Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Structural features in the C-terminal region of the
Sinorhizobium meliloti RmInt1 group II intron-encoded
protein contribute to its maturase and intron
DNA-insertion function
Marı
´
a D. Molina-Sa
´
nchez, Francisco Martı
´
nez-Abarca and Nicola
´
s Toro
Grupo de Ecologı
´
a Gene
´
tica, Estacio
´
n Experimental del Zaidı
´
n, Consejo Superior de Investigaciones Cientı
´
ficas, Granada, Spain
Introduction
Group II introns are large catalytic RNAs found in
organelle and bacterial genomes that splice via a lariat
intermediate, in a mechanism similar to that of splice-
osomal introns [1]. The intron RNA folds into a con-
served 3D structure consisting of six distinct domains,
DI to DVI [2]. Unlike organellar introns, most bacte-

rial group II introns have an internally encoded (ORF
within DIV) reverse transcriptase (RT) maturase. This
intron-encoded protein (IEP) is required for folding
the intron RNA into a catalytically active structure
Keywords
catalytic RNAs; maturase; retroelements;
reverse transcriptase; splicing
Correspondence
N. Toro, Estacio
´
n Experimental del Zaidı
´
n,
Consejo Superior de Investigaciones
Cientı
´
ficas, Calle Profesor Albareda 1, 18008
Granada, Spain
Fax: +34 9581 29600
Tel: +34 9581 81600
E-mail:
(Received 28 September 2009, revised
29 October 2009, accepted 4 November
2009)
doi:10.1111/j.1742-4658.2009.07478.x
Group II introns are both catalytic RNAs and mobile retroelements that
move through a process catalyzed by a RNP complex consisting of an
intron-encoded protein and the spliced intron lariat RNA. Group II
intron-encoded proteins are multifunctional and contain an N-terminal
reverse transcriptase domain, followed by a putative RNA-binding domain

(domain X) associated with RNA splicing or maturase activity and a
C-terminal DNA binding ⁄ DNA endonuclease region. The intron-encoded
protein encoded by the mobile group II intron RmInt1, which lacks the
DNA binding ⁄ DNA endonuclease region, has only a short C-terminal
extension (C-tail) after a typical domain X, apparently unrelated to the
C-terminal regions of other group II intron-encoded proteins. Multiple
sequence alignments identified features of the C-terminal portion of the
RmInt1 intron-encoded protein that are conserved throughout evolution in
the bacterial ORF class D, suggesting a group-specific functionally impor-
tant protein region. The functional importance of these features was dem-
onstrated by analyses of deletions and mutations affecting conserved amino
acid residues. We found that the C-tail of the RmInt1 intron-encoded
protein contributes to the maturase function of this reverse transcriptase
protein. Furthermore, within the C-terminal region, we identified, in a
predicted a-helical region and downstream, conserved residues that are
specifically required for the insertion of the intron into DNA targets in the
orientation that would make it possible to use the nascent leading strand
as a primer. These findings suggest that these group II intron intron-
encoded proteins may have adapted to function in mobility by different
mechanisms to make use of either leading or lagging-oriented targets in the
absence of an endonuclease domain.
Abbreviations
D, DNA binding; En, DNA endonuclease; IEP, intron-encoded protein; RT, reverse transcriptase.
244 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS
in vivo [3–6]. Mobility of these group II introns occurs
by means of a target DNA-primed reverse transcrip-
tion mechanism involving a RNP complex containing
both the intron RNA and the IEP [7–9].
The group II IEPs have an N-terminal RT domain
homologous to retroviral RTs, followed by a putative

RNA-binding domain associated with RNA splicing or
maturase activity (domain X), and a C-terminal DNA
binding (D) ⁄ DNA endonuclease (En) region [10,11].
Biochemical analyses of LtrA mutants (the IEP of the
Ll.ltrB intron of Lactococcus lactis) have suggested
that the N-terminus of the RT domain is required for
protein interactions with the high-affinity binding site
in subdomain DIVa of the intron, whereas other
regions of the RT and domain X interact with con-
served catalytic core regions [12]. Domain X is located
in the position corresponding to the ‘thumb’ and part
of the connection domains of retroviral RTs, and
appears to have a similar structure to these enzymes
[10,13]. The RT domain and domain X are required
for RNA splicing [12]. The En domain, which carries
out second-strand cleavage to generate the primer for
reverse transcription of the inserted intron RNA,
contains sequence motifs characteristic of the H-N-H
family of endonucleases, interspersed with two pairs of
cysteine residues [11,14,15]. Deletion of the conserved
En domain abolishes bottom-strand cleavage, although
the truncated protein retains RNA splicing activity
and can carry out reverse splicing of the intron RNA
into double-stranded DNA target sites. Further dele-
tions of the upstream variable region abolish stable
DNA binding and reverse splicing into double-
stranded DNA target sites, although the protein
retains its ability to splice RNA and to carry out
reverse splicing into single-stranded DNA target sites
[16–19], albeit at a lower rate than the wild-type pro-

