Báo cáo khoa học: Factors influencing RNA degradation by Thermus thermophilus polynucleotide phosphorylase ppt

Factors influencing RNA degradation by
Thermus thermophilus polynucleotide phosphorylase
Marina V. Falaleeva, Helena V. Chetverina, Victor I. Ugarov, Elena A. Uzlova and
Alexander B. Chetverin
Institute of Protein Research of the Russian Academy of Sciences, Pushchino, Moscow Region, Russia
Polynucleotide phosphorylase (PNPase, polyribonucleo-
tide:orthophosphate nucleotidyltransferase, EC 2.7.7.8)
is a 3¢fi5¢ exoribonuclease that catalyses the phospho-
rolysis of oligo- and polyribonucleotides producing
ribonucleoside 5¢-diphosphates (ppN), and this can be
reversed by decreasing the inorganic orthophosphate
(P
i
) concentration and increasing the ppN concen-
tration [1]:
ðpNÞ
n
þP
i
$ðpNÞ
nÀ1
þppN
PNPase has been found in all types of bacteria [2]
except mycoplasma [3]. Although PNPase-encoding
sequences are absent from all archaea and yeast
genomes examined to date (which do however contain
homologues of the related RNase PH gene), they are
present in higher eukaryotes [4–6]. Plant and animal
PNPases are encoded by nuclear genes, but are mainly
localized in organelles [7]. In plants, there are two
PNPase species, one of which is targeted to chlorop-

lasts and the other to mitochondria [4,8].
The PNPase gene (pnp) encodes a 80–100 kDa poly-
peptide composed of five evolutionary conserved
domains: two N-terminal core domains homologous
to Escherichia coli RNase PH interspaced with an
a-helical domain, and two C-terminal RNA-binding
domains, KH and S1 [3–6,9,10]. RNase PH is a
3¢fi5¢ phosphorolytic exonuclease that is responsible
for processing of the 3¢ ends of precursor tRNA
molecules [11]: the KH (‘K homology’) domain was
originally identified in the human RNA-binding
K protein [12], and the S1 domain is named after the
RNA-binding protein S1 of the E. coli ribosome [13].
Keywords
3¢fi5¢ exoribonuclease; oligonucleotide
protection; RNA phosphorolysis; 3¢-terminal
modifications; Thermus thermophilus
Correspondence
A. B. Chetverin, Institute of Protein
Research of the Russian Academy of
Sciences, Pushchino, Moscow Region,
142290 Russia
Fax: +7 495 632 7871
Tel: +7 496 773 2524
E-mail:
(Received 30 November 2007, revised 29
February 2008, accepted 4 March 2008)
doi:10.1111/j.1742-4658.2008.06374.x
At the optimal temperature (65 °C), Thermus thermophilus polynucleotide
phosphorylase (Tth PNPase), produced in Escherichia coli cells and isolated

to functional homogeneity, completely destroys RNAs that possess even a
very stable intramolecular secondary structure, but leaves intact RNAs
whose 3¢ end is protected by chemical modification or by hybridization
with a complementary oligonucleotide. This allows individual RNAs to be
isolated from heterogeneous populations by degrading unprotected species.
If oligonucleotide is hybridized to an internal RNA segment, the Tth
PNPase stalls eight nucleotides downstream of that segment. This allows
any arbitrary 5¢-terminal fragment of RNA to be prepared with a precision
similar to that of run-off transcription, but without the need for a res-
triction site. In contrast to the high Mg
2+
requirements of mesophilic
PNPases, Tth PNPase retains significant activity when the free Mg
2+
con-
centration is in the micromolar range. This allows minimization of the
Mg
2+
-catalysed nonenzymatic hydrolysis of RNA when phosphorolysis is
performed at a high temperature. This capability of Tth PNPase for fully
controlled RNA phosphorolysis could be utilized in a variety of research
and practical applications.
Abbreviations
P
i
, inorganic orthophosphate; PNPase, polynucleotide phosphorylase; Tth PNPase, PNPase of Thermus thermophilus.
2214 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS
The PNPase molecules of E. coli and Streptomyces an-
tibioticus are composed of three identical subunits that
form a doughnut-shaped structure with a central hole

capable of accommodating an RNA strand [10,14],
while the spinach chloroplast PNPase seems to be
composed of two such ring [4,15]. Interestingly, the
three-dimensional structures of the bacterial PNPase
[10] and of the archaeal exosome core of RNase PH
[16] are highly homologous, suggesting that the molec-
ular mechanisms of action of PNPase and RNase PH
may be very similar [16,17].
As the intracellular P
i
concentration is usually high,
the primary physiological role of PNPase is thought to
be the phosphorolytic degradation of RNA [2,18].
Important manifestations of this function include the
control of RNA quality by eliminating defective mole-
cules [19–21], regulation of the virulence and persis-
tence of pathogenic bacteria [22], anticancer activity
due to degradation of tumour-associated mRNAs
[23,24], and RNA processing [25]. However, PNPase
sometimes employs its polymerizing ability in vivo to
extend the 3¢ ends of RNAs instead of using a poly(A)
polymerase [26,27].
For a long time, due to its synthetic activity in
the absence of template, PNPase was widely used
as a tool for producing a variety of model nucleic
acids to solve important biological problems, such
as establishing the genetic code and studies on
physicochemical properties of polyribonucleotides
[28]. These applications have been largely replaced
by more versatile chemical synthesis of oligori-

