Báo cáo khoa học: Cross-species divergence of the major recognition pathways of ubiquitylated substrates for ubiquitin⁄26S proteasome-mediated proteolysis potx

Cross-species divergence of the major recognition
pathways of ubiquitylated substrates for ubiquitin⁄26S
proteasome-mediated proteolysis
Antony S. Fatimababy1, Ya-Ling Lin1,2,3, Raju Usharani1, Ramalingam Radjacommare1, Hsing-Ting
Wang1, Hwang-Long Tsai1, Yenfen Lee1 and Hongyong Fu1,2,3
1 Institute of Plant and Microbial Biology, Academia Sinica, Taipei, Taiwan
2 Molecular and Biological Agricultural Sciences Program, Taiwan International Graduate Program, National Chung-Hsing University and
Academia Sinica, Taipei, Taiwan
3 Graduate Institute of Biotechnology and Department of Life Sciences, National Chung-Hsing University, Taichung, Taiwan

Keywords
RPN10; RPN13; ubiquitin receptor; ubiquitin
recognition; UBL–UBA factors
Correspondence
H. Fu, Institute of Plant and Microbial
Biology, Academia Sinica, 128, Sec 2,
Academia Road, Nankang, Taipei 115,
Taiwan
Fax/Tel: +886 2 2787 1183
E-mail:
(Received 23 October 2009, revised 24
November 2009, accepted 2 December
2009)
doi:10.1111/j.1742-4658.2009.07531.x

The recognition of ubiquitylated substrates is an essential element of ubiquitin ⁄ 26S proteasome-mediated proteolysis (UPP), which is mediated directly
by the proteasome subunit RPN10 and ⁄ or RPN13, or indirectly by ubiquitin
receptors containing ubiquitin-like and ubiquitin-associated domains. By
pull-down and mutagenesis assays, we detected cross-species divergence of
the major recognition pathways. RPN10 plays a major role in direct recognition in Arabidopsis and yeast based on the strong affinity for the long and
K48-linked ubiquitin chains. In contrast, both the RPN10 and RPN13 homologs play major roles in humans. For indirect recognition, the RAD23

and DSK2 homologs (except for the human DSK2 homolog) are major
receptors. The human RAD23 homolog is targeted to the 26S proteasome by
the RPN10 and RPN13 homologs. In comparison, Arabidopsis uses UIM1
and UIM3 of RPN10 to bind DSK2 and RAD23, respectively. Yeast uses
UIM in RPN10 and LRR in RPN1. Overall, multiple proteasome subunits
are responsible for the direct and ⁄ or indirect recognition of ubiquitylated
substrates in yeast and humans. In contrast, a single proteasome subunit,
RPN10, is critical for both the direct and indirect recognition pathways in
Arabidopsis. In agreement with these results, the accumulation of ubiquitylated substrates and severe pleiotropic phenotypes of vegetative and reproductive growth are associated with the loss of RPN10 function in an
Arabidopsis T-DNA insertion mutant. This implies that the targeting and
proteolysis of the critical regulators involved are affected. These results support a cross-species mechanistic and functional divergence of the major recognition pathways for ubiquitylated substrates of UPP.
Structured digital abstract
l
A list of the large number of protein-protein interactions described in this article is available
via the MINT article ID MINT-7307429

Abbreviations
GST, glutathione S-transferase; LRR, leucine-rich repeat; PRU, Pleckstrin-like receptor of ubiquitin; RP, regulatory particle; UBA, ubiquitinassociated domain; UBL, ubiquitin-like domain; UIM, ubiquitin-interacting motif; UPP, ubiquitin ⁄ 26S proteasome-mediated proteolysis; Y2H,
yeast two-hybrid analysis.

796

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

Cross-species divergence of ubiquitin receptors

Introduction

Ubiquitin ⁄ 26S proteasome-mediated proteolysis (UPP)
controls the half-life of numerous critical regulatory
proteins and is an intimate regulatory component of
many cellular processes, including cell division, transcription, DNA repair and signal transduction [1]. The
proteasomal recognition of ubiquitylated substrates is
an important mechanistic and regulatory component
of UPP that connects the substrate of the conjugation
machinery to the 26S proteasome. Although the predominant step(s) in controlling substrate specificity are
regulated by post-translational modification or conformational changes in the substrates and by the association between the substrates and their conjugation
enzymes [2,3], accumulating evidence indicates that an
additional layer of substrate selectivity can be mediated by various ubiquitin receptors during the proteasomal recognition of ubiquitylated substrates [4,5].
However, limited information is available on how this
substrate specificity is determined by the ubiquitin
receptors.
The predominant targeting signal for 26S proteasome-mediated proteolysis appears to be the K48-linked
ubiquitin chain, which has a minimum length of four
ubiquitin units [6]. The hydrophobic patch comprised of
L8, I44 and V70 in ubiquitin is the primary contact surface for ubiquitin receptors that mediate proteasomal
degradation [7]. Like other types of linkage, the exact
structural elements in the K48-linked chain that determine the selectivity by various ubiquitin receptors
remain largely undefined. However, they are probably
associated with the L8–I44–V70 hydrophobic surface.
Although the K48-linked ubiquitin chain is the predominant signal for the recognition of ubiquitylated substrates in UPP, structural variants probably exist
because there are abundant receptors in different species. Furthermore, ubiquitin chains that are linked at
other positions, such as K11, K29 and K63, are competent signals for proteasomal degradation [8–10].
Three major classes of ubiquitin receptors for UPP
that appear to be conserved among different species
have been described. The first class includes intrinsic
26S proteasome base subunits, such as RPN10 [11],
RPN13 [12,13] and RPT5 [14], which directly recognize

ubiquitylated substrates. The second class includes
shuttle factors that contain ubiquitin-like (UBL) and
ubiquitin-associated (UBA) domains, such as RAD23,
DSK2 and DDI1, which require an additional proteasomal docking step to target the ubiquitylated substrates to the 26S proteasome. The UBL–UBA factors
contain one UBL and one or two UBAs in the N- and
C-termini that are capable of binding the 26S protea-

some and ubiquitylated substrates, respectively [4,15–
17]. It appears that multiple docking sites for various
UBL–UBA factors are located on the base subcomplex
of the regulatory particle, including RPN1 and the
ubiquitin receptors, RPN10 and RPN13 [12,18]. The
third class includes CDC48-based complexes, which
are involved primarily in endoplasmic reticulum-associated degradation [19,20].
Distinct ubiquitin-binding motifs ⁄ domains are used
by the various ubiquitin receptors [13,21,22]. The
ubiquitin-interacting motif (UIM), the Pleckstrin-like
receptor of ubiquitin (PRU) and UBA are utilized by
RPN10, RPN13 and UBL–UBA factors, respectively.
Multiple ubiquitin-binding sites are associated with different subunits of the CDC48 complexes, including the
NPL4-zinc finger [23] and UBA [24] in NPL4 and p47,
respectively, and the CDC48 ⁄ p97 N-domain fold in
CDC48 and UFD1 [25].
To resolve the mechanistic details of the distinct
proteasomal recognition pathways for the ubiquitylated substrates of UPP, the structural determinants for
several critical interfaces need to be resolved. These
include interactions between various ubiquitin receptors and ubiquitin chains of various linkage types, proteasomal recognition of the UBL–UBA factors,
interactions among the major ubiquitin receptors, and
interactions between ubiquitin receptors and their associated regulators or specific substrates. Moreover, little
is known regarding the biochemical properties of the

major ubiquitin receptors from different species, in
terms of their selectivity for linkage types and the
lengths of the ubiquitin chains and their associated
structural elements. An extensive survey of UBA-containing factors including several mammalian and yeast
UBL–UBA factors revealed significant differences with
regard to the selectivity of the linkage type. However,
these results were primarily acquired using isolated
domains ⁄ motifs and could be substantially different if
examined in the context of the full-length proteins [26].
Furthermore, the potential cross-species divergence of
proteasomal docking and the associated structural
determinants for the UBL–UBA factors have not yet
been thoroughly examined.
Using a cross-species comparison approach, we
observed distinct ubiquitin chain binding properties
and associated structural elements for the major
Arabdopsis, human and yeast ubiquitin receptors.
Moreover, we also identified distinct proteasomal
docking sites and divergent interfaces for the RAD23
and DSK2 homologs. Interestingly, whereas multiple
proteasome subunits are involved in the direct and ⁄ or

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

797


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

indirect proteasomal recognition of ubiquitylated substrates in yeast and humans, a single proteasome subunit (RPN10) is most critical in Arabdopsis. In
agreement with these results, the accumulation of ubiquitylated substrates and severe pleiotropic phenotypes
were observed in an Arabdopsis RPN10 knockout
mutant. This implies that targeting and proteolysis of
the relevant critical regulators are affected. Our results
support a cross-species mechanistic and functional
divergence of the major recognition pathways for the
ubiquitylated substrates of UPP.

dominant targeting signal for UPP [6], the K63-linked
ubiquitin chain is the predominant signal for DNA
repair, endocytosis and signal transduction [27–29].
The major ubiquitin receptors were expressed and purified as glutathione S-transferase (GST)-tagged wildtype or mutated variants (Table S1). The preferences of
various ubiquitin receptors for particular chain types
and lengths were examined using GST pull-down analysis, in which the profiles of the pulled-down and input
chains were compared by immunoblotting.
Whereas Arabdopsis and yeast RPN10 had significantly stronger affinities for long and K48-linked ubiquitin chains rather than the K63-linked chains, the human
RPN10 homolog (S5a) showed strong affinities for long
ubiquitin chains of both linkage types (Table 1 and
Fig. S1). The distinct chain-type preferences of RPN10
from different species were confirmed by competitively
pulling-down mixtures of tetra-ubiquitin chains containing an equal amount of both linkage types, which could
be distinguished by their distinct electrophoretic mobilities (data not shown). A similar, strong affinity for either
the K48- or K63-linked tetra-ubiquitin chain was also
reported previously for S5a [26].
The novel base subunit RPN13 was found to be a
new proteasomal ubiquitin receptor [12,13]. Distinct
ubiquitin chain binding properties were observed for
the Arabdopsis, human and yeast RPN13 homologs. As

shown in Table 1 and Fig. S2A, Arabdopsis RPN13

Results
Divergence of the ubiquitin binding properties
of the major ubiquitin receptors
To examine potential differences in the substrate selectivity and structural divergence of the major ubiquitin
receptors of UPP across species, we determined their
ubiquitin chain binding properties and associated structural elements ⁄ residues. We first compared binding
properties among Arabdopsis, human and yeast homologs of the major ubiquitin receptors RPN10, RPN13,
RAD23, DSK2 and DDI1, with either K48- or K63linked ubiquitin chains consisting of two to seven
ubiquitin units (Table 1). Whereas a K48-linked ubiquitin chain of more than four ubiquitin units is the pre-

Table 1. Ubiquitin chain binding properties and associated structural domains of the major ubiquitin receptors from Arabidopsis, humans
and yeast. DN, data not shown; NA, not applicable; ND, a potential novel domain is involved; PRU, Pleckstrin-like receptor of ubiquitin; TS,
this study; UBA, ubiquitin-associated domain; UIM, ubiquitin-interacting motif.
Arabidopsis

Human
b

Ubiquitin binding

K63 Domainc

Yeast
b

Ubiquitin bindingb

Ubiquitin binding

Moded

Ref

D

TS [20,31] +++ +

+++ +

TS [30] +++ +++ UIM1
+ UIM2
PRU
d
TS
+++ +++ PRU
UBA1
I (N10) TS
+++ +
UBA1
& UBA2
& UBA2
UBA
I (N10) DN
+
++
UBA

+

UBA

Namea

K48

RPN10

+++ +

RPN13
RAD23
(hHR23)
DSK2
(PLIC1)
DDI1

+
+
+++ +

+

UIM1

Moded

Ref

K48

K63

Domainc

D

i?