tein (approximately 10% of wild-type).
Three main classes (IIA, IIB and IIC) of group II
introns have been described based on the conserved
intron RNA structures [2,20–25]. The L. lactis Ll.ltrB
intron and the yeast aI1 and aI2 introns, which are the
best studied mobile introns and serve as a paradigm
for group II intron mobility, all belong to the IIA
class. The Sinorhizobium meliloti group II intron
RmInt1 is a mobile intron that belongs to subclass
IIB3 [24], showing a IIB-like RNA structure with some
IIA features [21]. Phylogenetic analysis of RT and X
domains has resulted in classification of the ORFs into
several groups [A, B, C, D, E, F, CL1 (chloroplast-like
1), CL2 (chloroplast-like 2) and ML (mitochondria-
like)] [21,22,26]. The RmInt1 IEP belongs to bacterial
ORF class D [21,22]. Moreover, unlike lactococcal and
yeast introns, the RmInt1 IEP and the members of
this class lack the C-terminal D ⁄ En region
[11,14,21,24,27,28]. In vitro assays have shown that
RmInt1 RNPs are thus unable to carry out second-
strand cleavage but do perform reverse splicing into
the target site, in both single- and double-stranded
DNA substrates [29]. RmInt1 is an efficient mobile
element with two retrohoming pathways for mobility;
the preferred pathway involves reverse splicing of the
intron RNA into single-stranded DNA at a replication
fork, using the nascent lagging DNA strand as the pri-
mer for reverse transcription [30]. Similar to the lacto-
coccal and yeast introns, RmInt1 retrohoming also
requires base-pairing interactions between the intron

RNA and the DNA target [31,32]. A previous study
[11] suggested that the IEP of RmInt1 differs from
other IEPs in having only a short (20 amino acids)
C-terminal extension (hereafter referred to as the
C-tail) after a typical domain X, which appears to be
unrelated to the C-terminal regions of other group II
IEPs. It has also been suggested that this C-tail may
be a primordial or remnant DNA-binding region, an
extension of domain X, or simply a nonfunctional
extension.
In the present study, we investigated the C-terminal
region of the RmInt1 IEP up to the maturase domain
and the C-tail. We found that the C-tail and upstream
amino acid residues, located in a predicted a-helical
region, form a functionally important region of the
IEP maturase domain that is conserved throughout the
evolution in the D lineage. We show that C-tail of the
RmInt1 IEP contributes to the maturase function of
this RT protein and have identified, downstream and
in the former putative a-helical region, conserved resi-
dues that are specifically required for the insertion of
the intron RNA into DNA targets in the orientation
that would make it possible to use the nascent leading
strand as a primer for reverse transcription.
Results and Discussion
Multiple sequence-structure alignments
Previously reported multiple sequence alignments sug-
gested that the C-tail of the RmInt1 IEP may extend
from amino acid residues 400–419 (Fig. 1) [11].
Figure 1 shows multiple sequence alignments of the

C-terminal region (domain X and downstream resi-
dues) of class D proteins (see Materials and methods).
The C-terminal region includes the two most highly
conserved sequence motifs in domain X of group II
IEPs: RGWXNYY (RmInt1 residues 349–355) and
R(K ⁄ R)XK (RmInt1 residues 380–383). The predicted
secondary structure of the RmInt1 domain X includes
M. D. Molina-Sa
´
nchez et al. Group II intron maturase C-terminal region
FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 245
four putative a-helices, as in most group II IEPs [13],
and a putative short b-strand in the C-tail. The two
conserved domain X motifs are found at or near the
C-termini of a2 and a3, respectively. The a-helices a1,
a2 and a3 potentially correspond to a-helices aH, aI
and aJ in the thumb of HIV-RT [13].
The domain X region of group II intron RTs
extends downstream from aJ into the region corre-
sponding to the connection domain of HIV-1 RT
[10], which is characterized by three adjoining
b-strands involved in protein dimerization [13]. This
downstream region contains a conserved lysine resi-
due in domain X (K483 in LtrA) [13], whose muta-
tion reduces maturase activity [12]. Interestingly, the
amino acid residue in the equivalent position of
ORF class D is a highly conserved leucine residue
(L396 in RmInt1) located at the C-terminus of
a-helix a4. Upstream of this conserved leucine resi-
due at the N-terminus of a-helix a4, the domain X

contains the conserved amino acid residues HKXRA
(RmInt1 residues 388–392) carrying a stretch of basic
amino acids. Some of the residues of the HKXRA
motif are also conserved in some other group II
IEPs at similar positions, together with the predicted
a-helix [13]. However, a-helix a4 has no equivalent
predicted structure in HIV-1 RT or LtrA protein. In
addition, an idiosyncratic conserved sequence motif
AX
3
PXLF(V ⁄ A)HW (RmInt1 residues 400–410), lies
downstream within the C-tail.
To summarize, the information content (Fig. 1) of
each position in domain X suggests that the C-tail of
class D RT ⁄ maturase proteins (Fig. 2A) is character-
ized by a well conserved sequence motif (hereafter
referred to as a class D motif), LX
3
AX
3
PXLF(V ⁄ A)
HW (RmInt1 residues 396–410), which suggest a
group-specific, functionally important protein region.
Effect of mutations in the C-terminal region of
the RmInt1 IEP on RNA splicing in vivo
We constructed a series of mutants to identify the
functional features of the C-terminal region of the
RmInt1 IEP. Three of these mutants had C-terminal
truncations of different sizes, whereas other mutants
had amino acid substitutions in various positions