bonucleotides with defined sequences and in vitro
transcription of DNA templates for the synthesis of
longer RNAs.
In contrast to nucleotide polymerization, the exonu-
clease activity of PNPase was rarely exploited. This is
mainly due to the fact that, despite the high processivi-
ty of the enzyme, phosphorolysis is not easily control-
lable. The rate and extent of degradation depend on
the stability of the RNA structure and vary greatly
among RNA species [2]. Increasing temperature results
in destabilization of the RNA structure and more thor-
ough and uniform degradation [29]. However, E. coli
PNPase is unstable above 55 °C and is rapidly inacti-
vated at 65 °C [2]. Conditions have not been estab-
lished that would allow the desired RNA or the
desired fragment of RNA to selectively survive the
phosphorolysis reaction. The only successful example
of a controlled phosphorolysis by PNPase has been the
faithful removal of poly(A) tails from mRNAs. This
was achieved by carrying out the reaction at 0 °C,
when the rest of mRNA was structured and hence
resistant to PNPase [30].
In this regard, PNPases from thermophilic organ-
isms deserve special attention as they are expected to
be active at high temperatures at which the second-
ary and tertiary structures of RNA are melted.
There have been a few reports on such PNPases. In
one of them, PNPases from thermophilic bacteria
Bacillus stearothermophilus and Thermus aquaticus
showed highest polymerizing activities at 69 and

80 °C, respectively. However, their ability to phosp-
horolyse structured RNAs was not characterized, the
enzyme from T. aquaticus was not isolated, and the
purified enzyme from B. stearothermophilus was
reported to be composed of atypically small subunits
of 51 kDa [31]. In another paper, PNPase from
Thermus thermophilus (Tth PNPase), a close relative
of T. aquaticus, was purified to apparent homogene-
ity as tested under non-denaturing conditions, but
the purified enzyme completely lacked phosphorolytic
activity, presumably due to proteolytic degradation
that had occurred during the isolation procedure.
The purified enzyme was reported to be composed
of three unequal polypeptides of 92, 73 and 35 kDa
[32].
In 1997, the nucleotide sequence of a putative pnp
gene from T. thermophilus was submitted to the Gen-
Bank database (accession number Z84207). This open
reading frame has the capacity to encode a 78.2 kDa
polypeptide (a molecular mass that is similar to that of
the E. coli PNPase, 77.1 kDa [33]) in which all struc-
tural domains characteristic of typical PNPases can be
identified (NCBI Protein Database accession number
CAB06341). However, details of the expression, isola-
tion and characterization of the enzyme, although
noted in the NCBI Protein Database submission, have
not been published.
In this paper, we report cloning of the pnp gene of
T. thermophilus, its expression in E. coli cells, and
characterization of biochemical properties of the iso-

lated enzyme. We show that the isolated Tth PNPase
is capable of phosphorolysis, and that even RNAs with
very stable secondary structures are readily degraded
to completion. We further show that RNA can be pro-
tected from phosphorolysis by either modifying its 3¢
end or annealing its 3¢-terminal sequence to a comple-
mentary oligonucleotide. If a mixture of protected and
unprotected RNAs is treated with Tth PNPase, then
only unprotected RNA is degraded. Finally, we show
that hybridization of oligonucleotide to an internal
segment of RNA protects that segment, the upstream
portion and a 8 nt downstream sequence of the RNA
from Tth PNPase. These features could make Tth
PNPase a useful tool for controlled RNA degradation
in vitro.
M. V. Falaleeva et al. RNA phosphorolysis by Tth PNPase
FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS 2215
Results
Isolation of Tth PNPase from E. coli cells
The pnp gene was PCR-amplified using the T. thermo-
philus chromosomal DNA as a template, cloned within
a plasmid downstream of the T7 promoter, and
expressed in T7 RNA polymerase-producing E. coli
cells. The expression product has a higher molecular
mass (78 203 Da, as calculated from the amino acid
sequence deposited in the NCBI Protein Database
under accession number CAB06341) than its E. coli
counterpart (77 122 Da [33]), and this allowed removal
of the E. coli enzyme from the Tth PNPase prepara-
tion to be monitored by PAGE analysis (see supple-

mentary Fig. S1). The Tth PNPase isolation procedure
included heating of the cell lysate at 70 °C, resulting in
denaturation and precipitation of most of the host
proteins, including the E. coli PNPase; ion-exchange
chromatography on a DEAE-Sepharose column; incu-
bation in the presence of P
i
and Mg
2+
(‘autolysis’,
during which any endogenous RNA was completely
degraded by PNPase; phosphatase was included to
eliminate any possible 3¢ phosphoryl groups on RNA
that might interfere with the phosphorolysis [34]);
and gel filtration through a highly porous Superose 6
column.
The full-sized 78 kDa Tth PNPase polypeptide con-
stituted > 50% of the final preparation, with the rest
of protein comprising multiple shorter bands grouping
at around 60–70 and 30–40 kDa. These minor poly-
peptides co-purified with PNPase, and similar products
accumulated in the E. coli cells upon the induction of
T7 RNA polymerase (supplementary Fig. S1). There-
fore, they are most likely fragments of the 78 kDa
polypeptide, which is highly susceptible to proteolysis
[32]. As the enzyme preparation did not contain con-
taminating activities (as shown below), we did not
attempt to further purify it. The enzyme yield (based
on the content of the 78 kDa polypeptide) was 3.3 mg
from 9 g of the Tth PNPase-producing E. coli cells.