DN

+

+

ND

K48

K63 Domainc Moded

Ref

UIM

D

TS [30]
TS [12]

TS

D
TS, [12]
I (N10,N13) TS, [20]

)
)
+++ +

NA
UBA1

d?
I (N1)

i

TS

+++ ++

UBA

I (N10) TS [20]

i?

TS

+

UBA*

i?

+

TS [20]

a

The names in parentheses are those for the human homologs. b The approximate binding affinity for either the K48- or K63-linked ubiquitin
chains is designated qualitatively by +++, ++, + and ) for strong, moderate and weak binding, and the absence of binding, respectively.
c
For those situations in which multiple domains are involved in the binding, & indicates that the involved domains contribute additively to
the binding, and + indicates that both domains act cooperatively. Human UIM2 is more critical to the binding and is underlined. UBA of yeast
DDI1 (marked with an asterisk) was determined by mutagenesis to have diverged residues at the interaction interface. d D ⁄ d and I ⁄ i indicate
a direct or indirect role, respectively, in the recognition of ubiquitylated substrates. The upper/bold and lower cases indicate a major and a
minor role, respectively, based on the binding affinity for the K48-linked ubiquitin chains. N1, N10 and ⁄ or N13 (for RPN1, -10 and -13, respectively) in bold and parentheses are the docking subunits for either the RAD23 or DSK2 homologs from different species. A ? is added for
yeast RPN13 and all DDI1 homologs as chain binding activity was not detected using yeast RPN13 and the docking site for DDI1 was not
identified. Therefore, their roles in the recognition of ubiquitylated substrates are not clear.

798

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

exhibited a weak affinity for K48-linked chains of three
and four ubiquitin units and for K63-linked chains of
various lengths. By contrast, human RPN13 had a
strong and approximately equivalent affinity for both
K48- and K63-linked chains, revealing that the binding
is similar to that of human S5a (RPN10). It appears
that human RPN13 prefers chains of more than three
and four ubiquitin units for the K48- and K63-linked
chains, respectively (compare the input and eluted chain
profiles in Fig. S2A). Moreover, yeast RPN13 did not
interact with either K48- or K63-linked chains.
A significant amount of high molecular mass ubiquitylated proteins from crude Arabdopsis extracts can be
pulled-down readily by GST-fused Arabdopsis or
human RPN13 (Fig. S2B, left), indicating a role for
ubiquitylated substrate recognition. In agreement with
the stronger ubiquitin chain binding activity, a
relatively higher level of ubiquitylated proteins was
associated with human RPN13. By contrast, no ubiquitylated proteins can be precipitated using yeast RPN13.
As shown in Table 1 and Fig. S3, distinct ubiquitin
chain binding properties were also detected with the
Arabdopsis, human and yeast UBL–UBA ubiquitin
receptors examined, except with the RAD23 homologs.
Similar to Arabdopsis RPN10 (Fig. S1), RAD23 homologs from Arabdopsis, humans (hHR23b) and yeast
had significantly stronger affinities for longer K48linked chains than for K63-linked chains (Fig. S3A,B).
However, the human DSK2 homolog (PLIC-1) had
moderate affinity but a clear preference for K63-linked
chains (Fig. S3A). This contrasts to the preference for
longer, K48-linked ubiquitin chains displayed by the
Arabdopsis DSK2 homologs (Table 1 and data not
shown). Furthermore, yeast DSK2 showed strong and

nearly equivalent affinities for the K48- and K63linked ubiquitin chains (Fig. S3B). A similar preference
for either K48- or K63-linked tetra-ubiquitin chains
was observed previously for the isolated UBA of yeast
DSK2 [26]. This was confirmed by comparing the pulldown of tetra-ubiquitin chains of either linkage type
(data not shown). In the case of DDI1 homologs, we
observed weak affinities for both K48- and K63-linked
chains when using the human and yeast homologs
(Table 1 and Fig. S3A,B). These results are similar to
those obtained with Arabdopsis DDI1 (Table 1 and
data not shown).
The divergent structural requirements of the
major ubiquitin receptors for ubiquitin chain
binding
To examine the cross-species divergence of the structural requirements for the recognition of ubiquitylated

Cross-species divergence of ubiquitin receptors

substrates, we determined the involved structural elements ⁄ residues of the major ubiquitin receptors
(Table 1). RPN10 homologs from Arabdopsis, humans
and yeast contain three, two and one UIMs, respectively, of which Arabdopsis uses the first UIM (UIM1)
for binding ubiquitin chains [30,31] (Table 1, and data
not shown). Involvement of the UIMs of the human
and yeast RPN10 homologs in binding to K48- and
K63-linked ubiquitin chains was determined using single or double UIM mutations. Five critical hydrophobic residues within UIM1 (216–220; LALAL) and ⁄ or
UIM2 (287–291; IAYAM) of the human RPN10
homolog (S5a) and UIM of yeast RPN10 (228–232;
LAMAL) were replaced by asparagines. Mutation of
UIM abolished the binding activity of yeast RPN10 to
the ubiquitin chains of both linkage types (Fig. S1B,
GST–Scrpn10–uim), indicating that UIM plays a critical role in ubiquitin chain binding. Mutation of UIM2

of the human RPN10 homolog S5a abolished binding
to the K48- and K63-linked chains almost completely,
whereas mutation of UIM1 reduced binding to both
chain types significantly (Fig. S1A, GST–S5a–uim2
and GST–S5a–uim1). Double-site mutation abrogated
the binding activity completely (GST–S5a–uim1_2),
indicating that the two UIM sites of S5a are the primary structural motifs for ubiquitin chain binding.
The association of a stronger binding defect with the
UIM2 mutation suggests a more critical role for
UIM2. It is apparent that the amount of precipitation
of the K48- and K63-linked ubiquitin chains associated
with wild-type S5a cannot simply be attributed to an
additive effect of the two single UIM-containing variants (Fig. S1A), and this observation supports a cooperative binding mode for the two UIMs of the human
RPN10 homolog (S5a).
The residues of human RPN13 that are critically
involved in ubiquitin binding have been identified by
molecular docking, based primarily on the crystal
structure of mammalian RPN13, and these residues
are located within a novel ubiquitin-binding domain
PRU [13]. In general, the corresponding residues are
conserved in Arabdopsis RPN13, but they diverge significantly in yeast RPN13 (Fig. S4). These findings are
in agreement with the observation that yeast RPN13 is
unable to bind both ubiquitin chains and conjugates.
Several critical residues of mammalian RPN13, including L56, F76, D79 and F98, have been shown to be
essential for ubiquitin binding using mutagenesis and
in vitro pull-down assays [13]. Binding to both the
K48- and K63-linked ubiquitin chains was affected
drastically when the corresponding residues of Arabdopsis and human RPN13 were mutated individually to
A, R, Q (or N) and R, respectively (Figs S4–S5),

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

799


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

indicating that the same interfaces in Arabdopsis and
human RPN13 appear to be critical for ubiquitin chain
binding (Table 1).
RAD23 homologs from Arabdopsis, humans or yeast
contain two UBA domains (UBA1 and -2), in which
each of the UBAs of Arabdopsis RAD23 contributes
additively to the binding of K48-linked ubiquitin
chains (Table 1 and data not shown). The roles of the
UBAs in ubiquitin chain binding of human and yeast
RAD23 homologs were determined using single- or
double UBA mutations (Table 1 and Fig. S6A,B).
Three conserved residues implicated in ubiquitin binding within each UBA were replaced with alanines;
these residues were 200–202 (MGY) and 376–378
(LGF) in the human homolog hHR23b and 158–160
(MGY) and 367–369 (LGF) in yeast RAD23. As
shown in Fig. S6A, mutation of UBA1 or UBA2 of
human hHR23b reduced the binding activity of K48or K63-linked ubiquitin chains significantly, indicating
that both UBAs are critical for the binding of ubiquitin chains of both linkage types. It appears that the
amount of K48-linked ubiquitin chain pulled-down by
the wild-type protein is approximately the additive
contribution of the two single UBA site-containing

mutants. Mutation of both sites completely abrogated
the chain binding activity (uba1_2) of both linkage
types, indicating that the two UBA sites of human
hHR23b are the primary structural motifs responsible
for ubiquitin chain binding. For yeast RAD23, the
mutation of UBA1, but not of UBA2, abrogated the
binding activity to ubiquitin chains of either linkage
type almost completely, indicating that UBA1 plays a
major role in binding of the ubiquitin chain (Fig. S6B).
Mutation of both sites also abrogated the binding
activity for both linkage types completely (Fig. S6B,
uba1_2).
The human DSK2 homolog (PLIC1) and yeast
DSK2 and DDI1 each contain a single UBA; the role
of these UBAs in ubiquitin chain binding was determined (Table 1 and Fig. S6C). No sequence similar
to the UBA was identified in human DDI1, suggesting that a potentially novel structural motif is
involved in ubiquitin binding. Two conserved residues
believed to mediate the interaction with ubiquitin
within the various UBAs were replaced by alanines;
these are 557–558 (MG) of the human DSK2 homolog (PLIC1), 342–343 (MG) of yeast DSK2 and 401–
402 (LG) of yeast DDI1. Mutation of the UBA of
human and yeast DSK2 homologs abolished binding
to ubiquitin chains of both linkage types, as did the
equivalent UBA mutants of the Arabdopsis DSK2
homologs (Table 1 and Fig. S6C). The UBA mutation
of yeast DDI1 also abolished binding to K63-linked
800

ubiquitin chains. However, although it was significantly reduced, we clearly detected binding of the
UBA-mutated yeast DDI1 to K48-linked ubiquitin

chains. This contrasts with the complete abrogation
of binding associated with a similar UBA mutation
of Arabdopsis DDI (Table 1 and data not shown).
This indicates a possible variation in the chainbinding interface in yeast DDI1.
Structural divergence of proteasomal recognition
of the RAD23 and DSK2 homologs by RPN10
With respect to the indirect recognition of ubiquitylated substrates by UBL–UBA factors, it is not
known whether the same proteasomal docking sites
are used in a given species and whether the docking
sites and associated interfaces are conserved across
species. Arabdopsis uses RPN10, but not RPN1 and
RPT5, to receive RAD23 and DSK2 through separate
sites (UIM3 and UIM1, respectively) (see below and
Table 2). We determined the potential role and associated domains ⁄ residues of the human and yeast
RPN10 homologs in the recognition of UBL–UBA
factors using pull-down assays (Table 2 and Figs 1–2).
Human and yeast RPN10 homologs were expressed
and purified as T7-tagged wild-type or mutated variants; the UBL–UBA factors, including the RAD23,
DSK2 and DDI1 homologs, were expressed and purified as GST-tagged wild-type or mutated variants
(Table S1).
As shown in Fig. 1A, the human RPN10 homolog
(S5a) was pulled-down readily by the GST-fused
RAD23 (hHR23b) or DSK2 (PLIC1) homolog, but
not by DDI1. By contrast, yeast RPN10 was pulleddown by GST-fused DSK2, but not RAD23 and
DDI1 (Fig. 1B). These results indicate that, as for
Arabdopsis RPN10, the human RPN10 homolog (S5a)
can function as a potential docking subunit for both
the RAD23 and DSK2 homologs. However, yeast
RPN10 can serve as a docking subunit for DSK2 but
not for RAD23 (Table 2).