(Fig. 2A). Intron RNA excision was analyzed by pri-
mer extension in both total RNA (Fig. 2B) and RNP
particles preparations (Fig. 2C) using a primer P (see
Materials and methods) complementary to a sequence
located 80–97 nucleotides from the 5¢ end of the intron
[29]. The previously reported domain X mutant
K381A [33], in which the last conserved lysine residue
of the conserved R(K ⁄ R)XK motif was replaced by
an alanine residue, retained RNA splicing activity
(approximately 30% of wild-type), measured in both
RNA and RNP particle preparations. These data
suggest that the mutant K381A remains capable of
binding the spliced lariat intron RNA. By contrast, the
Fig. 1. Multiple sequence alignments. The C-terminal region of the RmInt1 IEP (Sr.me.I1) was aligned with other group II IEPs of class D,
using
CLUSTALW. Conserved amino acid residues are highlighted: black, > 50% identity; gray, > 50% similarity; shading was achieved with
BOXSHADE ( Residue numbers are according to the RmInt1 sequence. The predicted
secondary structure of the RmInt1 IEP domain X, based on the
JPRED folding prediction, is shown above the alignments, and a consensus
sequence (indicated by dots) is shown below. Residues identical in all sequences are indicated by asterisks. Highly conserved motifs in the
X domain of group II IEPs RGWXNYY (RmInt1 residues 349–355) and R(K ⁄ R)XK (RmInt1 residues 380–383) are indicated by a line above the
secondary structure prediction. The putative boundaries of domain X and the C-tail [11] are indicated by opposing arrows separated by a
dashed line and a question mark. The bacterial species and the corresponding accession numbers of the IEPs are: S. meliloti (Sr.me.I1,
NP_437164); Ensifer adhaerens (E.a.I1, AAP83798); Sinorhizobium medicae (Sr.med., YP 001313619); Sinorhizobium terangae (Sr.t.I1,
AAU95643); E. coli (E.c.I2, CAA54637); Shewanella putrefaciens (Sh.p., YP_001181807); Azoarcus sp. EbN1 (Az.sp., YP_159836); Legionel-
la pneumophila (L.p., YP_001251128); E. coli B (E.c., ZP_01698243); Prosthecochloris aestuarii (Pr.ae.I3, ZP_00592895); Prosthecochloris
vibrioformis (Pr.vi.I1, YP_001129678); Pelodyction phaeoclathratiforme (Pe.ph.I1, ZP_00589124); Chlorobium phaeobacteroides (Ch.ph.,
YP_911931); Syntrophus aciditrophicus (Sy.a., YP_460783); Methanosarcina acetivorans (M.a.I5, NP_619481); uncultured archaeon
Gzfos32G12 (UA.I3,, AAU83697); Bacillus thuringiensis (B.thu., ZP_00738538); Paracoccus denitrificans (Pa.de.I1, ZP_00628808); Photorhab-
dus luminescens (Ph.l.I2, NP_928428); Magnetococcus sp. (Ma.sp.I3, YP_864580); Pseudomonas aeruginosa (P.ae., ABR13526); Pseudomo-

nas stutzeri (P.st. I3 YP_001172226); Burkholderia phymatum (Bu.ph., ZP_01505671); Frankia sp. (Fr.sp., YP_482811);
Saccharopolyspora erythraea (S.ery., YP_001104541); Pelobacter acetylenicus (Pe.a., AAQ08377); deltaproteobacterium MLMS-1 (delta,
ZP_01288325); Bradyrhizobium japonicum (B.j.I1, NP_768692); Shigella dysenteriae (S.dy.I1, YP_406035); Alkaliphilus metalliredigens
(Al.me.I4, YP_001321146); Bacteroides thetaiotaomicron (B.t.I4, NP_811528); uncultured marine bacterium 18874410 (UMB.I3, AAL78690);
uncultured marine bacterium 18874275 (UMB.I1, AAL78688); Psychroflexus torquis (Pch.t., ZP_01254488); and uncultured marine bacterium
18874408 (UMB.I2, AAL78689). The introns are named according to the Zimmerly nomenclature ( />Sequence logo for class D IEPs is shown below the alignment. The sequence logo ( shows the information con-
tent (4 bits = no degeneracy) for each position in domain X, and is based on the multiple sequence alignment shown in Fig. 2A. Amino acids
are colored according to properties: basic, blue (K, R and H); acidic, red (D and E); hydrophobic, green (P, L, I, V, M, F, W, Y and A); polar,
purple (N, Q, S and T); and black (G and C).
Group II intron maturase C-terminal region M. D. Molina-Sa
´
nchez et al.
246 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS
M. D. Molina-Sa
´
nchez et al. Group II intron maturase C-terminal region
FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 247
mutant (DC29), in which the IEP was truncated such
that the last 29 amino acid residues were missing,
showed no detectable RNA splicing activity when
assayed on total RNA or RNPs extracts, consistent
with the truncation affecting part of domain X. Inter-
estingly, mutants with shorter C-terminal truncations
(DC14 and DC21) displayed no detectable splicing
activity in vivo. A similar result was obtained with the
previously reported domain X double mutation
YY fi AA [33] in the conserved RGWXNYY motif,
in which the Y354 and Y355 amino acids were
replaced by alanine residues, and the 2.5· mutant [27],
in which the IEP was truncated in the RT domain.