The ADP-polymerizing activity of the final preparation
was approximately 200 unitsÆmg
)1
, which is higher
than reported for the PNPase isolated from T. thermo-
philus cells (approximately 70 unitsÆmg
)1
[32]), and,
unlike that preparation, our Tth PNPase retained
phosphorolytic activity (see below).
Conditions optimal for exonuclease activity
The isolated Tth PNPase degraded unprotected RNA,
but did not degrade RNA whose 3¢ end was hybridized
to a complementary oligodeoxyribonucleotide (Fig. 1).
This observation indicated that the enzyme preparation
does indeed possess the 3¢fi5¢ exonuclease activity
and was free from endoribonucleases. Also, RNA
remained intact in the absence of P
i
, suggesting that all
degradation was due to phosphorolysis, rather than
hydrolysis of polyribonucleotides.
Although RNA was not degraded in the presence of
56 lm EDTA, which would sequester trace amounts of
divalent cations, complete degradation of unprotected
RNA occurred when the concentration of added
Mg
2+
was equal to that of EDTA (Fig. 1). Given the
value of the dissociation constant for the Mg

2+
:EDTA
complex (approximately 10
)9
m [35]), this indicates
that the requirement of Tth PNPase for free Mg
2+
is
very low (£ 1 lm), which is much lower than is
the Mg
2+
requirement of a mesophilic (Micrococcus
luteus) enzyme, for which the apparent K
m
value for
Mg
2+
is 0.8 mm [36]. In subsequent experiments
described here, the free Mg
2+
concentration was main-
tained at about 40 lm, which allowed enzymatic phos-
phorolysis of RNA to be performed at a high
temperature without significant concomitant Mg
2+
-
catalysed hydrolysis. Under such conditions, the opti-
mal temperature for phosphorolysis was around 65 °C,
whereas, in the absence of PNPase, RNA remained
substantially intact even at 85 °C (Fig. 2).

Figure 3(A) shows that, at a saturating enzyme con-
centration, when all RNA strands are phosphorolysed
synchronously, a 109 nt 3¢-terminal fragment of a
highly structured RQ135 RNA [37,38] is degraded to
near completion within 2 min, suggesting a rate of
approximately 50 nt per min at 65 °C. This is much
faster than the rate of 3.5 nt per min that is achievable
Fig. 1. Mg
2+
dependence of RNA phosphorolysis. Nondenaturing
PAGE patterns for the 3¢ fragment of RQ135 RNA treated with Tth
PNPase after it had been annealed in the absence or presence of
the oligodeoxyribonucleotide R-38 that is complementary to the
RNA 3¢ end. Each sample contained 0.056 m
M EDTA, which was
present in the RNA and enzyme preparations, and the indicated
concentration of added MgCl
2
.
RNA phosphorolysis by Tth PNPase M. V. Falaleeva et al.
2216 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS
with the E. coli PNPase at its optimal temperature
(37 °C) using a similarly structured tRNA-like 3¢-ter-
minal domain of tobacco mosaic virus RNA [2]. How-
ever, in contrast to the E. coli enzyme, which saturates
RNA at a 1 : 1 m ratio, a larger amount of Tth
PNPase is required for saturation. For the concentra-
tion of RNA used in the experiments shown in Fig. 3
(50 nm), saturation occurs at a fourfold higher enzyme
concentration; the Tth PNPase concentration was cal-

culated assuming that one enzyme molecule active in
phosphorolysis consists of three intact (78 kDa) subun-
its [34]. The same saturating enzyme-to-RNA ratio
was determined when complex formation in the pres-
ence of Mg
2+
(but in the absence of P
i
to prevent
phosphorolysis) was monitored by a shift of the
32
P-labelled RNA band during PAGE (Fig. 3B). Based
on the data shown in Fig. 3, a K
d
value of approxi-
mately 100 nm was estimated for the Tth PNPa-
se:RNA interaction. Hence, the affinity of Tth PNPase
for RNA is approximately 10 times lower than that of
the E. coli enzyme (K
d
= 10–20 nm [39]). The lower
affinity does not necessarily mean that larger amounts
of Tth PNPase have to be used. Instead, the complete
degradation of RNA can be achieved by either reduc-
ing the reaction volume to concentrate the reactants,
or increasing the incubation time.
Selective protection of RNA by terminally
hybridized oligonucleotides
As determined in an RT-PCR assay, under the optimal
conditions established here (temperature, Mg

2+
and
EDTA concentrations, enzyme-to-RNA ratio, reaction
time), Tth PNPase eliminated more than 99% of a
highly structured unprotected RNA without affecting
RNA whose 3¢-terminal sequence was protected by
annealing with a complementary oligonucleotide
(Fig. 4A). This indicated that hybridization of an
oligonucleotide at the 3¢ end of an RNA could selec-
tively protect it from degradation by Tth PNPase.
Figure 4B demonstrates that this is indeed the case. In
this experiment, a mixture of two RNA species, 5¢ and
3¢ fragments of RQ135 RNA [37,38], was annealed
with an oligodeoxyribonucleotide complementary to
the 3¢ end of the 3 ¢ fragment. Subsequent phosphoroly-
sis with Tth PNPase resulted in complete degradation
of the 5¢ fragment and yielded a virtually pure 3¢ frag-
ment (except for the oligodeoxyribonucleotide itself,
which can be removed by electrophoresis or DNase
treatment).
Fig. 2. Temperature dependence of RNA phosphorolysis. Denatur-
ing PAGE patterns of 0.5 pmol of the 3¢ fragment of RQ135 RNA
incubated at the indicated temperature with or without 0.5 pmol of
Tth PNPase.
AB
Fig. 3. Interaction of Tth PNPase with RNA. (A) Denaturing PAGE patterns of 0.5 pmol of the 3¢ fragment of RQ135 RNA treated with the
indicated relative amounts of Tth PNPase for the indicated time periods. (B) Gel-shift analysis by nondenaturing PAGE of the complex
formed between Tth PNPase and the [a-
32
P]-labelled 3¢ fragment of RQ135 RNA upon incubation for 15 min at 65 °C in a phosphate-free