The involvement of the UIM in the human and
yeast RPN10 homologs in recognition of the RAD23
and ⁄ or DSK2 homologs was determined (Table 2)
using single and double UIM mutations similar to
those used in the chain-binding analyses. Compared
with wild-type human S5a, recovery of the UIM1 or
UIM2 mutant by GST-fused hHR23b or PLIC1 was
significantly reduced or completely abolished, respectively (Fig. 1A, uim1 and uim2). This indicates that
UIM1 and, in particular, UIM2 of S5a play a critical
role in the recognition of hHR23b and PLIC1. The
amount of wild-type S5a precipitated using GST-fused

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


TS
TS
UBL
UBL (V87)
UIM1
PRU

Names in parentheses are those for the corresponding human homologs. b Potential docking subunits that are underlined and in bold are those that are involved in the association with
the RAD23 or DSK2 homologs for the major indirect recognition pathways. c For docking subunits that involve multiple motifs ⁄ domains, & indicates that the involved motifs contribute
independently to the interaction, and + indicates that both motifs act cooperatively. Motifs that are underlined and in bold are more critical for the interaction. S5a in parentheses is the
designated name for the human RPN10 homolog. d IF, the interface regions on the UBL–UBA factors that are involved in binding with the docking subunit. The abbreviated amino acids
that are indicated in parentheses are those that are potentially divergent residues, as determined using mutagenesis.
a

TS

[18]
TS
UBL (L44,I45,L70,V71)
UBL
UBL (L44,L70,V71)
ND
UBL
UBL
RPN10
RPN13
DSK2 (PLIC1)

ND
UIM1 + UIM2
PRU

TS
TS
TS

RPN10
RPN1
RPN13

UIM
LRR
PRU

TS [18]
UBL

LRR
UBL (I47)
TS, UP
UBL
UIM2 & UIM3

IF on
UBL–UBAd
Sitec

RPN10
(S5a)
RPN13
RPN10
RPN13
RPN10
RAD23 (hHR23b)

UIM1 + UIM2

TS

RPN1

IF on UBL–UBAd
Docking
subunitb
IF on
UBL–UBAd
Docking

subunitb
Docking
subunitb
Namea

Ref

Human

Sitec

Ref

Yeast

Sitec

Ref

Cross-species divergence of ubiquitin receptors

Arabidopsis

Table 2. Distinct proteasomal docking site(s) of the RAD23 and DSK2 homologs from Arabidopsis, humans and yeast. LRR, leucine-rich repeat; ND, a potential novel domain is involved;
PRU, Pleckstrin-like receptor of ubiquitin; TS, this study; UBA, ubiquitin-associated domain; UBL, ubiquitin-like domain; UIM, ubiquitin-interacting motif; UP, YL, Lin and H. Fu, unpublished
results.

A. S. Fatimababy et al.

A

B

Fig. 1. Interaction analyses of the human and yeast RAD23, DSK2
and DDI1 homologs with the proteasome subunit RPN10. (A) Association of human hHR23b and PLIC1, but not DDI1, with the proteasome subunit S5a. Wild-type and UIM variants of human S5a
were pulled-down using GST-fused hHR23b, PLIC-1 or DDI1. (B)
The association of yeast DSK2, but not RAD23 or DDI1, with
RPN10. Wild-type and UIM variants of yeast RPN10 were pulleddown using GST-fused RAD23, DSK2 or DDI1. The pulled-down
products derived from GST alone were analyzed as a negative
control. One-fiftieth of the input prey (Inp) and the pulled-down
products were immunoblotted against an anti-T7 IgG (a-T7). Onetwentieth of the various prey (Prey 2.5·) and one-fifth of a set of
eluted products (Baits 10·) were examined by staining with Brilliant
Blue R to confirm equivalent prey input and bait immobilization,
respectively.

hHR23b or PLIC1 did not reflect additive contributions from the two single UIM mutants. This indicates
possible cooperation between UIM1 and UIM2 in S5a
in the interaction with hHR23b and PLIC1 (Fig. 1A),
in a way that is similar to their roles in ubiquitin chain
binding (Fig. S1A). As expected, recovery of the double UIM mutant by either GST-fused hHR23b or
PLIC1 was also abrogated completely (uim1_2). For
yeast RPN10, the UIM mutation abolished its recovery by GST-fused DSK2. This indicates that it is critical for DSK2 recognition, in addition to its role in
ubiquitin chain binding (Fig. 1B, uim).
Because the UIMs of RPN10 homologs are
involved in recognition of the RAD23 and ⁄ or DSK2
homologs, it is rational to suggest that the potential
hydrophobic patches in the UBLs of the RAD23 and
DSK2 homologs, which are equivalent to the hydrophobic patch containing L8, I44 and V70 in ubiquitin, are involved in the association with the RPN10
homologs. In general, residues that correspond to L8,
I44 and V70 of ubiquitin in the UBLs of the RAD23

and DSK2 homologs from Arabdopsis, humans and
yeast are conserved. However, we observed a clear
divergence in the corresponding residues in the UBLs
of the yeast RAD23 and DDI1 homologs (Fig. S7),
supporting their inability to associate with the
RPN10 homolog. We examined the role and poten-

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

801


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

A

B

Fig. 2. The UBLs of human and yeast RAD23 and ⁄ or DSK2 homologs are critical for association with the proteasomal subunit
RPN10. The association with the RPN10 homolog from humans
(S5a) or yeast (ScRPN10) was analyzed by pull-down using various
GST-fused UBL variants of human hHR23b, PLIC1 (A) or yeast
DSK2 (B). One-hundredth of the input RPN10 homolog (Inp) from
humans or yeast and the pulled-down products were analyzed by
immunoblotting against a-T7. One-tenth of the pulled-down products (Baits 10·) was examined by staining with Brilliant Blue R to
confirm that the baits had been immobilized equally. The pulleddown products that were derived from GST alone were analyzed
as a negative control. The asterisks indicate degradation products
of the GST-fused yeast DSK2 variants. WT, wild-type.

tial divergence of hydrophobic patches in the UBLs
of the RAD23 and ⁄ or DSK2 homologs from Arabdopsis, humans and yeast in binding to RPN10. Two
conserved residues that were equivalent to L8, I44 or
V70 of ubiquitin in the UBLs of the RAD23 and
DSK2 homologs from Arabdopsis and humans were
replaced separately by alanine (Fig. S7). Replacement
of the residue corresponding to L8 or I44 of ubiquitin in Arabdopsis RAD23 and I44 or V70 of ubiquitin in Arabdopsis DSK2 abrogated the RPN10
interaction (Table 2 and data not shown). Whereas
similar replacements in the human RAD23 homolog
(hHR23b; L8A) and the DSK2 homolog (PLIC1;
I79A and V105A) abrogated the interaction with the
human RPN10 homolog (S5a), replacement of the
residue corresponding to I44 of ubiquitin in human
hHR23b (I47A) did not (Fig. 2A). In yeast DSK2,
replacement of the residue that corresponds to I44 or
V70 of ubiquitin (I45 and V71, respectively) or their
adjacent residue (L44 or L70, respectively) did not
affect the association with RPN10 (Fig. 2B). Only
the double-alanine mutation at positions 44–45 (LI)
or 70–71 (LV) and a UBL deletion mutant (UBLD;
residues 1–73 deleted) of yeast DSK2 abolished the
association with RPN10 (Fig. 2B). These results indicate that the UBLs of the human RAD23 and DSK2
802

homologs and yeast DSK2 play a role in the association with the RPN10 homolog. Furthermore, we
detected a clear structural divergence in the UBL
interfaces of human hHR23B and yeast DSK2, compared with the corresponding homologs in Arabdopsis
(Table 2).
We further examined the overall structural conservation of the interfaces between RPN10 and RAD23 or

DSK2 homologs using cross-species interaction analyses. Wild-type and single or double UIM variants of
the RPN10 homolog from one species were tested
using GST pull-down assays to assess their ability to
interact with the RAD23 (Fig. 3A–C) or DSK2 homologs (Fig. 3D–F) from different species. As shown in
Fig. 3A, the single-site mutation of UIM3 (uim3), but
not of UIM1 or -2 (uim1 or uim2), abolished the association of RPN10 with the RAD23 homolog from
humans or Arabdopsis. Furthermore, the double UIM
mutant (uim1_2) containing an intact UIM3 motif
associated with the Arabdopsis and human RAD23
homologs, but the double UIM mutants (uim2_3 and
uim1_3) containing intact UIM1 or UIM2 motifs,
respectively, did not. Similarly, as shown in Fig. 3B,
human S5a was capable of interacting in a cooperative
manner with the RAD23 homolog from humans or
Arabdopsis through UIM2 and, to a lesser extent,
UIM1. Interestingly, whereas the Arabdopsis and
human RAD23 homologs were capable of interacting
with yeast RPN10 through UIM (Fig. 3C), yeast
RAD23 did not bind to yeast RPN10 or to the Arabdopsis and human RPN10 homologs (Fig. 3A–C,
upper). These results indicate that the interfaces of the
RPN10–RAD23 interaction are conserved in Arabdopsis and humans, and that UIM3 of Arabdopsis RPN10
and both UIM sites of human S5a play critical roles.
However, whereas the UIM motif of yeast RPN10 is
conserved through evolution for association with the
RAD23 homologs from Arabdopsis and humans, the
UBL of yeast RAD23 has diverged.
Using single and double UIM mutations, we found
that RPN10s from Arabdopsis and yeast were capable
of interacting with DSK2 homologs from other species
through UIM1 and UIM, respectively, as seen with

DSK2 from their own species (Fig. 3D,F). For the
human RPN10 homolog (S5a), both UIM1 and UIM2
facilitated association with the Arabdopsis and yeast
DSK2 homolog (Fig. 3E). Whereas UIM2 played a
more critical role in the interaction with the DSK2
homolog of both humans and Arabdopsis, UIM1
played a more critical role in the interaction with yeast
DSK2 (Fig. 3E). The latter probably evolved to cope
with the divergent UBL interface detected in yeast
DSK2 (Fig. 2B).

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

Cross-species divergence of ubiquitin receptors

A

B

Fig. 3. Cross-species interaction analyses
between the homologs of RPN10 and
RAD23 or DSK2. Wild-type and single or
double UIM mutants of the Arabdopsis
(A,D), human (B,E), or yeast (C,F) RPN10
homologs were analyzed separately by pulldown using various GST-fused Arabdopsis,
human and yeast RAD23 (A–C) or DSK2
(D–F) homologs. The various UIM mutations

for Arabdopsis RPN10 are located at
residues 226–230 for uim1 (LALAL fi
DDDDD), 286–290 for uim2 (LLDQA fi
NNDND) and 310–314 for uim3 (LALAL fi
NNNDN). One-fiftieth of the prey (Input)
and pulled-down products were analyzed by
immunoblotting against a-T7. One-fifth of a
set of eluted products (Baits 10·) was
examined by staining with Brilliant Blue R to
confirm that the baits had been immobilized
equally.