Therefore, the pattern of inhibition for the C-terminal
truncations was consistent with proteins that are
missfolded, unstable and ⁄ or unable to interact with
their substrates. Thus, we conclude that the C-tail is
structurally and functionally important for these RT
proteins.
Despite the conserved amino acid residues H388,
K389, R391 and A392 in the predicted a-helix a4 and
the neighboring A400 and P404 in the D motif being
substituted by amino acid residues with very different
structures and properties (Fig. 2A), point mutants
retained substantial RNA splicing activity (‡ 70% of
wild-type) in both RNA (Fig. 2B) and RNP extracts
(Fig. 2C). These results suggest that the former amino
acid residues are not required for the maturase func-
tion of this IEP. By contrast, the mutants in the con-
served residues L396, L406, F407 and W410 within the
D motif showed a greater reduction in the splicing
activity that decreased to 18–60% of wild-type, which
suggests that these amino acid residues contribute to
intron RNA splicing. Furthermore, the mutation of
the conserved amino acid residue H409 (H409G),
which is invariant in multiple sequence alignments,
abolished RNA splicing. Taken together, these findings
show that the C-tail contributes to the maturase func-
tion of these RT proteins and reveal that H409 is the
most critical amino acid residue.
Effect of mutations in the C-terminal region of
the RmInt1 IEP on intron mobility
To test the retrohoming ability of the RmInt1 C-termi-

nal mutants, mobility assays were conducted by using
an intron donor and target-recipient plasmids assay, as
reported previously [30]. S. meliloti strain RMO17
harboring the intron donor plasmid was transformed
with target-recipient plasmids in which the target site
was cloned in the same (LAG) or in opposite (LEAD)
orientation, depending on whether the nascent lagging
or leading DNA strand could be used as a primer for
reverse transcription of the inserted intron RNA. As
expected, all the mutants in the C-terminal region of the
RmInt1 IEP that showed no detectable RNA splicing
activity in vivo did not demonstrate detectable intron
mobility (Fig. 3). Similarly, mutations that strongly
decreased splicing measured in total RNA to £ 33% of
wild-type (F407R, W410D and W410P) demonstrated
no detectable mobility such as occurs with point muta-
tion K381A in domain X. The mutants P404T, L406R
and W410F, which showed higher splicing activity
(80%, 40% and 36% of wild-type, respectively),
retained substantial intron mobility with DNA targets
cloned in both orientations with respect to the replica-
tion fork. Surprisingly, none of the mutations in the
conserved residues H388, K389, R391, A392 and L396
in the predicted a-helix a4 and the neighboring A400
displayed retrohoming on pJB0.6LEAD containing the
target cloned in the orientation that would make it pos-
sible to use the nascent leading strand as a primer for
reverse transcription of the inserted intron RNA. How-
ever, some of them (R391M, A400R and A400V)
retained retrohoming activity into the target DNA site

when cloned in the orientation that would make it possi-
ble to use the nascent lagging DNA strand as a primer
for reverse transcription (pJB0.6LAG), the preferred
retrohoming pathway of RmInt1. Therefore, for these
mutants that retain a substantial level of splicing activity
(‡ 50% of wild-type), intron mobility cannot be directly
predicted from the extent of splicing. Thus, these con-
served residues appear to contribute to intron mobility
and are specifically required for the insertion of the
intron into DNA targets in the orientation that would
make it possible to use the nascent leading strand as a
primer for reverse transcription. Additional data further
support the above conclusion: the W410F mutant
showed a similar reduction of retrohoming (47% of
wild-type) in a target in the lagging strand orientation
but still had retrohoming in the leading strand template
(55% of wild-type). Furthermore, similar mutations in
more efficient constructs (DORF and IEP expressed in
cis; not shown) showed a similar bias for intron mobility
(Fig. S1). It has been suggested that this minor retroh-
oming pathway [30] may involve reverse splicing into
either double-stranded DNA or transiently single-
stranded DNA target sites, and that priming may
include random nonspecific opposite-strand nicks, a
nascent leading strand or de novo initiation of cDNA
synthesis. Because most of these mutants were able to
cleave single- and double-stranded DNA substrates
(Fig. 4), the impairment of mobility may reflect the
requirement of these residues for specific interactions
that are required to initiate the priming reaction after

reverse splicing of the intron RNA into these target
Group II intron maturase C-terminal region M. D. Molina-Sa
´
nchez et al.
248 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS
A
B
C
Fig. 2. Effect of RmInt1 IEP C-terminal mutations on intron RNA splicing. (A) Detailed sequence of the C-terminal region of the RmInt1 IEP.
Highly conserved amino acids are shown in bold. Changes are indicated below each position; deletions are shown with arrows below the
sequence. The boxed residues correspond to the class D motif at the C-terminal region. The predicted secondary structure is indicated
above the sequence; a-helices are represented by cylinders and the b-strand is shown as an arrow. Amino acid positions are indicated. (B)
Splicing measured in total RNA sample or (C) in RNP particle preparations. Representative lanes of the primer extension gel electrophoresis
are shown for each mutant. The molecular sizes of the cDNAs extension products, spliced intron RNA (S) and unspliced precursors (Pr) are
indicated. cDNA bands corresponding to the resolved extension products were quantified with the
QUANTITY ONE software package (Bio-Rad
Laboratories) and intron splicing was measured as 100[S ⁄ (S + Pr)]. Splicing efficiency was plotted as percentage of wild-type values in
pKG2.5. In addition to the C-terminal mutants, other mutants were used as negative controls: 2.5X, which has a frame-shift at the beginning
of the IEP sequence; YAHH, which has a mutation affecting the active site for RT activity (RT domain 5); and D5-CGA, which has a mutation
in the catalytic triad of the ribozyme catalytic core (RNA domain V).
M. D. Molina-Sa
´
nchez et al. Group II intron maturase C-terminal region
FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 249
sites. The results obtained in the present study support
the hypothesis that these group II intron IEPs may have
adapted to function in mobility by different mechanisms
to make use of either leading or lagging-oriented targets
in the absence of a DNA endonuclease domain.
Materials and methods

