaIT and BotXIVM8-10 are signifi-
cantly different; RVPGKCR(58–66) for LqhaIT vs.
IVHGEKCHR(59–67) in BotXIVM8-10. Thus, the com-
position and length differences between native BotXIV and
M8-10 variant vs. LqhaIT C-terminal tails, together with its
peculiar environment in BotXIVM8-10 vs. BotXIV, could
be related to the biological properties expressed by these
different molecules.
Finally, the fact that a limited modification can directly or
indirectly be responsible for a new biological property
shared between a-insect and a-like neurotoxins, suggests
that BotXIV probably occupies an intermediate position
within the evolutionary scheme of these molecules. It also
supports the hypothesis that the acquisition of such
electrophysiological properties might constitute an early
biological event on the way of the molecular design of
potent sodium channel gated ligands.
ACKNOWLEDGEMENTS
We wish to thank S. Pinkasfield and Dr F. Bouet for technical
assistance and N-terminal sequencing, Drs D. Gordon, S. Zinn-Justin
for fruitful discussions, and Dr P. Mansuelle for his help in preparation
of Figs 6 and 7. This work was supported in part by an IFS grant
(International Foundation for Science).
REFERENCES
1. Miranda, F., Kopeyan, C., Rochat, H. & Lissitzky, S. (1970)
Purification of animal neurotoxin. Isolation and characterization
of eleven neurotoxins from the venoms of the scorpions Androc-
tonus australis hector, Buthus occitanus tunetanus and Leiurus

quinquestriatus quinquestriatus. Eur. J. Biochem. 16, 514–523.
2. Gregoire,J.&Rochat,H.(1983)CovalentstructureoftoxinsI
and II from the scorpion Buthus occitanus tunetanus. Toxicon 21,
153–162.
3. Krifi, M.N., El Ayeb, M. & Dellagi, K. (1996) New procedures
and parameters for better evaluation of Androctonus australis
garzonii (Aag) and Buthus occitanus tunetanus (Bot.) scorpion
envenomations and specific serotherapy treatment. Toxicon 34,
257–266.
4. Catterall, W.A. (1986) Molecular properties of voltage-sensitive
sodium channels. Annu. Rev. Biochem. 55, 953–985.
5. Hille, B. (1992) Ionic Channels of Excitable Membranes.Sinauer
Associates, Sunderland MA.
6. Rochat, H., Bernard, P. & Couraud, F. (1979) Scorpion toxins:
chemistry and mode of action. Adv. Cytopharmacol. 3, 325–330.
7. Catterall, W.A. (1984) The molecular basis of neuronal excitabil-
ity. Science 223, 653–661.
8. Jover, E., Couraud, F. & Rochat, H. (1980) Two types of scorpion
neurotoxin characterized by their binding to two separate receptor
sites on rat synaptosomes. Biochem. Biophys. Res. Commun. 95,
1607–1614.
9. Couraud,F.,Jover,E.,Dubois,J.M.&Rochat,H.(1982)Two
types of scorpion toxins receptors sites, one related to the activa-
tion of the action potential sodium channel. Toxicon 20, 9–16.
10. Martin-Eauclaire, M.F. & Couraud, F. (1995) Scorpion
neurotoxins: effects and mechanisms. In Handle Neurotoxi-
cology (Chang, L.W. & Dyer, R.S eds) p. 683 Marcel Dekker,
New York.
Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2839
11. Gordon, D., Savarin, P., Gurevitz, M. & Zinn-Justin, S. (1998)

Functional anatomy of scorpion toxins affecting sodium channels.
J. Toxicol. Toxin Rev. 17, 131–159.
12. Catterall, W.A. (1992) Cellular and molecular biology of voltage-
gated sodium channels. Physiol. Rev. 72, 15–48.
13. Gordon, D. (1997) A new approach to insect-pest control-com-
bination of neurotoxins interacting with voltage sensitive sodium
channels to increase selectivity and specificity. Invert. Neurosci. 3,
103–116.
14. Gordon, D., Martin-Eauclaire, M.F., Cestele, S., Kopeyan, C.,
Carlier, E., Ben Khalifa, R., Pelhate, M. & Rochat, H. (1996)
Scorpion toxins affecting sodium current inactivation bind to
distinct homologous receptor sites on rat brain and insect sodium
channels. J. Biol. Chem. 271, 8034–8045.
15. Sautie
`
re, P., Ceste
`
le, S., Kopeyan, C., Martinage, A., Drobecq, H.,
Doljansky, Y. & Gordon, D. (1998) New toxins acting on sodium
channels from the scorpion Leiurus quinquestriatus hebraeus sug-
gest a clue to mammalian versus insect selectivity. Toxicon 36,
1141–1154.
16. Gordon, D. & Zlotkin, E. (1993) Binding of scorpion toxin to
insect sodium channels is not dependent on membrane potential.
FEBS Lett. 315, 125–128.
17. Ceste
`
le, S., Stankiewicz, M., Mansuelle, P., De Waard, M., Dar-
gent, B., Gilles, N., Pelhate, M., Rochat, H., Martin-Eauclaire,
M.F. & Gordon, D. (1999) Scorpion alpha-like toxins, toxic to