phosphorolysis buffer. RNA bands were visualized by scanning the gel using the Cyclon
TM
storage phosphor system (Packard Instruments,
Meriden, CT, USA). The concentration of RNA in the incubation mixtures was constant (50 n
M), and the concentration of PNPase varied as
indicated.
M. V. Falaleeva et al. RNA phosphorolysis by Tth PNPase
FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS 2217
Protection of RNA by 3¢-terminal modifications
Figure 5 shows that 3¢-terminal modifications of RNA
make it more resistant to phosphorolysis by Tth
PNPase, further confirming that RNA degradation is
due to the 3¢fi5¢ exonuclease activity. Oxidation of
RNA with periodate, which opens the terminal ribose
ring and generates a dialdehyde [40], results in selective
protection of the modified RNA species (Fig. 5A,B).
This protection is moderate, but it is increased upon
treatment of the oxidized RNA with aniline (Fig. 5C),
which eliminates the broken nucleoside and yields
RNA whose terminal 3¢ hydroxyl is phosphorylated
[41]. The high resistance of the 3¢-phosphorylated
RNA to Tth PNPase is not due to chemical modifica-
tion of the RNA body during periodate or aniline
treatment, because it is fully released upon removal of
the 3¢-terminal phosphate by a phosphatase (Fig. 5C).
A similar increase in protection is achieved by treat-
ment of the oxidized RNA with biotin hydrazide,
which adds the biotin group to the RNA 3¢ end
(Fig. 5D).
Comparison with PNPase of E. coli

Figure 6 compares some properties of Tth PNPase
with those of the E. coli PNPase. While both the
enzymes readily degraded poly(A), an unstructured
polyribonucleotide, they behaved differently with the
3¢-terminal fragment of RQ135 RNA, which possesses
a strong secondary structure [37,38]. Unlike the
T. thermophilus enzyme, the E. coli PNPase only phos-
phorolysed a fraction of the RNA at its optimal tem-
perature, and the rest of the RNA remained
apparently intact. This resembles the degradation pat-
tern of another structured RNA, tRNA [29], which
exists in two conformations, of which only one is sus-
ceptible to E. coli PNPase attack at 37 °C [42]. How-
ever, in contrast to tRNA [29,42], E. coli PNPase was
unable to completely degrade the 3¢-terminal fragment
of RQ135 RNA even when temperature was raised to
55 °C (supplementary Fig. S2). Another difference
between these two enzymes concerns the effects of the
3¢-terminal phosphoryl group. While this group effi-
ciently protected RNA from Tth PNPase, such an
effect was not observed with the E. coli PNPase, prob-
ably because it was masked by the inability of the
latter enzyme to completely degrade the unprotected
RNA (Fig. 6).
Protection of RNA by internally hybridized
oligonucleotides
Figure 7 shows degradation patterns of three nested
RNAs that were differently extended at the 3¢ end. All
three RNAs were subjected to phosphorolysis by Tth
PNPase after annealing in the presence or the absence

of a 38 nt oligodeoxyribonucleotide that hybridized to
the 3¢-terminal sequence of the shorter RNA (SmaI)
and to internal sequences of the longer RNAs (EcoRI
and PvuII).
The oligonucleotide completely protected the shorter
RNA, and partially protected the two longer RNAs,
whose degradation yielded a resistant product that
migrated during PAGE slightly more slowly than did
A
B
Fig. 4. Selectivity and completeness of RNA degradation. (A)
Ethidium bromide-stained nondenaturing PAGE patterns for the
products of RT-PCR of RNA that survived incubation with Tth
PNPase of the indicated number of molecules of CT1n1 RNA
after it had been annealed in the absence or presence of the oli-
godeoxyribonucleotide R-38 that is complementary to the RNA
3¢ end. PNPase was present in all samples except those marked
‘–PNPase’. (B) Nondenaturing PAGE patterns of a mixture of the
3¢ and 5¢ fragments of RQ135 RNA incubated with or without
Tth PNPase after annealing in the presence of the oligodeoxyri-
bonucleotide R-38 that is complementary to the 3¢ end of the 3¢
fragment.
RNA phosphorolysis by Tth PNPase M. V. Falaleeva et al.
2218 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS
A
C
D
B

Fig. 5. Effects of 3¢-terminal modifications.

(A–C) Denaturing PAGE patterns for a mix-
ture of 0.5 pmol each of the 3¢ fragment
(upper band) and 5¢ fragment (lower band)
of RQ135 RNA, of which either the 5¢ frag-
ment (A and C, initial mixture) or the 3¢ frag-
ment (B) was oxidized with sodium
periodate (3¢oxi) while the other possessed
the native 3¢ end (3¢OH). The mixture was
either not treated (N ⁄ T) or treated with the
indicated amounts (in pmol) of Tth PNPase,
either directly (A–C, initial mixture) or after
treatment with aniline, resulting in a conver-
sion of the oxidized fragment to 3¢-phos-
phorylated (C, after aniline) and then with
shrimp alkaline phosphatase, removing the
3¢-phosphate (C, after phosphatase). (D)
Nondenaturing PAGE patterns for 3¢ frag-
ments whose 3¢ end was either modified
with biotin (3¢bio) or not modified (3¢OH),
and which were either treated (+) or not
treated ()) with Tth PNPase, or mixed with
a fivefold molar excess of streptavidin
before electrophoresis (Str).
Fig. 6. Comparison of Thermus thermophilus and Escherichia coli
PNPases. Nondenaturing PAGE patterns for 20 ng of poly(A) and
0.5 pmol of the 3¢ fragment of RQ135 RNA whose 3¢ end was
either intact (3¢OH) or esterified with phosphate (3¢P) as a result of
consecutive reactions with periodate and aniline, and which was
either not treated ()) or treated in the presence of 1 m
M P