Bacterial strains, media and growth conditions
S. meliloti RMO17 was cultured at 28 °C on TY medium
for RNA extraction and RNP particle isolation. Escherichia
coli DH5a was used for the construction of mutants and
cloning. E. coli was grown in LB medium at 37 °C. For
plasmid maintenance, the antibiotic kanamycin was
added at a concentration of 200 lgÆmL
)1
for rhizobia
and 50 lgÆmL
)1
for E. coli; ampicillin was added at a
concentration of 200 lgÆmL
)1
for both; and the medium
was supplemented with tetracycline at a concentration of
10 lgÆmL
)1
for mobility assays.
Sequence alignments and secondary-structure
prediction
We searched the NCBI database for class D group II IEPs,
using blastp with the amino-acid sequence (127 residues) of
Fig. 3. Retrohoming in vivo of wild-type RmInt1 and mutant derivatives on DNA target sites cloned in opposite orientations relative to the
direction of plasmid replication. Plasmid pools from S. meliloti RMO17 harboring donor (pKG2.5) and target plasmids (pJB0.6LEAD or
pJB0.6LAG) were analyzed by digestion and Southern hybridization with an exon-specific probe. Recipient plasmid without the DNA target
(pJBD129) was used as a negative control in the assays. Schematic diagrams of the mobility assays are shown at the top (not drawn to
scale). The SalI restriction sites (S) in the plasmids as well as the orientation of the target with respect to the replication fork (arrows) are
indicated. The recipient plasmids contain the intron DNA target cloned in the same (LAG) or in opposite (LEAD) orientation depending on
whether the nascent lagging or leading DNA strand could be used as a primer for reverse transcription of the inserted intron RNA. The

Southern blots are shown below and the hybridization signal corresponding to the target recipient plasmid (T) and the homing product (H)
are indicated. Donor plasmid hybridization signals were removed.
Group II intron maturase C-terminal region M. D. Molina-Sa
´
nchez et al.
250 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS
the RmInt1 IEP domain X (positions 293–419) as the protein
query sequence. The first 66 blast hits obtained with this
query protein were complete or fragmented group II IEPs of
class D. For sequence alignments, we chose 35 complete IEPs
harbored by different bacterial species, including 18 out of 22
currently (updated 11 March 2008) classified as group II
intron bacterial class ORF D in the group II intron database
( clustalw was
used to generate sequence alignments, and the secondary
structure was predicted with the jpred server (http://
www.compbio.dundee.ac.uk/~www-jpred/). The identifica-
tion as class D proteins was further confirmed by phyloge-
netic analyses using class C intron IEPs as outgroup (not
shown). The logo sequence [34,35] was obtained based on
this alignment ( />RmInt1 and mutant derivatives
The pKG2.5, pKG2.5X, pKG2.5-YAHH, pKG2.5D5-
CGA, pKG2.5-DC29, pKG2.5-A354A355 and pKG2.5-
A381 constructs have been described in previous studies
[27,29,33]. Most of the RmInt1 IEP maturase mutants
(Table S1) were generated by site-directed mutagenesis,
using the Altered Sites II in vitro Mutagenesis pAlter-1 Sys-
tem (Promega, Madison, WI, USA), with changes intro-
duced in the pAL2.5 plasmid. This plasmid contains
RmInt1 flanked by exons )175 ⁄ +466 inserted into pALter-

1asaSphI fragment [29]. The changes were introduced
through the use of DNA oligonucleotides, hybridizing
around the position of the intended mutation and abolish-
ing antibiotic resistance. The final constructs were generated
by inserting the RmInt1-containing fragment resulting from
BamHI ⁄ SpeI digestion of pAL2.5 into pKG0. The primers
used for mutagenesis are shown in Table S1. The pKG2.5-
V400 mutant was constructed by a two-step PCR procedure
using the Triple MasterÔ PCR System (Eppendorf, Ham-
burg, Germany). Two pairs of primers were designed to
amplify the 5¢ and 3¢ sections of the IEP, respectively: a 5¢
end primer mut UP (5¢-GTCAGCGGTGCTGGAAG
TATG-3¢) and a 3¢ end primer A400V ⁄ DN (5¢ -ATTTT
CCCGCACCAGCTTTCGCAAGA-3¢) were used to gener-
ate the upstream 824 bp fragment; a 5¢ end primer
A400V ⁄ UP (5¢-GAAAGCTGGTGCGGGAAAATCCGG
G-3¢) and a 3¢ end primer mut DN (5¢-GCGCGCGTAAT
ACGACTCAC-3¢) were used to generate the downstream
689 bp fragment. The mutagenic primers contained a 20 bp
region of overlap and introduced a valine (V) residue in
place of the moderately conserved alanine (A) in position
400 of the IEP, by changing C>T in intron position 1745.
The final 1492 bp fragment was amplified, digested with
EcoRI and SpeI and used to replace the corresponding
wild-type fragment in pKG2.5.
RNA isolation and RNP particle preparation
RNA and RNPs were extracted from free-living cultures of
S. meliloti strain RMO17 containing plasmids encoding the
wild-type or mutant RmInt1, as described previously
Fig. 4. Effect of mutations in the C-terminal region of the RmInt1 IEP on DNA cleavage. The panel on the left shows cleavage in a 5¢-labeled,