D

E

C

F

Structural divergence of the RPN13-mediated
proteasomal recognition of the RAD23 and DSK2
homologs
As reported recently, the base subunit RPN13 is also
capable of binding to UBL–UBA factors [13]. We

determined the roles and associated interfaces of
Arabdopsis, human and yeast RPN13 homologs in the
recognition of UBL–UBA factors (Table 2). Arabdopsis, human and yeast RPN13 and RPN10 (for comparison) homologs were purified as T7-tagged proteins
(Fig. 4A), and the UBL–UBA factors, including the

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

803


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

A

B

C

D

Fig. 4. Interaction analyses of the RAD23, DSK2 and DDI1 homologs from Arabdopsis, humans and yeast with the proteasome subunit
RPN13. (A) The input prey of the T7-tagged RPN13 and RPN10 homologs. One-fifth of the input Arabdopsis, human and yeast RPN10 and
RPN13 homologs (1 lg each) were visualized by staining with Brilliant Blue R. Purified recombinant yeast RPN13 was mobilized as a doublet, which is probably derived from different translational initiation sites. (B–D) The RPN10 and RPN13 homologs from Arabdopsis (B),
humans (C) or yeast (D) were analyzed separately by pull-down using GST-fused RAD23, DSK2 or DDI1 homolog(s) from the respective species. The Arabdopsis RAD23 homologs examined include RAD23b–d. One-hundredth of the input RPN10 or RPN13 homologs (Input) and
the pulled-down products were analyzed by immunoblotting against a-T7. One-tenth of the eluted products (Baits 10·) was examined by
staining with Brilliant Blue R to confirm that the baits had been immobilized equally. The pulled-down products that were derived from GST
alone were analyzed as a negative control, and the RPN10 pull-down analyses were analyzed for comparison.

RAD23, DSK2 and DDI1 homologs, were purified as
GST-tagged proteins. As shown in Fig. 4B,D, Arabdopsis (AtRPN13) and yeast (ScRPN13) RPN13 homologs were recovered using GST-fused DSK2, but not
RAD23 and DDI1, homologs from their respective
species. However, recovery occurred at a significantly

lower level compared with the RPN10 homolog
pulled-down using GST-fused Arabdopsis RAD23 homologs or DSK2a (Fig. 4B), or using GST-fused yeast
DSK2 (Fig. 4D). Human RPN13 was recovered using
GST-fused human hHR23b or PLIC1, but not DDI1,
at a level slightly lower than that of S5a recovered
using the respective GST-fusion (Fig. 4C). The data
indicate that Arabdopsis or yeast RPN13, which has a
minor role compared with RPN10, is capable of functioning as a recognition subunit for DSK2, and that
human RPN13 is capable of serving as the recognition
subunit for both hHR23b and PLIC1.
It is logical to propose that the interfaces ⁄ residues in
the PRU domains of Arabdopsis and human RPN13
responsible for ubiquitin chain binding (Fig. S5) are
also involved in recognition of the UBL–UBA factors.
804

The same single-residue mutants of RPN13 from
Arabdopsis or humans as constructed for the ubiquitinbinding experiments were used to determine their role
in the recognition of RAD23 and ⁄ or DSK2 homologs.
A few residues, including E72 and F91 (corresponding
to D79 and F98 in mammalian RPN13), are also conserved in the potential PRU domain in yeast RPN13
(Fig. S4). Therefore, we mutated E72 and F91 to Q72
and R91, respectively, and tested their role in the recognition of yeast DSK2. In addition, we mutated L43
in yeast RPN13 at a position one residue away from
F45 (corresponding to L56 of mammalian RPN13) to
alanine, and tested this mutant also. All the tested residues appear to be critical for the interaction between
the RPN13 and DSK2 homologs from Arabdopsis,
yeast and humans. When compared with wild-type
proteins from Arabdopsis (Fig. 5A), yeast (Fig. 5B)
and humans (Fig. 5C), the levels of the RPN13 variants recovered using the GST-fused DSK2 homologs

from the respective species were reduced drastically.
However, apart from a slight reduction in the recovery
of human RPN13 variant A56 using GST-fused

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

Cross-species divergence of ubiquitin receptors

A

Fig. 5. Cross-species interaction analyses
between the RPN13 variants and the DSK2
or RAD23 homologs. The Arabdopsis (A),
yeast (B) or human (C) RPN13 variants were
analyzed by pull-down using GST-fused
Arabdopsis, human or yeast DSK2 homologs. Human RPN13 variants were also analyzed using GST-fused Arabdopsis
(RAD23b–d), human or yeast RAD23 homologs (D). The RPN13 variants that were
examined include the wild-type and singleresidue mutants L47A, F67R, E70Q and
F88R for Arabdopsis (A); L43A, E72Q and
F91R for yeast (B); and L56A, F76R, D79N
and F98R for humans (C,D). The mutagenized residues correspond to L56, F76, D79
or F98 in the PRU domain of mammalian
RPN13 [13] (Fig. S4). One-hundredth of the
input RPN13 variants (Input) and one-hundredth (1·) or one-tenth (10·) of the
pulled-down products were analyzed by
immunoblotting against a-T7. One-tenth of
the eluted products (Baits 10·) was

examined by staining with Brilliant Blue R to
confirm that the baits had been immobilized
equally. The pulled-down products that were
derived from GST alone were analyzed as a
negative control. The asterisks in (C) indicate an unspecific pull-down product.

B

D
C

hHR23b, human RPN13 variants were recovered at a
level equivalent to wild-type RPN13 (Fig. 5D,
Human). These observations indicate that Arabdopsis,
human and yeast DSK2 homologs might be recognized
by RPN13 homologs from the respective species using
the conserved interfaces in the PRU domains [12,13],
which are also critical for ubiquitin binding. Interestingly, the interface of the PRU of human RPN13,
which is critical for the interaction with ubiquitin and
PLIC1, is not required to bind hHR23b.
Because the conserved residues of the PRU domain
of Arabdopsis, human and yeast RPN13 homologs
have roles in the interaction with the DSK2 homolog
from the respective species, we decided to test the
hydrophobic patches within the UBLs of the DSK2
homologs for their involvement in the interaction with

RPN13. The potential involvement of the hydrophobic
patch in the UBL of hHR23b was also examined. The
UBL variants constructed for analysis of the association of RPN10 with human hHR23b and the DSK2

homologs from Arabdopsis, humans and yeast were
examined for their association with RPN13. Whereas
the recovery of human RPN13 was abrogated when
the GST-fused I79A or V105A PLIC1 variant was
used (Fig. 6B), recovery of Arabdopsis RPN13 was
abrogated using the GST-fused Arabdopsis I61A
DSK2a variant, but not the V87A variant (Fig. 6A).
All the residues tested in yeast DSK2 affected RPN13
recognition. However, I45 and L44 appear to be more
critical for the interaction with RPN13 than V71 and
L70 (Fig. 6C). Recovery of yeast RPN13 was abolished when the GST-fused I45A or L44A DSK2 single

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

805


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

A

B

C

Fig. 6. The role of the hydrophobic patches in the UBLs of the
DSK2 homologs and human hHR23b in association with RPN13.
The Arabdopsis (AtRPN13), human (HsRPN13) or yeast (ScRPN13)

RPN13 were analyzed by pull-down using various GST-fused UBL
variants of Arabdopsis DSK2 (A), human hHR23b or PLIC1 (B) or
yeast DSK2 (C). The UBL variants of human hHR23b and PLIC1,
and yeast DSK2, are the same as those used for association with
the RPN10 homologs (Fig. 2). For the UBL variants of Arabdopsis
DSK2, two of the conserved residues, which were equivalent to
I44 and V70 of ubiquitin, were individually mutagenized to alanine
(I61A and V87A). One-hundredth of the input Arabdopsis, human or
yeast RPN13 homologs (Input) and the pulled-down products were
analyzed by immunoblotting against a-T7. One-tenth of the pulleddown products (Baits 10·) was examined by staining with Brilliant
Blue R to confirm that the baits had been immobilized equally. The
pulled-down products that were derived from GST alone were analyzed as a negative control.

mutant, or the LI–AA (44–45) double mutant, was
used. The recovery of yeast RPN13 was reduced significantly when using GST-fused V71A, L70A or LV–AA
(70–71) DSK2 mutants. As expected, the recovery of
yeast RPN13 was abolished using the GST-fused
DSK2 UBL deletion mutant (Fig. 6C, UBLD). These
results indicate clearly that structural divergence exists
at the interfaces of the UBLs of Arabdopsis, human
and yeast DSK2 homologs for RPN13 association.
Human RPN13 was recovered at a similar level
using the GST-fused hHR23b or hHR23b variants
(Fig. 6B; L8A and I47A), indicating that the hydrophobic patch in the UBL of hHR23b is nonessential
for RPN13 association. This corroborates the aforementioned observation that the ubiquitin-binding
806

interface in the human RPN13 PRU is not critical for
association with hHR23b (Fig. 5D), and that novel
interfaces are probably involved.

We examined the overall structural conservation of
the interfaces between the RPN13 and DSK2 homologs further using cross-species interaction analyses.
Arabdopsis RPN13 was recovered at a reduced efficiency using the GST-fused human and yeast DSK2
homologs when compared with the level that was
recovered using GST-fused Arabdopsis DSK2a
(Fig. 5A). Mutation of critical residues in the Arabdopsis RPN13 PRU disrupted this interaction (Fig. 5A).
Human RPN13 was recovered at a similar level using
GST-fused human or yeast DSK2 homologs (Fig. 5C).
The mutation of critical residues in the PRU of human
RPN13 also disrupted the interaction (Fig. 5C). Yeast
RPN13 was recovered only when using GST-fused
yeast DSK2, and not when using GST-fused Arabdopsis or human DSK2 homologs (Fig. 5B). Our results
suggest that the overall structure of the RPN13–DSK2
interface is conserved across species. However, the lack
of cross-species interaction between yeast RPN13 and
either the human or Arabdopsis DSK2 homologs is in
agreement with the observation of a greater divergence
at critical positions on the PRU interface for yeast
RPN13 (Fig. S4).
Interestingly, human RPN13 and its single-mutation
variants were recovered using GST-fused Arabdopsis
or yeast RAD23 homologs at a level similar to the
recovery level observed when using GST-fused
hHR23b (Fig. 5D). This suggests that the interface of
hHR23b responsible for its interaction with human
RPN13 is conserved in the Arabdopsis and yeast
RAD23 homologs. It also suggests that the interfaces
of the Arabdopsis and yeast RPN13s, which correspond to the interface of human RPN13 that mediates
the interaction with the RAD23 homologs, are divergent or have been deleted. In agreement with this suggestion, neither the Arabdopsis nor yeast RPN13
homolog was recovered when using GST-fused

hHR23b (data not shown).
Yeast RAD23 is recognized by the base subunit
RPN1
As reported previously, RPN1 is the primary docking
subunit for RAD23 in yeast [18]. Yeast DSK2 also competes slightly for the interaction between RAD23 and
the 26S proteasome, indicating that DSK2 can also be
recognized by RPN1 [18]. However, a direct interaction
between Arabdopsis RPN1 and UBL–UBA factors,
including the RAD23 and DSK2 homologs and DDI1,
was not detected (data not shown). To confirm the pos-