i
and 0.1
m
M Mg
2+
with 4 pmol of PNPase from E. coli (E) at 37 °C or with
1 pmol of Tth PNPase (T) at 65 °C.
Fig. 7. Effects of internally hybridized oligonucleotide. Nondena-
turing PAGE patterns for nested transcripts of the same plasmid
digested at consecutive sites with SmaI (transcript length
109 nt), EcoRI (127 nt) or PvuII (303 nt), and treated (+) or not
treated ()) with Tth PNPase after annealing in the absence or
presence of oligodeoxyribonucleotide R-38 complementary to
positions 72–109. White arrows indicate the resistant phosphorol-
ysis products.
M. V. Falaleeva et al. RNA phosphorolysis by Tth PNPase
FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS 2219
the hybrid of the oligonucleotide with the shorter
RNA (left part of Fig. 7). Such products were not
observed in the absence of the oligonucleotide (right
part of Fig. 7).
The fine structure of the phosphorolysis product was
analysed by high-resolution (sequencing) PAGE under
denaturing conditions (Fig. 8). Before phosphorolysis,
each of the three RNAs was dephosphorylated and
then labelled at the 5¢ end using [c-
32
P]ATP and poly-
nucleotide kinase. Figure 8A shows that the resistant
product had rather heterogeneous 3¢ ends and was up

to eight nucleotides longer than the terminally pro-
tected RNA, whose 3¢ ends were also not uniform, but
this is common for run-off transcription [43]. The het-
erogeneity of the phosphorolysis product was mainly
due to the heterogeneity of the protecting oligonucleo-
tide, and was substantially reduced when the 5¢ ends of
this oligonucleotide were made uniform by digesting a
longer oligonucleotide with restriction endonuclease.
Phosphorolysis of the longer RNAs, hybridized with
this 5¢-terminally polished oligonucleotide, yielded a
product whose 3¢-terminal heterogeneity was similar to
that of a product of the run-off transcription, and
which was 8 nt longer than the terminally protected
shorter RNA (Fig. 8B). This indicates that Tth
PNPase stalls on a phosphorolysed RNA eight resi-
dues from the 5¢ end of the internally hybridized oligo-
nucleotide, which parallels the observation that
PNPase of E. coli stalls six to nine residues from the
base of a stable stem-loop structure in an RNA strand
[44]. Similarly, the exosome core of a hyperthermophil-
ic archaeon Sulfolobus solfataricus, consisting of
RNase PH subunits, also stalled eight or nine nucleo-
tides from an upstream stem, which has been attrib-
uted to the inability of a double-stranded structure to
enter the central hole of the doughnut-shaped enzyme
structure [45]. The presence of a phosphate group at
the 5¢ end of the oligonucleotide did not affect the
length of the protected RNA fragment, but slightly
reduced its heterogeneity (Fig. 8B; compare lanes 3
and 4 with lanes 7 and 8).

Discussion
This paper reports the isolation of a thermophilic
PNPase whose subunits have a molecular mass typical
of PNPases and which possesses phosphorolytic activ-
ity. The isolated enzyme is free from other ribonucleas-
es. Biochemical characterization of the isolated enzyme
revealed several important features that were not
observed with PNPases from other sources.
First, Tth PNPase has maximal phosphorolytic
activity at a temperature at which even the most
stable hairpins are melted. Therefore, it degrades to
completion those RNAs that mesophilic PNPases fail
to phosphorolyse. Second, the requirement of Tth
PNPase for free Mg
2+
ions is extremely low. This
feature is beneficial, because it allows directed
3¢fi5¢ phosphorolysis to be performed at high tem-
peratures without a risk of breakage of RNA strands
due to Mg
2+
-catalysed hydrolysis. Moreover, it is
this feature that permitted us to discover that RNA
can survive the high-temperature phosphorolysis con-
ditions if its 3¢ end is protected. Protection can be
achieved either by hybridizing the terminal sequence
with a complementary oligonucleotide (care must be
taken to ensure that the hybrid is not melted at the
reaction temperature) or by modifying the terminal
nucleoside.

The results show that 3¢-terminal modifications pro-
tect RNA from Tth PNPase. Previously, a phosphoryl
group in either the 3¢ or 2¢ position of the terminal
ribose, as well as the 2¢,3¢-cyclic phosphate, were found
to prevent phosphorolysis of short (up to 6 nt) oligo-
nucleotides by PNPases from E. coli [46] and M. luteus
AB
Fig. 8. RNA sequence protected by internally hybridized oligonu-
cleotide. High-resolution denaturing PAGE patterns for [5¢-
32
P]-
labelled SmaI, EcoRI and PvuII transcripts protected from Tth
PNPase by hybridization with oligodeoxyribonucleotide R-38 (cf.
Fig. 7). (A) The oligonucleotide was prepared by chemical synthe-
sis without further treatment. Lanes 1 and 2 show untreated
SmaI and EcoRI transcripts respectively; lanes 3 and 4 show
PNPase-treated EcoRI and PvuII transcripts, respectively. The
untreated PvuII transcript migrated too slowly to be shown here
(cf. Fig. 7). (B) Oligonucleotides were prepared from a longer one
by digestion at the SmaI site to generate uniform 5¢ ends (lanes
2–4) and by further removing the 5¢-terminal phosphate (lanes
6–8). Shown are untreated SmaI transcripts (lane 1), PNPase-
treated SmaI (lanes 2 and 6), EcoRI (lanes 3 and 7) and PvuII
(lanes 4 and 8) transcripts, and the EcoRI transcript partially
degraded in mild alkali to produce a 1 nt ladder [51] (lane 5). RNA
bands were visualized by scanning the gel using the Cyclon
TM
storage phosphor system.
RNA phosphorolysis by Tth PNPase M. V. Falaleeva et al.
2220 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS

[47]. However, there were conflicting reports on phos-
phorolysis of the longer (up to 20 nt) 3¢-phosphory-
lated fragments that constitute most commercial RNA
preparations, of which between 20% [48] and 100%
[49] was found to be degradable by E. coli PNPase.
This disagreement could be explained by a different
average fragment length in the RNA preparations or
by different content of contaminating enzymes (such
as a phosphatase that would remove the 3¢-terminal
phosphate from the RNA fragments) in the PNPase
preparations used.
The results further show that Tth PNPase is sensi-
tive to 3¢-terminal modifications that cannot result in
positioning of a phosphate or a similar bulky nega-
tively charged group in the subsite of the PNPase
active site normally occupied by the terminal nucleo-
side, the mechanism that was hypothesized to be the
basis for the inhibitory action of the 3¢-terminal phos-
phate [50]. The fact that periodate oxidation of RNA,
resulting a conversion of the 2¢,3¢-cis-glycol to dialde-
hyde, also has an inhibitory effect indicates that inter-
actions with the free 3¢ and ⁄ or 2¢ hydroxyls of the
terminal ribose may be important for correct binding
of substrate RNA to the active site of Tth PNPase, as
was found for the S. solfataricus exosome [45].
Terminal protection allows desirable RNA species
to be isolated from heterogeneous populations by
degrading other (unprotected) strands. This could
also be used for reducing artifactual sequence recom-
bination and increasing the specificity of RT-PCR

assays. The observation that biotin at the 3¢ end of
an RNA strand efficiently protects it from phospho-
rolysis suggests an efficient way of obtaining a 100%
pure biotinylated RNA preparation. Many other Tth
PNPase applications of this sort can undoubtedly be
conceived.
Finally, the results of this study show that any arbi-
trary 5¢-terminal fragment of an RNA strand can be
obtained by a controlled phosphorolysis with a preci-
sion similar to that of run-off transcription, but with-
out the need for a restriction site. This can be done by
protecting the RNA strand with an oligonucleotide
complementary to an internal RNA segment that lies
8 nt upstream of the desired 3¢ end.
In summary, this paper demonstrates that the prop-
erties of Tth PNPase allow fully controlled RNA deg-
radation, which could be used in various research and
practical applications. In view of the structural similar-
ities between bacterial PNPase [10] and the S. solfatari-
cus exosome [16], one may expect that the archaeal
enzyme, which is also thermophilic, will possess bio-
chemical properties similar to those reported here for
Tth PNPase.
Experimental procedures
Cloning and expression of the pnp gene of
T. thermophilus
The pnp gene was PCR-amplified using the chromosomal
DNA of T. thermophilus VK1 as a template and primers
5¢-GACGTCGACAT
ATGGAAGGCACACCCAATG-3¢

[matching the start of the PNPase-coding sequence, positions
977–995 of GenBank accession number Z84207 (underlined)
and introducing an NdeI site (bold)], and 5¢-TTCGAATTC
T
TACTTGCGCCGCCTGGG-3¢ [matching the end of the
PNPase-coding sequence, positions 3101–3117 of GenBank
accession number Z84207 (underlined) and introducing an
EcoRI site (bold)]. The PCR product was digested at the
NdeI and EcoRI sites, and ligated into plasmid vector
pT7-7 [52] between these sites. The resulting plasmid, pT7-
PNP, was cloned [53] and expressed in E. coli
B834(DE3) ⁄ pLysS cells [54] by inducing T7 RNA polymer-
ase synthesis using 1 mm isopropyl b-d-thiogalactoside for
4 h at 37 °C.
Isolation of Tth PNPase
Nine grams of Tth PNPase-producing E. coli cells pel-
leted from 6 L of culture were suspended in 40 mL of
ice-cold buffer A (20 mm Hepes ⁄ NaOH pH 8.2, 100 mm
NaCl, 0.1 mm Na-EDTA, 2 mm b-mercaptoethanol, 1 mm
phenylmethanesulfonyl fluoride) and disrupted in a
Gaulin Micron Lab 40 homogenizer (APV Thermotech
GmbH, Artem, Germany) at 1400 bar. The lysate was
10-fold diluted with buffer A and incubated for 60 min
at 70 °C with stirring. After pelleting of the cell debris
and precipitated proteins for 40 min at 25 900 g in rotor
JA-14 of a J2-21 centrifuge (Beckman, Vienna, Austria),
the lysate was applied to a 11 mL DEAE-Sepharose FF
(Amersham Biosciences, Vienna, Austria) column equili-
brated with buffer B (20 mm Tris ⁄ HCl pH 8.0, 1 m m
Na-EDTA, 0.1 m NaCl, 2 mm b-mercaptoethanol, 5%

w ⁄ w glycerol). After washing the column with buffer B,
the enzyme was eluted with a linear gradient of NaCl
(0.1–0.5 m) in the same buffer. Fractions with a high
PNPase activity were pooled, supplemented with DNase
(1 lgÆmL
)1
) and calf intestinal alkaline phosphatase
(1 unitÆmL
)1
), and dialysed overnight against buffer B
containing 3 mm MgCl
2
and 5 mm Na-phosphate. After
an additional incubation for 30 min at 37 °C, followed
by 60 min at 66 °C and then chilling on ice, the precipi-
tated proteins were pelleted as above. The supernatant
was concentrated to a volume of 0.25 mL using a Centr-
icon-30 filter (Amicon, Beverly, MA, USA), cleared by
centrifugation in a microcentrifuge at 12 100 g, and sub-
jected to gel filtration through a 24 mL Superose 6 HR
column (Amersham Biosciences) in buffer B. Fractions
with the highest PNPase activity were pooled, dialysed
M. V. Falaleeva et al. RNA phosphorolysis by Tth PNPase
FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS 2221
overnight against the storage buffer (50 mm Tris ⁄ HCl
pH 8.0, 100 mm NaCl, 10% w ⁄ w glycerol, 0.1% Nonidet
P40 (BDH Ltd, Poole, England), 2 mm dithiothreitol),
cleared by centrifugation, and stored at )70 °C after the
addition of glycerol to 50% w ⁄ w.
Enzyme assay