symmetric, 70 nucleotides single-stranded DNA substrate, whereas the panel on the right shows cleavage in a 5¢-labeled top-strand, 70 bp
double-stranded DNA substrate. DNA cleavage activity was assayed by incubating a DNA substrate with the RNP-enriched preparations
extracted from cells containing the wild-type or the indicated mutant proteins. The products were analyzed by electrophoresis in a denaturing
6% polyacrylamide gel and quantified with the Quantity One software package (Bio-Rad Laboratories). In lanes marked ‘-RNPs’, DNA substrates
were incubated in the absence of RNPs. Sizes were determined based on DNA sequencing ladders (not shown). S, DNA substrate; C, cleavage
product. Other bands correspond to nonspecific cleavage products. The products expected from partial reverse splicing of the intron RNA into
the insertion site in the DNA are shown at the top. Solid lines indicate DNA and dashed lines correspond to intron RNA.
M. D. Molina-Sa
´
nchez et al. Group II intron maturase C-terminal region
FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 251
[29,33]. For RNA isolation, we collected the cells present in
10 mL of TY medium, supplemented with kanamycin at a
D
600
of  0.6. The cells were lysed and their DNA was
eliminated by incubation with 50 units of RNase-free
DNase I. RNP-enriched fractions were obtained from
200 mL of TY medium plus kanamycin at a D
600
of  0.8.
A clarified lysate of the bacterial cells was layered
onto a 1.85 m sucrose cushion and subjected to 20 h of
centrifugation in a Beckman Ti50 rotor (Beckman Coulter,
Fullerton, CA, USA) at 50 000 g . The resulting pellet was
resuspended in 10 mm Tris–HCl (pH 8.0) and 1 mm
dithiothreitol.
Primer extension assays
These assays were carried out on both total RNA and
RNP particle preparations. Primer extension reactions

were carried out essentially as previously described [29].
The annealing mixture had a volume of 10 lL and con-
tained either 15 lg of total RNA or 0.125 A
260
units
(equivalent of 5 lg of single-stranded RNA) of RNP par-
ticles and 0.2 pmol (300 000 c.p.m.) of [5¢-
32
P]-labeled
P primer (5¢-TGA AAG CCG ATC CCG GAG-3¢)in
10 mm Pipes (pH 7.5) and 400 mm NaCl. This mixture
was first heated at 85 °C for 5 min, and was then rapidly
cooled to 60 °C and allowed to cool more slowly to
45 °C. Extension reactions were initiated by adding 40 lL
of 50 mm Tris–HCl (pH 8.0), 60 mm NaCl, 10 mm dith-
iothreitol, 6 mm MgOAc, 1 mm each of all four dNTPs,
60 lgÆmL
)1
of actinomycin D (Sigma, St Louis, MO,
USA), 15 units of RNAguardÔ RNase inhibitor (GE
Healthcare, Milwaukee, WI, USA) and 7 units of AMV
RT (Roche Diagnostics, Basel, Switzerland). Reaction
mixtures were incubated at 42 °C for 60 min. The reaction
was stopped by adding 15 lLof3m NaAc (pH 5.2) and
150 lL of cold ethanol. Samples were resolved by electro-
phoresis in a denaturing 6% polyacrylamide gel. Primer
extension products were quantified with Quantity One
software package (Bio-Rad Laboratories, Hercules, CA,
USA) and excision efficiency was measured as
100[S ⁄ (S + Pr)].

In vivo retrohoming assays
The mobility of RmInt1 was revealed by a two-plasmid
assay and further Southern hybridization [27,30]. A donor
plasmid (pKG2.5 or IEP mutant derivatives) containing the
full-length intron flanked by a 640 bp fragment
()174 ⁄ +466) of ISRm2011-2 was transferred from E. coli
DH5a to S. meliloti RMO17, an RmInt1-less strain. The
rhizobial host contained a recipient plasmid bearing a
640 bp fragment with the intron insertion site in the same
(pJB0.6LAG) or opposite (pJB0.6LEAD) orientation to the
replication fork. The recipient plasmid pJBD129, which
lacks the RmInt1 target, was used as a negative control in
these assays. Plasmids isolated from transconjugants were
analyzed by SalI digestion, agarose gel electrophoresis and
Southern blotting with an ISRm2011-2 probe. Generally,
we could obtain three hybridization bands: the linearized
donor plasmid (7859 bp), a fragment of the recipient plas-
mid containing the intron DNA target (2017 bp) and an
extra band when the recipient plasmid has been invaded
(3901 bp).
Single- and double-stranded DNA cleavage
assays
DNA cleavage assays were performed essentially as previ-
ously described [29]. RNP-enriched fractions were incu-
bated with a 70-mer [5¢-
32
P]-labeled DNA oligonucleotide
or a 70 bp labeled PCR product ([5¢-
32
P]-labeled top

strand) to check top-strand cleavage. Single-stranded DNA
substrate (ssDNA70) was obtained by labeling 100 pmol of
HPLC-purified primer WT (5¢-AATTGATCCCGCCCG
CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA
ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi of
[c-
32
P]ATP (3000 CiÆ mmol
)1
; GE Healthcare) and 100 units
of T4 polynucleotide kinase (New England Biolabs Inc.,
Ipswich, MA, USA). The double-stranded DNA substrates
(dsDNA70) used in top-strand cleavage and reverse splicing
assays were obtained in the same way. The oligonucleotide
WT was used as a template for amplification of a 70 bp
PCR product with [5¢-
32
P]-labeled S70ds ⁄ UP (5¢-AATT-
GATCCCGCCCGCCTC-3¢) and S70ds ⁄ DN (5¢-GCCCCG
CAGCGGCGCCATGTT-3¢) primers. For PCR, we added
2.5 · 10
)3
pmol of primer template, 50 pmol of each oligo-
mer, 20 pmol of dNTP equimolar mix and 0.2 units of Vent
polymerase (New England Biolabs). The amplification con-
ditions were: 94 °C for 2 min, followed by 25 cycles of
94 °C for 30 s and 60 °C for 30 s, with a final extension at
72 °C for 5 min. Both substrates were gel-purified, eluted
overnight in TE and 0.5 mm ammonium acetate and precip-
itated in ethanol. For the assays, the