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

Cross-species divergence of ubiquitin receptors

sible role of yeast RPN1 and RPN10 in the recognition
of RAD23 and DSK2, respectively, and to explore
whether other potential proteasome subunits are important for the recognition of RAD23, DSK2 and DDI1,
we searched for direct binding partners from the subunits of the regulatory particle (RP) of the 26S proteasome
using yeast two-hybrid (Y2H) analyses.
As shown in Fig. S8A, yeast RAD23, DSK2 and 17
RP subunits, including RPT1–6, RPN1–3 and RPN5–12,
were analyzed as C-terminal GAL4-BD fusions and as Cand N-terminal GAL4–AD fusions. DDI1 was tested as
N- and C-terminal GAL4–AD fusions. After analyzing
all possible BD ⁄ AD fusion combinations between the RP
subunits and UBL–UBA factors (Fig. S8A), we detected
interactions between DSK2 and RPN10, and between

RAD23 and RPN1 (Fig. S8D). An interaction between
RAD23 and RPT6 was also detected. However, the interactions between RAD23 and RPN1 and RAD23 and
RPT6 were weak, and only one of the two Y2H reporters
(HIS3) was activated. These results support the observation that the recognition of RAD23 is mediated by RPN1
in yeast [18]. In addition, the stronger Y2H interaction
also suggests that the recognition of DSK2 could potentially be mediated by RPN10.
RPN10 is critical for both vegetative and
reproductive growth in Arabdopsis
Based on in vitro interaction analyses, Arabdopsis
RPN10 appears to play a critical role in both the

A

B

C

D

Fig. 7. RPN10 is essential for Arabdopsis growth and development. A T-DNA insertion knockout Arabdopsis mutant, rpn10-2, was characterized. (A) The T-DNA insertion site in the fourth intron of RPN10 (At4g38630) for rpn10-2 is indicated schematically (large triangle, not to
scale). Exons and introns are indicated using boxes and lines, respectively. The positions of the primers that were used to detect the T-DNA
insert, the endogenous RPN10 gene and the transcript are indicated. The primers that were used include GABI-LB4, RPN10-5¢b (5¢b),
RPN10-3¢B (3¢B), cRPN10–Sma (cN10-Sma) and cRPN10–Sst (cN10-Sst) (see Experimental procedures). (B) Transgene genotyping and transcript expression of the rpn10-2 and complementation lines. (Left) The presence of endogenous RPN10 (eN10), T-DNA insertion (tDNA) and
the complemented RPN10 (cN10) coding region were examined by PCR using genomic DNA that was isolated from Col-0, rpn10-2 and
rpn10-2 expressing the RPN10 coding region driven by the CaMV 35S promoter (two lines, line-1 and -2), respectively. (Right) RT-PCR shows
that the RPN10 transcripts were not detected in rpn10-2. (C) The expression of RPN10 was knocked-out and ubiquitylated proteins accumulated in rpn10-2. The expression of RPN10 and the accumulation of ubiquitylated proteins and free di-ubiquitin (diUB) were examined by
immunoblotting against Arabdopsis RPN10 (aRPN10) or human ubiquitin antibodies (aUB) in crude protein extracts that were prepared from
Col-0 (Col), rpn10-2 and two complementation lines. The expression of CSN5 was examined using the Arabdopsis CSN5 antibody (aCSN5)
to confirm equal loading. (D) The growth of Col-0, rpn10-2 and two complementation lines was followed at different stages (21, 50 and

80 days after germination).

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

807


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

direct and indirect recognition of ubiquitylated substrates of UPP. In agreement with this idea, rpn10-1, a
reported T-DNA insertion mutant, has been shown to
have pleiotropic phenotypes including a reduction in
germination, growth rate, stamen number, genetic
transmission through the male gametes, hormoneinduced cell division and seed set, as well as increased
sensitivity to abscisic acid [32]. A slight accumulation
of ubiquitylated substrates and a specific and drastic
stabilization of ABI5 were observed with rpn10-1,
indicating a defect in substrate targeting [32]. The
RPN10 protein in rpn10-1 was expressed as a NPT-II
fusion, in which a C-terminal fragment containing
UIMs was truncated. This fusion protein was
expressed at a very low level compared with that of
RPN10 in wild-type. However, the chimeric RPN10
was assembled into the 26S proteasome in rpn10-1 at
near wild-type levels [32].
We predicted that more severe phenotypes would
be associated with a complete loss of RPN10 function. A new T-DNA insertion mutant line of RPN10
in a Col-0 background was obtained, and is designated here as rpn10-2. In this line, the T-DNA insertion was located in the fourth intron (Fig. 7A). A

homozygous T-DNA insertion line was obtained by
segregating T2 plants (Fig. 7B, left); neither the wildtype RPN10 transcript (Fig. 7B, right) nor its protein
(Fig. 7C, upper) was detected, indicating that rpn10-2
is a null mutant. As expected, rpn10-2 showed more
severe pleiotropic phenotypes than rpn10-1. Phenotypes included: reduced growth rate; larger, thicker,
lanceolar, serrated rosette and cauline leaves; delayed
flowering time; reduced axillary inflorescences; longer
internodes; increased length of pedicels; increased
accumulation of anthocyanin; abnormal flower organ
number; larger flower organs; larger petal cells; prolonged life cycle; delayed leaf senescence; increased
plant height; defective male and female gametophytes;
and infertility (Fig. 7D and data not shown). We
also detected the accumulation of ubiquitylated substrates and free di-ubiquitin (Fig. 7C, middle). Except
for the gametophyte phenotypes, all the phenotypes
(including conjugate accumulation) can be complemented when a wild-type RPN10 coding region that
is driven by the CaMV 35S promoter was reintroduced into rpn10-2 (Fig. 7C,D and data not shown).
Part of the reason for the lack of complementation
of the gametophyte phenotypes is probably because
of an absence of 35S promoter expression in the
anthers [33]. The detailed phenotypes of the rpn10-2
plants and the complementation analyses are
described in a separate study (Y.L. Lin and H. Fu,
unpublished results).
808

Discussion
Using a cross-species comparison approach, we
observed distinct ubiquitin chain binding properties
and associated structural requirements among the
major Arabdopsis, human and yeast ubiquitin receptors (Table 1 and Fig. 8). Moreover, we also observed

distinct proteasomal docking sites and interfaces for
homologs of the major UBL–UBA factors (Table 2
and Fig. 8) in different species. Our results support
the mechanistic divergence across species of the major
recognition pathways for ubiquitylated substrates of
UPP. Interestingly, Arabdopsis RPN10 plays a major
role in both the direct and indirect recognition of
ubiquitylated substrates, and this is in agreement with
the accumulation of ubiquitylated conjugates in
T-DNA-inserted Arabdopsis RPN10 mutant lines and
the associated pleiotropic phenotypes for both vegetative and reproductive growth reported here and previously [32].
Arabdopsis RPN10 plays a major role in both the
direct and indirect recognition of ubiquitylated
substrates of UPP
As determined by the strong affinity for long K48linked ubiquitin chains, which is the primary signal for
targeting to the 26S proteasome [6], humans use
RPN10 (S5a) and RPN13 as major receptors for the
direct recognition of ubiquitylated substrates, whereas
both yeast and Arabdopsis use RPN10 as the major
receptor (Fig. 8). Weak or absent binding affinity for
either K48- or K63-linked ubiquitin chains suggests
that RPN13 in Arabdopsis and yeast is likely to play a
minor role in direct substrate recognition. Although it
is possible that the recombinant Arabdopsis or yeast
RPN13 was not folded properly, their interaction with
the DSK2 homologs through PRU makes this less
likely (Fig. 5A,B). Alternatively, the conformation and
chain-binding properties of RPN13 in Arabdopsis and
yeast may be altered when they are assembled into the
26S proteasome, or the RPN13 homologs may be regulated by association with additional regulatory factor(s). Other subunits of the 26S proteasome RP are

not likely to participate as major receptors in direct
substrate recognition, because an extensive yeast twohybrid analysis (Y2H) between yeast ubiquitin and RP
subunits did not detect any novel interaction. Furthermore, Arabdopsis RPT5 and RPN1 did not bind to
ubiquitin chains (data not shown) although these subunits have been suggested as candidates for substrate
recognition because ubiquitin- or UBL-binding activity
was observed in other species [14,18].

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

Cross-species divergence of ubiquitin receptors

A

B

C

Fig. 8. The major recognition pathways for the ubiquitylated substrates of UPP are divergent across species. Schematic diagrams show the
direct and indirect recognition pathways of ubiquitylated substrates in humans (A), yeast (B) and Arabdopsis (C). For the direct recognition of
ubiquitylated substrates (CONJUGATES), humans use RPN10 (N10 ⁄ S5a) and RPN13 (N13) as the major receptors, whereas yeast and
Arabdopsis use RPN10 (N10) as the major receptor (indicated by the wide, red double-arrowhead lines). Arabdopsis RPN13 (N13) plays a
minor role (the thin, red double-arrowhead line). Whereas a single UIM motif of Arabdopsis (UIM1 ⁄ U1) or yeast RPN10 (UIM ⁄ U) is required
for substrate recognition, UIM1 (U1) and UIM2 (U2) of human S5a act cooperatively (bracketed). Of the two, UIM2 is more critical for substrate binding (colored in red and yellow for UIM2 and UIM1, respectively). For the human and Arabdopsis RPN13 homologs, the PRU
domains are required. Except for the human DSK2 homolog (DSK) (indicated by the thin, black double-arrowhead lines), both the RAD23
(RAD) and DSK2 homologs could serve as major receptors for indirect recognition (as indicated by the wide, black double-arrowhead lines).
(A) The docking of the human RAD23 and DSK2 homologs is mediated by both RPN10 (S5a) and RPN13. Docking by RPN10 (S5a) is mediated by UIM1 (U1) and UIM2 (U2) in a mode that is similar to substrate binding. By contrast, the docking of the human RAD23 and DSK2
homologs by RPN13 is mediated by a novel domain that has not yet been defined (DN) and by PRU, respectively. Although both UBLs (the

red subregions) of the RAD23 and DSK2 homologs are involved in binding RPN10 (S5a), the UBL of the DSK2 homolog and a novel unidentified domain (the green-colored subregion, DN) of the RAD23 homolog are involved in RPN13 binding. The role of human RPN1 (N1) in the
recognition of UBL–UBA factors has not been determined (marked ? in the figure). (B) Docking of the yeast RAD23 and DSK2 homologs is
mediated primarily by RPN1 and RPN10, respectively. RPN1 and RPN13 also play a minor role in DSK2 docking (the thin, black double-arrowhead lines). The interaction of RPN1 and RAD23 or DSK2 is mediated by LRR in RPN1 and by the UBLs in RAD23 ⁄ DSK2; residues that
are critically involved in the UBLs of RAD23 ⁄ DSK2 have not been determined (marked by asterisks in the figure). The interaction between
DSK2 and RPN10 ⁄ RPN13 is mediated by the UBL in DSK2, and by UIM and PRU, respectively, in RPN10 and RPN13. (C) Docking of the
Arabdopsis RAD23 and DSK2 homologs is mediated primarily by UIM3 and UIM1, respectively, in the same base subunit, RPN10. UIM2
(shown in yellow) also plays a minor role in binding submembers of the RAD23 family (data not shown; the thin, black double-arrowhead
lines). Via PRU, Arabdopsis RPN13 also plays a minor role in docking DSK2 (the thin, black double-arrowhead lines). Arabdopsis RPN1
(depicted in gray) is not involved in the recognition and is marked with an X. For the involvement of the UBLs in proteasomal docking,
the conserved residues (corresponding to those located in the hydrophobic patch of ubiquitin) are generally critical. However, divergent
interfaces have been detected. The residues with altered importance are designated with the corresponding binding proteasome subunit
indicated in parentheses.