both mammals and insects, differentially interact with receptor site
3 on voltage-gated sodium channels in mammals and insects. Eur.
J. Neurosci. 11, 975–985.
18. Krimm, I., Gilles, N., Sautiere, P., Stankiewicz, M., Pelhate, M.,
Gordon, D. & Lancelin, J.M. (1999) NMR structures and activity
of a novel alpha-like toxin from the scorpion Leiurus quinques-
triatus hebraeus. J. Mol. Biol. 285, 1749–1763.
19. Bouhaouala-Zahar, B., Ducancel, F., Zenouaki, I., Ben Kha-
lifa, R., Borchani, L., Pelhate, M., Boulain, J.C., El Ayeb,
M., Menez, A. & Karoui, H. (1996) A recombinant insect-
specific alpha-toxin of Buthus occitanus tunetanus scorpion confers
protection against homologous mammal toxins. Eur. J. Biochem.
238, 653–660.
20. Ricciardi, A., Du Le, M.H., Khayati, M., Dajas, F., Boulain, J.C.,
Me
´
nez, A. & Ducancel, F. (2000) Do structural deviations
between toxins adopting the same fold reflect functional differ-
ences? J. Biol. Chem. 275, 18302–18310.
21. Le Du, M.H., Ricciardi, A., Khayati, M., Menez, R., Boulain,
J.C., Menez, A. & Ducancel, F. (2000) Stability of a structural
scaffold upon activity transfer: X-ray structure of a three fingers
chimeric protein. J. Mol. Biol. 296, 1017–1026.
22. Kunkel, T.A. (1985) The mutational specificity of DNA poly-
merases alpha and gamma during in vitro DNA synthesis. J. Biol.
Chem. 260, 12866–12874.
23. Boyer, H.W. & Roulland-Dussoix, D. (1969) A complementation
analysis of the restriction and modification of DNA in Escherichia
coli. J. Mol. Biol. 41, 459–472.
24. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular

cloning. A Laboratory Manual. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor NY.
25. Sanger, F., Nicklen, S. & Coulson, A.R. (1977) DNA sequencing
with chain-terminating inhibitors. Biotechnology 24, 104–108.
26. Ducancel, F., Boulain, J.C., Tremeau, O. & Menez, A. (1989)
Direct expression in E. coli of a functionally active protein A-snake
toxin fusion protein. Protein Eng. 3, 139–143.
27. Boyot, P., Pillet, L., Ducancel, F., Boulain, J.C., Tremeau, O. &
Menez, A. (1990) A recombinant snake neurotoxin generated by
chemical cleavage of a hybrid protein recovers full biological
properties. FEBS Lett. 266, 87–90.
28. Pichon, Y. & Boistel, J. (1967) Current–voltage relations in the
isolated giant axon of the cockroach under voltage-clamp condi-
tions. J. Exp. Biol. 47, 343–355.
29. Pelhate, M. & Sattelle, D.B. (1982) Pharmacological properties of
insects axons: a review. J. Insect Physiol. 28, 889–903.
30. Benkhalifa, R., Stankiewicz, M., Lapied, B., Turkov, M.,
Zilberberg, N., Gurevitz, M. & Pelhate, M. (1997) Refined elec-
trophysiological analysis suggests that a depressant toxin is a
sodium channel opener rather than a blocker. Life Sci. 61,
819–830.
31. Chavez-Olortegui, C., Amara, D.A., Rochat, H., Diniz, C. &
Granier, C. (1991) In vivo protection against scorpion toxins by
liposomal immunization. Vaccine 9, 907–910.
32. Reed, L. & Muench, H. (1938) A simple method of estimating fifty
percent in eucaryotic end point. Am. J. Hyg. 27, 493–497.
33. Housset, D., Habersetzer-Rochat, C., Astier, J.P. & Fontecilla-
Camps, J.C. (1994) Crystal structure of toxin II from the scorpion
Androctonus australis hector refined at 1.3 A
˚