32
P-labeled DNA sub-
strates (300 000 c.p.m.) were incubated for 35 min at 37 °C
with 0.2 A
260
units of RNP-enriched fractions in 10 lLof
reaction medium containing 10 mm KCl, 25 mm MgCl
2
,
50 mm Tris-HCl (pH 7.5) and 5 mm dithiothreitol. The
reactions were stopped by extraction with phenol–chloro-
fom–isoamyl alcohol (25 : 24 : 1) in the presence of 0.25 m
sodium acetate and 0.2% linear acrylamide as a carrier.
The products generated were precipitated in ethanol and
analyzed by electrophoresis in a denaturing 6% (w ⁄ v)
polyacrylamide gel, which was dried and quantified with
Quantity One software package (Bio-Rad Laboratories).
Acknowledgements
We would like to thank Ascensio
´
n Martos Tejera
and Vicenta Milla
´
n Casamayor for their technical
Group II intron maturase C-terminal region M. D. Molina-Sa
´
nchez et al.
252 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS
assistance. This work was supported by research grant
BIO2008-00740 from the Ministerio de Ciencia y

Tecnologı
´
a and grant CVI-01522 from Junta de
Andalucı
´
a. M.D.M S. was supported by a predoctoral
fellowship from Junta de Andalucı
´
a.
References
1 Michel F & Ferat JL (1995) Structure and activities of
group II introns. Annu Rev Biochem 64, 435–461.
2 Michel F, Umesono K & Ozeki H (1989) Comparative
and functional anatomy of group II catalytic introns –
a review. Gene 82, 5–30.
3 Carignani G, Groudinsky O, Frezza D, Schiavon E,
Bergantino E & Slonimski PP (1983) An mRNA matur-
ase is encoded by the first intron of the mitochondrial
gene for the subunit I of cytochrome oxidase in S. cere-
visiae. Cell 35, 733–742.
4 Moran JV, Mecklenburg KL, Sass P, Belcher SM,
Mahnke D, Lewin A & Perlman PS (1994) Splicing
defective mutants of the COXI gene of yeast mitochon-
drial DNA: initial definition of the maturase domain
of the group II intron aI2. Nucleic Acids Res 22,
2057–2064.
5 Saldanha R, Chen B, Wank H, Matsuura M, Edwards
J & Lambowitz AM (1999) RNA and protein
catalysis in group II intron splicing and mobility
reactions using purified components. Biochemistry 38,

9069–9083.
6 Matsuura M, Noah JW & Lambowitz AM (2001)
Mechanism of maturase-promoted group II intron splic-
ing. EMBO J 20, 7259–7270.
7 Lambowitz AM, Caprara MG, Zimmerly S & Perlman
PS (1999) Group I and group II ribozymes as RNPs:
clues to the past and guides to the future. In The RNA
World, 2nd edn (Gesteland RF, Cech RF & Atkins JF
eds), pp 451–485. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
8 Belfort M, Derbyshire V, Parker MM, Cousineau B &
Lambowitz AM (2002) Mobile introns: pathways and
proteins. In Mobile DNA II (Craig NL, Craigie R,
Gellert M & Lambowitz AM eds), pp 761–783. ASM
Press Publishers, Washington, DC.
9 Lambowitz AM & Zimmerly S (2004) Mobile group II
introns. Annu Rev Genet 38, 1–35.
10 Mohr G, Perlman PS & Lambowitz AM (1993) Evolu-
tionary relationships among group II intron-encoded
proteins and identification of a conserved domain that
may be related to maturase function. Nucleic Acids Res
21, 4991–4997.
11 San FilippoJ & Lambowitz AM (2002) Characterization
of the C-terminal DNA-binding ⁄ DNA endonuclease
region of a group II intron-encoded protein. J Mol Biol
324, 933–951.
12 Cui X, Matsuura M, Wang Q, Ma H & Lambowitz
AM (2004) A group II intron-encoded maturase func-
tions preferentially in cis and requires both the reverse
transcriptase and X domains to promote RNA splicing.