Based on the strong affinity for long K48-linked
ubiquitin chains, the RAD23 and DSK2 homologs
may be used as major receptors for indirect recognition in the species examined (Fig. 8). The exception is

the human DSK2 homolog, which probably plays a
minor role because of its weak affinity for K48-linked
ubiquitin chains. Other UBL–UBA factors such as
DDI1 and NUB1 also probably play a minor role, or

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

809


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

they act beyond UPP because they have weak or
absent affinity for K48-linked ubiquitin chains (Fig. S3
and data not shown).
Based on the strength of the interaction, multiple RP
base subunits play a major role in proteasomal docking
of the RAD23 and DSK2 homologs in yeast (RPN1 and
RPN10) and humans (RPN10 and RPN13), whereas a
single base subunit RPN10 plays a major role in Arabdopsis (Fig. 8). In yeast, RPN1 plays a major role in the
recognition of RAD23 and probably also plays a minor
role in the recognition of DSK2, as described previously
[18] and confirmed using Y2H (Fig. S8). Based on the
observation that the Y2H reporter activity derived from
the RPN10–DSK2 interaction is stronger than that from
the RPN1–RAD23 interaction, and also on observation
of the strong interaction detected by the pull-down
assay, RPN10 probably plays a major role in DSK2 recognition (Figs 1B and S8). With its relatively weak binding compared with RPN10, yeast RPN13 probably
plays a minor role in DSK2 recognition (Fig. 4D). In
humans, both RPN10 and RPN13 play a major role in
the recognition of RAD23 and DSK2 homologs
(Figs 1A and 4C). The role of human RPN1 in the recognition of UBL–UBA factors has not been examined.
Uniquely for Arabdopsis, the proteasomal docking of
the RAD23 and DSK2 homologs is mediated primarily
by RPN10 through separate sites (Fig. 3). However, a
minor role in DSK2 recognition is mediated by RPN13
(Fig. 4B).
Except during docking by the human RPN10
homolog (S5a), the proteasomal recognition sites of
the RAD23 and DSK2 homologs are separated structurally. Here, recognition of the DSK2 homolog overlaps structurally with the recognition of ubiquitylated
substrates (Fig. 8). For example, all the PRU domains

of the RPN13 homologs are involved in the recognition of the ubiquitin chains and DSK2, except for
yeast RPN13. UIM1 of Arabdopsis RPN10 and the
UIM of yeast RPN10 are also involved. By contrast,
RAD23 recognition is mediated by a separate
motif(s) ⁄ domain(s) that includes UIM3 and, to a lesser extent, UIM2 of Arabdopsis RPN10 (Fig. 3 and
data not shown), LRR of yeast RPN1 [18] and a
novel domain in human RPN13 (Figs 5D and 6B).
However, recognition of the RAD23 and DSK2
homologs by human S5a is mediated by the two
UIMs using a very similar mode to the recognition of
ubiquitin chains (Fig. 1A). The structural separation
or overlap between the ubiquitin-binding and proteasomal recognition sites of different UBL–UBA factors is probably a critical element in the mechanistic
relay or for regulation during proteasomal recognition
of ubiquitylated substrates.
810

Pleiotropic phenotypes of loss of function
support a major role for Arabdopsis RPN10 in the
direct and indirect recognition of ubiquitylated
substrates
The multiplicity of major recognition pathways of
ubiquitylated substrates was mediated in yeast and
humans through separate proteasomal subunits. A nonessential role was observed for the major yeast ubiquitin receptors RPN10, RAD23 and DSK2 [11,16],
suggesting their functional redundancy. However, it
can be predicted that simultaneous loss of the ubiquitin chain-binding activity of RPN10 and the proteasomal docking activity of RPN1 (Fig. 8) would have
severe consequences in yeast. By contrast, the major
recognition pathways (both direct and indirect) in
Arabdopsis are all mediated by RPN10, suggesting an
essential role in growth and development. In agreement with this idea, Arabdopsis RPN10 was shown to
be essential for both vegetative and reproductive

growth, as reported previously [32] and here through
the examination of a new T-DNA inserted null
mutant. Interestingly, critical roles of the RPN10
homolog in vivo were also observed in several other
species, including Drosophila [34], mouse [35], Physcomitrella patens [36] and Caenorhabditis elegans [37].
The observed pleiotropic phenotypes associated with
rpn10-1 [32] and rpn10-2 (Fig. 7D and data not shown)
support defective proteolysis of the critical regulatory
factors involved. Accordingly, accumulation of ubiquitylated substrates and free di-ubiquitin was clearly
observed; the latter is probably derived from active
deubiquitylation activities that exist in vivo. However,
RPN10 is a protein that has multiple activities. The
N-terminal vWA domain is critical for the stable association between the lid and base subcomplexes of RP
[38], UIM1 is critical for both the direct and indirect
(through DSK2) recognition of ubiquitylated substrates, and UIM3 is important for indirect (through
RAD23) recognition of ubiquitylated substrates. The
null-mutation of rpn10-2 will allow analyses to correlate the observed phenotypes with separate RPN10
activities by complementation with site-mutagenized
RPN10 mutants. It can also be tested whether the
direct and indirect recognition that are mediated by
UIM1 and the indirect recognition that is mediated by
UIM3 are redundant.
Functional roles of major ubiquitin receptors
beyond UPP
Human S5a ⁄ RPN10, RPN13 and yeast DSK2 have
strong affinities, not only for K48-, but also for

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

A. S. Fatimababy et al.

K63-linked ubiquitin chains. This suggests that additional ubiquitin recognition functions beyond UPP
may be associated with these ubiquitin receptors. However, ubiquitin chains of other linkage types, such as
K11, K29 and K63, may still serve as competent signals for proteasomal degradation [8,9]. The affinity of
the major ubiquitin receptors for in vivo physiological
substrates, which probably have highly extended
ubiquitin chains at multiple sites, could be modulated
through the interaction with associated factors or after
assembly into the 26S proteasome. Further differentiation of the biochemical properties of the major ubiquitin receptors may yet be discovered when more
extended ubiquitin chains or physiological substrates
are analyzed.
DDI1 homologs from various species have weak
affinities for either K48- or K63-linked ubiquitin
chains. Weak ubiquitin chain binding is reflected by
the low affinity for endogenous ubiquitylated substrates observed with Arabdopsis DDI1 (data not
shown). In addition, the potential proteasomal docking
site for DDI1 has not been detected in Arabdopsis,
humans or yeast (Figs 1, 4 and S8, and data not
shown). These results do not favor a role for DDI1
homologs as major receptors for ubiquitylated substrates during UPP. However, the involvement of yeast
DDI1 in the recognition of specific substrates, such as
Ho endonuclease and the F-box protein of the E3
complex SCFUfo1, has been described [5,17]. The
human DSK2 homolog (PLIC1) has a clear preference
and moderate affinity for K63-linked ubiquitin chains
(Fig. S3), indicating that PLIC1 plays a minor, if any,
role in the recognition of ubiquitylated substrates during UPP. The possible involvement of PLIC1 in the
sequestration of UIM-containing endocytic components has been described previously [39].
Structural divergence supports mechanistic

differentiation of the major recognition pathways
across species
Although conserved domains ⁄ motifs are used by various ubiquitin receptors for substrate binding and proteasomal docking, a clear structural divergence of the
major recognition pathways across species exists
(Tables 1 and 2 and Fig. 8). First, distinct substratebinding properties are associated with major ubiquitin
receptors from different species, indicating structural
differentiation. For example, whereas the human
RPN10 homolog binds to both the K48- and K63linked ubiquitin chains with high affinities using the
two UIM sites in a cooperative manner, Arabdopsis
and yeast homologs preferentially bind to K48-linked

Cross-species divergence of ubiquitin receptors

ubiquitin chains using a single UIM site (Fig. S1). Distinct substrate-binding properties are also associated
with the RPN13 and DSK2 homologs from different
species (Figs S2A and S3).
Second, structural divergence for ubiquitin chain
binding was detected with major ubiquitin receptors.
For example, the human and Arabdopsis RAD23
homologs bind ubiquitin chains using both UBAs
additively, whereas yeast RAD23 binds chains using a
single UBA1 (Table 1 and Fig. S6A,B, and data not
shown). Because the UBA was not detected in human
DDI1, it is likely that a novel ubiquitin-binding
domain is involved. Also, divergence of the interface
of the UBA in yeast DDI1 was detected by mutagenesis (Fig. S6C, left). Moreover, divergence of the PRU
interface was detected in yeast RPN13, and this observation agrees with the lack of affinity for ubiquitin
chains and conjugates (Fig. S4).
Third, structural divergence was detected in the
interaction interfaces between the proteasomal docking

subunits and the UBL–UBA factors in different species. Although overall structural conservation was
detected for the interfaces of RPN10–RAD23,
RPN10–DSK2 and RPN13–DSK2 (when examined
using cross-species interaction analyses; Figs 3 and 5),
nevertheless, divergent interfaces were detected
(Fig. 8). The most obvious example of a divergent
interface is the UBL of yeast RAD23 (Fig. S7). This
divergence leads to a loss of binding to RPN10
(Fig. 3A–C, upper). However, yeast RPN10 retains the
ability to bind the UBLs of the RAD23 homologs
from Arabdopsis and humans (Fig. 3C). Uniquely,
yeast RPN1 acquired the LRR for binding with the
UBL of RAD23, which appears to be divergent in
Arabdopsis. Functional divergence of the conserved
residues in the UBL interfaces of human RAD23 (I47;
Fig. 2A) and yeast DSK2 (L44, I45, L70 and V70;
Fig. 2B) for association with the RPN10 homolog were
detected. Cross-species interaction analysis between
human S5a and the yeast DSK2 homolog also supports a divergent UBL in yeast DSK2. Although both
UIM1 and UIM2 of human RPN10 ⁄ S5a are important
for the interaction with yeast DSK2, UIM1 is more
critical. This is different from the interaction of S5a
with the human or Arabdopsis DSK2 homolog, in
which UIM2 is more critical (Fig. 3E). We also
detected divergence in the UBL interfaces of Arabdopsis DSK2 (V87, Fig. 6A) and yeast DSK2 (L44, L70
and V71; Fig. 6C) in their association with RPN13.
The novel interfaces between the human RPN13 and
RAD23 homologs appear to be partly divergent in
other species. RAD23 homologs from Arabdopsis and
yeast are still capable of interacting with human

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

811


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

RPN13 (Fig. 5D), indicating that their interaction
interfaces (which do not involve UBLs, Figs 5D and
6B) are still conserved when compared with the human
RAD23 homolog. By contrast, RPN13 homologs from
Arabdopsis and yeast did not interact with the human
RAD23 homolog, indicating that their binding interfaces had diverged (data not shown).
Mechanistic differentiation across species, supported
by divergent structural requirements, may potentially
lead to distinct functions for the different recognition
pathways, as exemplified here by Arabdopsis RPN10,
and different in vivo regulation (such as the association
with distinct regulators). Because the specificity of
UPP can be modulated at the ubiquitylated substrate
recognition step [4,5,17], additional structural elements
or associated factors probably play roles in determining substrate specificity. Taking these suggestions
together, it is likely that more subtle mechanistic components are involved in the proteasomal recognition of
ubiquitylated substrates, and these may have diverged
in the major recognition pathways across species. Further structural analyses and comparisons are required
to resolve the divergence detected in this study to provide a solid basis for mechanistic insight. In vivo studies, including loss- and gain-of-function analyses and
structure ⁄ function correlations, are required to determine the functional roles associated with the various

recognition pathways. Alternatively, identification of
specific substrates using proteomic approaches may
also contribute functional insights into the various
recognition pathways.