Tth PNPase activity was determined colorimetrically as P
i
[55] released from ADP during the synthesis of poly(A)
at 70 °C in a mixture containing 50 mm Tris ⁄ HCl
pH 8.2, 20 mm ADP, 0.1 m NaC1, 1 mm MgCl
2
and no
primer. One unit of activity was defined as the amount
of enzyme that polymerized 1 lmol of ADP per hour.
Protein was measured by the method described by Lowry
et al. [56]. Enzyme purity was analysed by SDS–PAGE
(supplementary Fig. S1). The percentage of full-sized
PNPase polypeptide was estimated from Coomassie
G-250-stained gel images using program imagej (http://
rsb.info.nih.gov/ij/).
Isolation of E. coli PNPase
Unless otherwise stated, all procedures were carried out at
4 °C.
Homogenization
Two hundred grams of pelleted E. coli B cells were sus-
pended in 200 mL of buffer C (50 mm Tris ⁄ HCl pH 8.0,
1mm Na-EDTA, 10 mm MgCl
2
, 0.2 m KCl, 5 mm b-mer-
captoethanol, 5% w ⁄ w glycerol, 1 mm phenylmethane-
sulfonyl fluoride) and disrupted in homogenizer 15M-8TA
(APV Gaulin Inc., Everett, MA, USA) at 600 bar.
Phase partitioning
After removal of cell debris (for 40 min at 30 100 g in
rotor JA-14 of the Beckman J2-21 centrifuge), the lysate

was subjected to the liquid polymer phase partitioning
procedure previously developed for the isolation of Qb
replicase, using a mixture of polyethylene glycol 6000
(Merck KGaA, Darmstadt, Germany) and Dextran
T500 (Amersham Biosciences), followed by extraction of
RNA-bound proteins from the dextran phase using NaCl
[57].
DEAE cellulose
After dialysis against buffer D (10 mm Tris ⁄ HCl pH 7.5,
1mm Na-EDTA, 5 mm MgCl
2
,5mm b-mercaptoethanol,
5% w ⁄ w glycerol), until conductivity of the extract
dropped to that of buffer D100 (buffer D plus 100 mm
NaCl), it was cleared by centrifugation for 40 min at
30 100 g in rotor JA-14 and applied to a 200 mL DE-52
column (Whatman, Florhom Park, NJ, USA) equilibrated
in buffer D100. The column was washed with 2.5 vol-
umes of D100, then with 2.5 volumes of D150 (buffer D
plus 150 mm NaCl) and eluted with a gradient of NaCl
(150–400 mm) in buffer D. Fractions with a high PNPase
activity were pooled, protein was concentrated by precipi-
tation with ammonium sulphate (40 gÆ100 mL
)1
), and the
pellet was solubilized in 20 mL of buffer and dialysed
overnight against buffer D100.
Autolysis
After clearing the dialysed preparation by centrifugation, it
was supplemented with 50 lg of DNase, 50 units of calf

intestinal alkaline phosphatase, 1 mm ZnCl
2
and 1 mm
phenylmethanesulfonyl fluoride, and incubated for 60 min
at 37 °C. Then 1 m K-phosphate (pH 8.0) was added to a
concentration of 100 mm, and incubation was continued
for an additional 30 min.
Sepharose CL-6B
The autolysed preparation was cleared by centrifugation
and subjected to gel filtration through a column of Sepha-
rose CL-6D, Amersham Biosciences (2.6 · 100 cm) equili-
brated in buffer D100.
Mono Q
Fractions with high activity were pooled and chromato-
graphed in several portions on a FPLC system through a
Mono Q HR 5 ⁄ 5 column (Amersham Biosciences) equili-
brated in buffer D100 and utilizing a 100–1000 mm NaCl
gradient in buffer D.
Superose 6
Active Mono Q fractions were pooled, concentrated by
passing through a Centricon-30 filter (Amicon), and sub-
jected to gel filtration through a 24 mL Superose 6 HR
column (Amersham Biosciences). Fractions were analysed
by SDS–PAGE, and those containing the least amount of
impurities were pooled, and stored at )70 °C after addition
of glycerol to 50% w ⁄ w.
The final preparation (2.2 mg of protein) was > 90%
pure (supplementary Fig. S1C, lanes 2 and 3) and was free
from endonuclease activity. The specific activity of the
enzyme was approximately 450 unitsÆmg

)1
, with 1 unit
being defined as the amount of enzyme that released 1 lmol
of P
i
from ADP per hour at 37 °C in a mixture containing
100 mm Tris ⁄ HCl pH 8.0, 10 mm ADP, 0.5 mm Na-EDTA,
10 mm MgCl
2
and no primer.
RNA phosphorolysis by Tth PNPase M. V. Falaleeva et al.
2222 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS
RNA sequences
CT1n1 RNA is a derivative of RQ135
)1
RNA [37] carry-
ing a 43 nt insert (underlined), generated in unpublished
experiments on intermolecular RNA recombination. The
RNA preparation was obtained by transcription of a
SmaI-digested plasmid, encoding the recombinant sequence:
GGGGUUCCAACCGGAAGUUGAGGGAUGCCUAGG
CAUCCCCCGUGCGUCCCUU
AAAGCUUCAUUCUUC
CUUUCUUUAAAAGAGAGAGAGAGAAAGCGAGGG
AUUUGAGAGAUGCCUAGGCAUCUCCCGCGCGCC
GGUUUCGGACCUCCAGUGCGUGUUACCGCACUG
UUAGCCC.
The 5¢ fragment of RQ135 RNA is a 52 nt 5¢ terminal
sequence of RQ135
)1