J Mol Biol 340, 211–231.
13 Blocker FJH, Mohr G, Conlan LH, Qi L, Belfort M &
Lambowitz A (2005) Domain structure and three-
dimensional model of a group II intron-encoded reverse
transcriptase. RNA 11, 14–28.
14 Gorbalenya AE (1994) Self-splicing group I and group
II introns encode homologous (putative) DNA endo-
nucleases of a new family. Protein Sci 3, 1117–1120.
15 Shub DA, Goodrich-Blair H & Eddy SR (1994) Amino
acid sequence motif of group I intron endonucleases is
conserved in open reading frames of group II introns.
Trends Biochem Sci 19, 402–404.
16 Zimmerly S, Guo H, Eskes R, Yang J, Perlman PS &
Lambowitz AM (1995) A group II intron RNA is a cat-
alytic component of a DNA endonuclease involved in
intron mobility. Cell 83, 529–538.
17 Guo H, Zimmerly S, Perlman PS & Lambowitz AM
(1997) Group II intron endonucleases use both RNA
and protein subunits for recognition of specific
sequences in double-stranded DNA. EMBO J 16,
6835–6848.
18 Matsuura M, Saldanha R, Ma H, Wank H, Yang J,
Mohr G, Cavanagh S, Dunny GM, Belfort M &
Lambowitz AM (1997) A bacterial group II intron
encoding reverse transcriptase, maturase, and DNA
endonuclease activities: biochemical demonstration of
maturase activity and insertion of new genetic informa-
tion within the intron. Genes Dev 11, 2910–2924.
19 Singh NN & Lambowitz AM (2001) Interaction of a
group II intron ribonucleoprotein endonuclease with

its DNA target site investigated by DNA footprinting
and modification interference. J Mol Biol 309, 361–
386.
20 Toor N, Hausner G & Zimmerly S (2001) Coevolution
of group II intron RNA structures with their
intron-encoded reverse transcriptases. RNA 7,
1142–1152.
21 Zimmerly S, Hausner G & Wu X (2001) Phylogenetic
relationships among group II intron ORFs. Nucleic
Acids Res 29, 1238–1250.
22 Toro N, Molina-Sa
´
nchez MD & Ferna
´
ndez-Lo
´
pez M
(2002) Identification and characterization of bacterial
class E group II introns. Gene 299, 245–250.
23 Ferat JL, Le Gouar M & Michel F (2003) A group II
intron has invaded the genus Azotobacter and inserted
within the termination codon of the essential groEL
gene. Mol Microbiol 49, 1407–1423.
24 Toro N (2003) Bacteria and archaea group II introns:
additional mobile genetic elements in the environment.
Environ Microbiol 5, 143–151.
M. D. Molina-Sa
´
nchez et al. Group II intron maturase C-terminal region
FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS 253

25 Toro N, Jime
´
nez-Zurdo JI & Garcı
´
a-Rodrı
´
guez FM
(2007) Bacterial group II introns: not just splicing.
FEMS Microbiol Rev 31 , 342–358.
26 Simon DM, Claske NA, McNeil BA, Johnson I, Pan-
tuso D, Dai L, Chai D & Zimmerly S (2008) Group II
introns in Eubacteria and Archaea: ORF-less introns
and new varieties. RNA 14, 1704–1713.
27 Martı
´
nez-Abarca F, Garcı
´
a-Rodrı
´
guez FM & Toro N
(2000) Homing of a bacterial group II intron with
an intron-encoded protein lacking a recognizable
endonuclease domain. Mol Microbiol 35, 1405–
1412.
28 Dai L & Zimmerly S (2002) Compilation and analysis
of group II intron insertions in bacterial genomes:
evidence for retroelement behavior. Nucleic Acids Res
30, 1091–1102.
29 Mun
˜

oz-Adelantado E, San Filippo J, Martı
´
nez-Abarca
F, Garcı
´
a-Rodrı
´
guez FM, Lambowitz AM & Toro N
(2003) Mobility of the Sinorhizobium meliloti group II
intron RmInt1 occurs by reverse splicing into DNA,
but requires and unknown reverse transcriptase priming
mechanism. J Mol Biol 327, 931–943.
30 Martı
´
nez-Abarca F, Barrientos-Dura
´
n A, Ferna
´
ndez-
Lo
´
pez M & Toro N (2004) The RmInt1 group II intron
has two different retrohoming pathways for mobility
using predominantly the nascent lagging strand at DNA
replication forks for priming. Nucleic Acids Res 32,
2880–2888.
31 Jime
´
nez-Zurdo JI, Garcı
´

a-Rodrı
´
guez FM, Barrientos-
Dura
´
n A & Toro N (2003) DNA target site require-
ments for homing in vivo of a bacterial group II intron
encoding a protein lacking the DNA endonuclease
domain. J Mol Biol 326, 413–423.
32 Costa M, Michel F & Toro N (2006) Potential for
alternative intron-exon pairings in group II intron
RmInt1 from Sinorhizobium meliloti and its relatives.
RNA 12, 338–341.
33 Molina-Sa
´
nchez MD, Martı
´
nez-Abarca F & Toro N
(2006) Excision of the Sinorhizobium meliloti group II
intron RmInt1 as circles in vivo.
J Biol Chem 281,
28737–28744.
34 Crooks GE, Hon G, Chandonia JM & Brenner SE
(2004) WebLogo: a sequence logo generator. Genome
Res 14, 1188–1190.
35 Schneider TD & Stephens RM (1990) Sequence logos: a
new way to display consensus sequences. Nucleic Acids
Res 18, 6097–6100.
Supplementary information
The following supporting information is available:

Fig. S1. Retrohoming in vivo of wild-type intron and
C-terminal region mutant derivatives using RmInt1-
engineering constructs DORF.
Table S1. List of RmInt1 IEP mutants with the corre-
sponding oligonucleotides used in its construction.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
Group II intron maturase C-terminal region M. D. Molina-Sa
´
nchez et al.
254 FEBS Journal 277 (2010) 244–254 ª 2009 The Authors Journal compilation ª 2009 FEBS