Experimental procedures
Characterization of the Arabdopsis T-DNA
insertion line rpn10-2
The GABI-Kat T-DNA insertion line GK-734B02 (in the
Col-0 background) designated here as rpn10-2 was ordered
from the European Arabdopsis Stock Center (University of
Nottingham, Loughborough, UK). The T-DNA insertion
site was determined by sequencing a PCR fragment amplified from the junction using the primer pair GABI-LB2 and
RPN10-3¢a. To complement the rpn10-2 phenotypes, the
Arabdopsis RPN10 coding region was amplified from firststrand cDNAs using the primer pair cRPN10–Sma and
cRPN10–Sst (these added SmaI and SstI restriction sites,
respectively) and cloned into pBI121, downstream of the
CaMV 35S promoter [40]. This construct was mobilized
into Agrobacterium GV3101 using a freeze–thaw method.
Arabdopsis was transformed as described previously [41].
To grow Col-0, rpn10-2 or complemented rpn10-2 Arabdopsis, we surface sterilized the seeds using 20% bleach and

812

0.05% Tween 20 and stratified them for 3 days on plates at
4 °C in the dark. The seeds were germinated on halfstrength MS solid medium (0.8% agar, pH 5.8) supplemented with 1% sucrose. Two-week-old seedlings were
transferred to soil (equal parts of humus, vermiculite and perlite) and grown using a 16 h light ⁄ 8 h dark photoperiod with
a light intensity of  120 lmolỈm)2Ỉs)1 at 22 °C.
For genotyping, a single rosette leaf was mashed in
600 lL of extraction buffer using a SH-48 homogenizer

(J&H Technology, Taipei, Taiwan) and the genomic DNA
was extracted as described [42]. For RT-PCR, total RNA
was isolated from 30-day-old rosette leaves using TRIzol
according to manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). RNA was quantified using a NanoDrop
ND-1000 (NanoDrop Technologies, Wilmington, DE,
USA). Three micrograms of total RNA were used for firststrand cDNA synthesis in a 20 lL reaction using poly(T),
random primers and SuperScript III reverse transcriptase
(Invitrogen). Sterile water was added to achieve a final volume of 150 lL, and 2.5 lL was used as the template for
each PCR. The PCR primer pairs used to detect the endogenous RPN10, T-DNA insertion, RPN10 complementation
construct, RPN10 coding region and a UBQ10 cDNA fragment were RPN10-5¢b ⁄ RPN10-3¢B, RPN10-3¢B ⁄ GABILB4, 35S-Fw-T ⁄ RPN10-3¢B, cRPN10-Sma ⁄ cRPN10-Sst
and UBQ10-5¢ ⁄ UBQ10-3¢, respectively. The sequences of
the primers used are listed in 5¢ to 3¢ direction as follows:
RPN10-3¢a, CACCCGTGAATCACGGTGTGCTGGA
AG; RPN10-5¢b, GAGTTTGACATCAATTTGCTACTTG
CGTC; RPN10-3¢B, CTGCGGCCGCTGCAGCAGCTG
CCGCAG; GABI-LB2, GCTGATCCATGTAGATTTCCC
CGGACATG; GABI-LB4, CACGGATGATCTCGCGGA
GGGTAG; 35S-Fw-T, CTCGGATTCCATTGCCCAGCT
ATCTG; cRPN10–Sma, TCCCCGGGATGGTTCTCGAG
GCGACTATG; cRPN10–Sst, ATGAGCTCTCACTTCT
TCTCATCCTCGCC; UBQ10-5¢, GTGGTGGTTTCTAAA
TCTCGTCTCTG; UBQ10-3¢, GAAGAAGTTCGACTTG
TCATTAGAAAG.

Preparation of crude protein extracts from
Arabdopsis
To prepare crude protein extracts for the detection of
RPN10, CSN5 and the ubiquitylated conjugates by immunoblotting, we ground rosette leaves in liquid nitrogen
using an equal volume of pull-down binding buffer (see
below) supplemented with 1· protease inhibitor cocktail

(Roche Diagnostics, Indianapolis, IN, USA) or 2 vol of
sample buffer (to detect the ubiquitylated conjugates).
Samples were dissolved by vortexing, incubated on ice for
5 min, centrifuged at 16 000 g and 4 °C, and filtered using
0.45 lm filters (Millipore Corp., Bedford, MA, USA). For
pulling-down endogenous Arabdopsis ubiquitin conjugates,
we prepared the crude Arabdopsis extract from the upper

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

parts of 1-month-old plants using pull-down binding buffer
supplemented with 1· protease inhibitor cocktail (Roche
Diagnostics), 50 lm proteasome inhibitor MG132 (Biomol
International, Plymouth Meeting, PA, USA) and 50 lm Nethylmaleimide (Sigma-Aldrich, St. Louis, MO, USA). The
protein concentration was determined using Protein Assay
reagent (Bio-Rad Laboratories, Hercules, CA, USA).

Protein expression constructs
The coding sequences for wild-type, site-mutagenized and
deletion variants of Arabdopsis, yeast and human ubiquitin
receptors were generated by PCR and inserted into either
pET42a or pET28a (Novagen, Madison, WI, USA) to yield
constructs that encoded for GST ⁄ HIS- or T7 ⁄ HIS-tagged
proteins, respectively (Table S1). Site-directed mutagenesis
was performed using a QuickChange Kit with PfuTurbo and
paired primers that were centered at the mutation sites
according to the manufacturer’s protocols (Stratagene, La

Jolla, CA, USA). Double-site mutants were generated by
sequential mutagenesis. The coding sequences for human
S5a (U51007), hHR23b (D21090), PLIC1 (BC010066),
DDI1 (NM032341) and RPN13 (NM175573) were amplified using PCR from first-strand cDNAs prepared from
human HeLa S3 cells (Stratagene). The coding sequences
for yeast RAD23, DSK2 and DDI1 were PCR-amplified or
subcloned (DSK2) from Y2H constructs (see the Doc. S1
and Table S1). The coding sequence for yeast RPN13
(U20939) was isolated from genomic DNA prepared from
the DF5 strain [11]. All expression constructs were confirmed by DNA sequencing using an ABI Prism 3700 DNA
Analyzer (Applied Biosystems, Foster City, CA, USA).

Recombinant protein purification from
Escherichia coli
The various recombinant proteins were expressed in BL21
(DE3) cells using the pET28a or pET42a expression plasmids (Novagen). Bacterial cultures were induced at
D600 = 0.6 for protein expression with 1 mm isopropyl thiob-d-galactoside and incubated at 16, 30 or 37 °C depending
on the construct. Escherichia coli cells were resuspended in
1· GST- or HIS-binding buffer (Novagen), supplemented
with 200 lgỈmL)1 lysozyme, 0.1% NP-40, 10% glycerol and
1· protease inhibitor cocktail (Roche Diagnostics). Resuspended cells were incubated for 15 min at room temperature
and sonicated on ice for 5–10 min (15% power, 30-s pulses
with 30-s intermittent pauses; Misonix XL2020, Farmingdale, NY, USA). His- and GST-tagged recombinant proteins were purified by immobilized metal- or glutathioneaffinity chromatography, respectively (Novagen) using buffers and procedures recommended by the manufacturer.
Purified proteins were dialyzed and concentrated in GST
pull-down binding buffer (see below) using Microcon Ultracel YM-30 filter units (Millipore Corp.).

Cross-species divergence of ubiquitin receptors

GST pull-down analyses and immunoblotting
GST pull-down experiments were performed using immobilized glutathione according to the manufacturer’s instructions (Pierce, Rockford, IL, USA). Briefly, the glutathione

resin (25 lL final bed volume for each reaction) was
washed five times with 400 lL of binding buffer (50 mm
Tris ⁄ HCl, pH 7.5, 25 °C, 100 mm NaCl, 1 mm EDTA and
0.1% NP-40). GST-fused baits were then individually
immobilized on the resin in 400 lL of binding buffer for
2 h on ice (gently mixed by inverting). The immobilized
baits were washed five times with 400 lL of binding buffer.
A specific prey was then added, and the resin complexes
were incubated for 2 h on ice, with gentle mixing by inverting. After five washes with 400 lL of binding buffer, the
pulled-down products were boiled for 5 min in sample buffer, analyzed by SDS ⁄ PAGE and detected by immunoblotting using chemiluminescence (Perkin–Elmer, Shelton, CT,
USA) or color development. The NaCl concentration in the
binding buffer was increased to 150 mm when analyzing the
interactions between the UBL–UBA factors and the
RPN10 or RPN13 variants. To detect the ubiquitin chains
or conjugates, the proteins were transferred onto Hybond
ECL nitrocellulose membranes (0.45 lm; Amersham
Biosciences, Freiburg, Germany) following separation by
SDS ⁄ PAGE. The membrane was then sandwiched between
two glass plates and autoclaved for 20 min in transfer buffer to assist epitope exposure. For other immunoblotting
assays, poly(vinylidene difluoride) membranes were used
(Perkin–Elmer, Boston, MA, USA). To visualize the pulleddown ubiquitin chains, conjugates and T7-tagged recombinant proteins, we used either rabbit anti-human ubiquitin
(Santa Cruz Biotechnology, Santa Cruz, CA, USA) or
mouse anti-T7 primary serum (Novagen). Horseradish peroxidase-conjugated goat anti-(rabbit IgG) serum or anti(mouse IgG) serum (Santa Cruz Biotechnology) were used
as secondary antibodies. To detect RPN10, CSN5 and the
conjugates from the Arabdopsis crude extracts, we used primary rabbit polyclonal antibodies raised against Arabdopsis
RPN10, CSN5 (custom-made by Genesis Biotech, Taipei,
Taiwan or purchased from Biomol, respectively), or human
ubiquitin (Santa Cruz Biotechnology). These were used in
conjunction with an alkaline phosphatase-labeled goat
anti-(rabbit IgG) serum (Santa Cruz Biotechnology) and

the substrates Nitro blue tetrazolium and 5-bromo-4chloro-3-indolyl phosphate (Sigma-Aldrich). The K48- and
K63-linked ubiquitin chains (Ub2–7) and tetra-ubiquitin
were purchased from BostonBiochem (Cambridge, MA,
USA).

Sequence analyses
The presence of UIM, UBA and other protein domains
was detected using available web programs from the
ExPASy proteomics server (Swiss Institute of Bioinformatics,

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

813


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

Routine sequence analyses were performed using version 10.3 of the wisconsin gcg package
(Accelrys, San Diego, CA, USA).

Acknowledgements
We thank Drs Michael H. Glickman, Richard D. Vierstra and Shu-Hsing Wu for critical reading of the
manuscript, Dr Michael H. Glickman for the Y2H bait
constructs BD-UB and BD-UB5, and for the Y2H
constructs of yeast RAD23, DSK2 and DDI1. We also
thank Tzuning Ho and Ting-Ting Yu for technical
assistance. R. Radjacommare is the recipient of a postdoctoral fellowship from Academia Sinica (2005–
2006). Y.L. Lin is supported by a graduate fellowship

from the Taiwan International Graduate Program
(2003-2006; National Chung-Hsing University and
Academia Sinica). This work was supported by grants
from the National Science Council (NSC 88-2311B001-127, NSC 89-2311-B001-125, and NSC 89-2311B001-044, NSC 95-2311-B-001-045-MY3) and from
Academia Sinica (AS-94-TP-B08 and AS-97-TP-B03),
Taipei, Taiwan.