resolution. J. Mol.
Biol. 238, 88–103.
34. Jablonski, M.J., Watt, D.D. & Krishna, N.R. (1995) Structure of
an old world-like neurotoxin from the venom of the new world
scorpion Centruroides sculpturatus ewing. J. Mol. Biol. 248,
449–458.
35. Sali, A. & Blundell, T.L. (1993) Comparative protein modeling by
satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815.
36. Laskowski, R.A., MacArthur, M.W., Moss, D.S. & Thornton,
J.M. (1993) PROCHECK – a program to check the stereo
chemical quality of protein structure. J. Appl. Crystallogr. 26,
283–291.
37. Sippl, M.J. (1993) Recognition of errors in three-dimensional
structures of proteins. Proteins 17, 355–362.
38. Nicholls, A., Sharp, K.A. & Honig, B. (1991) Protein folding and
association: insights from the interfacial and dynamic properties of
hydrocarbons. Proteins 11, 281–296.
39. Nilsson, B., Moks, T., Jansson, B., Abrahmsen, L., Elmblad, A.,
Holmgren,E.,Henrichson,C.,Jones,T.A.&Uhlen,M.(1987)
A synthetic IgG-binding domain based on staphylococcal protein
A. Protein Eng. 1, 107–113.
40. Hodgson, D., Gasparini, S., Drevet, P., Ducancel, F., Bouet, F.,
Boulain, J.C., Harris, J.B. & Me
´
nez, A. (1993) Production of
recombinant notechis 11¢2L, an enzymatically active mutant of a
phospholipase A2 from Notechis scutatus scutatus venom, as
directly generated by cleavage of a fusion protein produced in
Escherichia coli. Eur. J. Biochem. 212, 441–446.
41. Danse, J.M., Rowan, E.G., Gasparini, S., Ducancel, F., Vatan-

pour-Young, L.C., Poorheidari, G., Lajeunesse, E., Drevet, P.,
Me
´
nez, R., Pinskasfeld, S., Boulain, J.C., Harvey, A.L. & Me
´
nez,
A. (1994) On the site by which a-dendrotoxin binds to voltage-
dependent potassium channels: site directed mutagenesis reveals
that the lysine triplet 28–30 is not essential for binding. FEBS Lett.
356, 153–158.
42. El Ayeb, M., Delori, P. & Rochat, H. (1983) Immunochemistry of
scorpion a-toxins antigenic homologies checked with radio-
immuno-assays (RIA). Toxicon 21, 709–716.
43. Chen, H., Gordon, D. & Heinmann, H.S. (2000) Modulation of
cloned skeletal muscle sodium channels by the scorpion toxins
LqhII, LqhIII and LqhaIT. Pflu
¨
gers Arch. 439, 423–432.
44. Fontecilla-Camps, J.C., Habersetzer-Rochat, C. & Rochat, H.
(1988) Orthorhombic crystals and three-dimensional structure of
the potent toxin II from the scorpion. Androctonus australis hector.
Proc. Natl Acad. Sci. USA 85, 7443–7447.
45. Zilberberg, N., Froy, O., Loret, E., Cestele, S., Arad, D., Gordon,
D. & Gurevitz, M. (1997) Identification of structural elements of a
scorpion alpha-neurotoxin important for receptor site recognition.
J. Biol. Chem. 272, 14810–14816.
46. Tugarinov, V., Kustanovitz, I., Zilberberg, N., Gurevitz, M. &
Anglister, Y. (1997) Solution structures of a highly insecticidal
recombinant scorpion alpha-toxin and a mutant with increased
activity. Biochemistry 36, 2414–2424.

2840 B. Bouhaouala-Zahar et al. (Eur. J. Biochem. 269) Ó FEBS 2002
47. Vita, C. (1997) Engineering novel proteins by transfer of active
sites to natural scaffolds. Curr. Opin. Biotechnol. 8, 429–434.
48. Kharrat, R., Darbon, H., Rochat, H. & Granier, C. (1989)
Structure-activity relationships of scorpion a-toxins. Multiple
residues contribute to the interaction with receptors. Eur. J. Bio-
chem. 181, 381–390.
49. Gordon, D., Moskowitz, H., Eitan, M., Warner, C., Catterall,
W.A. & Zlotkin, E. (1992) Localization of receptor sites for
insect-selective toxins on sodium channels by site directed anti-
bodies. Biochemistry 31, 7622–7628.
50. Gurevitz,M.,Gordon,D.,Ben-Natan,S.,Turkov,M.&Froy,O.
(2001) Diversification of neurotoxins by C-tail ÔwigglingÕ:ascor-
pion recipe for survival. FASEB J. 15, 1201–1205.
51. Pelhate, M., Stankiewicz, M. & Benkhalifa, R. (1998) Anti-insect
scorpion toxins: historical account, activities and prospects. C. R.
Soc. Biol. 192, 463–484.
Ó FEBS 2002 Design of chimeric scorpion a-toxins (Eur. J. Biochem. 269) 2841