References
1 Hershko A & Ciechanover A (1998) The ubiquitin
system. Annu Rev Biochem 67, 425–479.
2 Petroski MD & Deshaies RJ (2005) Mechanism of
lysine 48-linked ubiquitin-chain synthesis by the
Cullin–RING ubiquitin–ligase complex SCF–Cdc34.
Cell 123, 1107–1120.
3 Ravid T & Hochstrasser M (2008) Diversity of
degradation signals in the ubiquitin–proteasome system.
Nat Rev Mol Cell Biol 9, 679–690.
4 Verma R, Oania R, Graumann J & Deshaies RJ (2004)
Multiubiquitin chain receptors define a layer of
substrate selectivity in the ubiquitin–proteasome system.
Cell 118, 99–110.
5 Ivantsiv Y, Kaplun L, Tzirkin-Goldin R, Shabek N &
Raveh D (2006) Unique role for the UbL–UbA protein
Ddi1 in turnover of SCFUfo1 complexes. Mol Cell Biol
26, 1579–1588.
6 Thrower J, Hoffman L, Rechsteiner M & Pickart C
(2000) Recognition of the polyubiquitin proteolytic
signal. EMBO J 19, 94–102.
7 Beal R, Deveraux Q, Xia G, Rechsteiner M & Pickart
C (1996) Surface hydrophobic residues of multiubiquitin

chains essential for proteolytic targeting. Proc Natl
Acad Sci USA 93, 861–866.
8 Jin L, Williamson A, Banerjee S, Philipp I & Rape M
(2008) Mechanism of ubiquitin-chain formation by the
human anaphase-promoting complex. Cell 133,
653–665.

814

9 Johnson ES, Ma PCM, Ota IM & Varshavsky A (1995)
A proteolytic pathway that recognizes ubiquitin as a
degradation signal. J Biol Chem 270, 17442–17456.
10 Hofmann RM & Pickart CM (2001) In vitro assembly
and recognition of Lys-63 polyubiquitin chains. J Biol
Chem 276, 27936–27943.
11 van Nocker S, Sadis S, Rubin D, Glickman M, Fu H,
Coux O, Wefes I, Finley D & Vierstra R (1996) The
multiubiquitin-chain-binding protein Mcb1 is a component of the 26S proteasome in Saccharomyces cerevisiae
and plays a nonessential, substrate-specific role in
protein turnover. Mol Cell Biol 16, 6020–6028.
12 Husnjak K, Elsasser S, Zhang N, Chen X, Randles L,
Shi Y, Hofmann K, Walters KJ, Finley D & Dikic I
(2008) Proteasome subunit Rpn13 is a novel ubiquitin
receptor. Nature 453, 481–488.
13 Schreiner P, Chen X, Husnjak K, Randles L, Zhang N,
Elsasser S, Finley D, Dikic I, Walters KJ & Groll M
(2008) Ubiquitin docking at the proteasome through a
novel pleckstrin–homology domain interaction. Nature
453, 548–552.
14 Lam YA, Lawson TG, Velayutham M, Zweier JL &

Pickart CM (2002) A proteasomal ATPase subunit
recognizes the polyubiquitin degradation signal. Nature
416, 763–767.
15 Saeki Y, Sone T, Toh-e A & Yokosawa H (2002)
Identification of ubiquitin-like protein-binding subunits
of the 26S proteasome. Biochem Biophys Res Commun
296, 813–819.
16 Funakoshi M, Sasaki T, Nishimoto T & Kobayashi H
(2002) Budding yeast Dsk2p is a polyubiquitin-binding
protein that can interact with the proteasome. Proc Natl
Acad Sci USA 99, 745–750.
17 Kaplun L, Tzirkin R, Bakhrat A, Shabek N, Ivantsiv Y
& Raveh D (2005) The DNA damage-inducible
UbL–UbA protein Ddi1 participates in Mec1-mediated
degradation of Ho endonuclease. Mol Cell Biol 25,
5355–5362.
18 Elsasser S, Gali RR, Schwickart M, Larsen CN,
Leggett DS, Muller B, Feng MT, Tubing F, Dittmar
GAG & Finley D (2002) Proteasome subunit Rpn1
binds ubiquitin-like protein domains. Nat Cell Biol 4,
725–730.
19 Elsasser S & Finley D (2005) Delivery of ubiquitinated
substrates to protein-unfolding machines. Nat Cell Biol
7, 742–749.
20 Raasi S & Wolf DH (2007) Ubiquitin receptors and
ERAD: a network of pathways to the proteasome.
Semin Cell Dev Biol 18, 780–791.
21 Hicke L, Schubert HL & Hill CP (2005) Ubiquitinbinding domains. Nat Rev Mol Cell Biol 6, 610–621.
22 Hurley J, Lee S & Prag G (2006) Ubiquitin-binding
domains. Biochem J 399, 361–372.

23 Wang B, Alam SL, Meyer HH, Payne M, Stemmler
TL, Davis DR & Sundquist WI (2003) Structure and

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS


A. S. Fatimababy et al.

24

25

26

27

28

29

30

31

32

33

34

35

ubiquitin interactions of the conserved zinc finger
domain of Npl4. J Biol Chem 278, 20225–20234.
Yuan X, Simpson P, McKeown C, Kondo H, Uchiyama K, Wallis R, Dreveny I, Keetch C, Zhang X, Robinson C et al. (2004) Structure, dynamics and
interactions of p47, a major adaptor of the AAA
ATPase, p97. EMBO J 23, 1463–1473.
Park S, Isaacson R, Kim HT, Silver PA & Wagner G
(2005) Ufd1 exhibits the AAA–ATPase fold with two
distinct ubiquitin interaction sites. Structure 13, 995–
1005.
Raasi S, Varadan R, Fushman D & Pickart CM (2005)
Diverse polyubiquitin interaction properties of ubiquitin-associated domains. Nat Struct Mol Biol 12,
708–714.
Hicke L & Dunn R (2003) Regulation of membrane
protein transport by ubiquitin and ubiquitin-binding
proteins. Annu Rev Cell Dev Biol 19, 141–172.
Kanayama A, Seth RB, Sun L, Ea C-K, Hong M, Shaito A, Chiu Y-H, Deng L & Chen ZJ (2004) TAB2 and
TAB3 activate the NFjB pathway through binding to
polyubiquitin chains. Mol Cell 15, 535–548.
Tsui C, Raguraj A & Pickart CM (2005) Ubiquitin
binding site of the ubiquitin E2 variant (UEV) protein
Mms2 is required for DNA damage tolerance in the
yeast RAD6 pathway. J Biol Chem 280, 19829–19835.
Fu H, Sadis S, Rubin DM, Glickman M, van Nocker
S, Finley D & Vierstra RD (1998) Multiubiquitin chain
binding and protein degradation are mediated by distinct domains within the 26S proteasome subunit Mcb1.
J Biol Chem 273, 1970–1981.
Young P, Deveraux Q, Beal RE, Pickart CM &
Rechsteiner M (1998) Characterization of two polyubiquitin binding sites in the 26S protease subunit 5a.

J Biol Chem 273, 5461–5467.
Smalle J, Kurepa J, Yang P, Emborg TJ, Babiychuk E,
Kushnir S & Vierstra RD (2003) The pleiotropic role of
the 26S proteasome subunit RPN10 in Arabidopsis
growth and development supports a substrate-specific
function in abscisic acid signaling. Plant Cell 15,
965–980.
Wilkinson JE, Twell D & Lindsey K (1997) Activities
of CaMV 35S and nos promoters in pollen: implications
for field release of transgenic plants. J Exp Bot 48,
265–275.
Szlanka T, Haracska L, Kiss I, Deak P, Kurucz E,
Ando I, Viragh E & Udvardy A (2003) Deletion of proteasomal subunit S5a ⁄ Rpn10 ⁄ p54 causes lethality, multiple mitotic defects and overexpression of proteasomal
genes in Drosophila melanogaster. J Cell Sci 116,
1023–1033.
Hamazaki J, Sasaki K, Kawahara H, Hisanaga S-i,
Tanaka K & Murata S (2007) Rpn10-mediated degradation of ubiquitinated proteins is essential for mouse
development. Mol Cell Biol 27, 6629–6638.

Cross-species divergence of ubiquitin receptors

36 Girod P, Fu H, Zryd J & Vierstra R (1999) Multiubiquitin chain binding subunit MCB1 (RPN10) of the 26S
proteasome is essential for developmental progression in
Physcomitrella patens. Plant Cell 11, 1457–1472.
37 Shimada M, Kanematsu K, Tanaka K, Yokosawa H &
Kawahara H (2006) Proteasomal ubiquitin receptor
RPN-10 controls sex determination in Caenorhabditis elegans. Mol Biol Cell 17, 5356–5371.
38 Fu H, Reis N, Lee Y, Glickman M & Vierstra R (2001)
Subunit interaction maps for the regulatory particle of
the 26S proteasome and the COP9 signalosome. EMBO

J 20, 7096–7107.
39 Regan-Klapisz E, Sorokina I, Voortman J, de Keizer P,
Roovers RC, Verheesen P, Urbe S, Fallon L, Fon EA,
Verkleij A et al. (2005) Ubiquilin recruits Eps15 into
ubiquitin-rich cytoplasmic aggregates via a UIM–UBL
interaction. J Cell Sci 118, 4437–4450.
40 Jefferson R, Kavanagh T & Bevan M (1987) GUS
fusions: beta-glucuronidase as a sensitive and versatile
gene fusion marker in higher plants. EMBO J 6,
3901–3907.
41 Clough SJ & Bent AF (1998) Floral dip: a simplified
method for Agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J 16, 735–743.
42 Weigel D & Glazebrook J (2002) How to isolate a gene
defined by a mutation. In Arabidopsis: A Laboratory
Manual (Weigel D & Glazebrook J eds), pp 168–169.
Cold Spring Harbour Laboratory Press, Cold Spring
Harbour, NY.

Supporting information
This following supplementary material is available:
Fig. S1. Ubiquitin chain binding properties and the relevant domains of the human and yeast RPN10 homologs.
Fig. S2. Ubiquitin chain binding properties of the
RPN13 homologs.
Fig. S3. Ubiquitin chain binding properties of the
human and yeast RAD23, DSK2 and DDI1 homologs.
Fig. S4. Sequence similarity among the RPN13 homologs.
Fig. S5. Involvement of PRU in the Arabdopsis and
human RPN13 homologs in the binding of ubiquitin
chains.

Fig. S6. Involvement of the UBAs of the RAD23,
DSK2 and DDI1 homologs in the interaction with
ubiquitin chains.
Fig. S7. Sequence similarity of ubiquitin and the UBLs
of the UBL–UBA factors.
Fig. S8. The Y2H search for the interacting RP subunit(s) of the UBL–UBA factors.
Doc. S1. Supplementary experimental procedures. The
methods used for the Y2H analyses. Supplementary
references.

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS

815


Cross-species divergence of ubiquitin receptors

A. S. Fatimababy et al.

Table S1. Expression constructs.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied

816

by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising

from supporting information (other than missing files)
should be addressed to the authors.

FEBS Journal 277 (2010) 796–816 ª 2010 The Authors Journal compilation ª 2010 FEBS