RNA [37] carrying a 23 nt extension
(underlined), obtained by transcription of the 5¢ fragment-
encoding plasmid [58] digested at site BamHI: GGGG
UUCCAACCGGAAGUUGAGGGAUGCCUAGGCAUC
CCCCGUGCGUCCCUU
CUGCAGCUCGAGUCUAGAG
GAUC.
The 3¢ fragment of RQ135 RNA (transcript SmaI) is a
81 nt 3¢ terminal sequence of RQ135
)1
RNA [37] carrying a
28 nt extension (underlined), obtained by transcription of
the 3¢ fragment-encoding plasmid [58] digested at the SmaI
site:
GGCGCUGCAGCUCGAGUCUAGAGGAUCCUA
CGAGGGAUUUGAGAGAUGCCUAGGCAUCUCC CG
CGCGCCGGUUUCGGACCUCCAGUGCGUGUUACC
GCACUGUUAGCCC.
Transcript EcoRI (the 3¢ fragment of RQ135 RNA
extended at the 3¢ end by a 18 nt sequence, underlined) was
obtained by transcription of the 3¢ fragment-encoding plas-
mid [58] digested at site EcoRI: GGCGCUGCAGCUCGA
GUCUAGAGGAUCCUACGAGGGAUUUGAGAGAUG
CCUAGGCAUCUCCCGCGCGCCGGUUUCGGACCU
CCAGUGCGUGUUACCGCACUGUUAGCCC
GGGUA
CCGAGCUCGAAUU.
Transcript PvuII (the 3¢ fragment of RQ135 RNA
extended at the 3¢ end by a 194 nt sequence, underlined)
was obtained by transcription of the 3¢ fragment-encoding

plasmid [58] digested at site PvuII: GGCGCUGCAGCUC
GAGUCUAGAGGAUCCUACGAGGGAUUUGAGAGA
UGCCUAGGCAUCU CCCGC GCG CCGGU UUCGG AC
CUCCAGUGCGUGUUACCGCACUGUUAGCCC
GGG
UACC GAGCUCGAA UUCGUAAUCAUGGUCAUAGC
UGUUUCCUGUGUGAAAUUGUUAUCCGCUCACAA
UUCCACACAACAUACGAGCCGGAAGCAUAAAGU
GUAAAGCCUGGGGUGCCUAAUGAGUGAGCUAA
CUCACAUUAAUUGCGUUGCGCUCACUGCCCGCUU
UCCAGUCGGGAAACCUGUCGUGCCAG.
RNA preparations
RNA samples used in this work were prepared by run-off
transcription of plasmids digested at appropriate restriction
sites and purified by PAGE as described previously [58].
Where indicated, RNA was oxidized with sodium perio-
date, followed by treatment with aniline and shrimp alka-
line phosphatase as described previously [58]. Biotinylated
RNA was prepared by incubation of periodate-oxidized
RNA at 4 °C for 20 h with 5 mm biotin hydrazide (Sigma,
St Louis, MO, USA) in the presence of 0.1% SDS and
0.2 m Na-acetate (pH 4.8). Unincorporated biotin hydra-
zide was removed by gel filtration through a Sephadex
G-25 (Amersham Biosciences) spin column.
RNA:oligonucleotide hybridization
Immediately before hybridization, RNA (in 0.1 mm
Na-EDTA pH 8.0) and oligodeoxyribonucleotides (in
10 mm Tris ⁄ HCl pH 9.0, 0.01 mm Na-EDTA) were sepa-
rately melted in a boiling bath for 2 min followed by rapid
chilling on ice. Hybridization was carried out by incuba-

tion, at 65 °C for 15 min, of a 5 lL mixture containing
80 mm Hepes-KOH pH 8.1, 150 mm KCl, 0.2 mm
Na-EDTA, 0.5 pmol RNA and 2.5 pmol of complementary
oligodeoxyribonucleotide.
RNA degradation and analysis
Unless otherwise stated, RNA degradation and analysis
were performed using a 10 lL reaction mixture containing
50 mm Hepes-KOH pH 8.1, 75 mm KCl, 1 mm dithiothrei-
tol, 1 mm Na-phosphate, 0.06 mm Na-EDTA, 0.1 mm
MgCl
2
, 0.5 pmol RNA, 2 pmol Tth PNPase, and, where
indicated, 2.5 pmol of a protective oligodeoxyribonucleo-
tide. Reactions were carried out at 65 °C for 15 min and
terminated by the addition of 10 lLof10mm Na-EDTA.
Nucleic acids were isolated by phenol extraction [53] and
analysed by nondenaturing PAGE (in the presence of TBE
buffer: 100 mm Tris ⁄ HCl, 100 mm boric acid, 2 mm
Na-EDTA) or by denaturing PAGE (in the presence of
buffer TBE containing 7 m urea). Gels were stained after
electrophoresis using silver [59].
Preparation of oligodeoxyribonucleotides with
uniform 5¢ ends
To prepare oligodeoxyribonucleotide R-38 with uniform 5¢
end, two other oligonucleotides were synthesized: a longer
oligodeoxyribonucleotide R-50 (3¢-AAAGCCTGGAGGTC
ACGCACAATGGCGTGACAATC
GGGCCCCCTTAAG
GT-5¢) and a shorter complementary oligodeoxyribonucleo-
tide F-24 (5¢-CACTGTTAGCCCGGGGGAATTCCA-3¢).

Upon annealing, these produced a partial duplex (last 24
nucleotides of R-50 with complete sequence of F-24), which
was digested with restriction endonuclease SmaI at the site
underlined in R-50. After digestion, the preparation was
melted, and the 38 nt long oligodeoxyribonucleotide R-38
was isolated by PAGE.
M. V. Falaleeva et al. RNA phosphorolysis by Tth PNPase
FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS 2223
Reverse transcription
RNA samples subjected to PNPase treatment were
extracted with phenol [53], precipitated from the aqueous
phase using 6 volumes of an ethanol : acetone (1 : 1 v ⁄ v)
mixture in the presence of 20 lg of linear polyacrylamide
[60] and 300 mm KCl, pelleted in a microcentrifuge, washed
twice with 80% v⁄ v ethanol, and dissolved in 6 lL water.
A10lL reaction mixture was prepared, containing 50 mm
Tris ⁄ HCl pH 8.3, 79 mm KCl, 3 mm MgCl
2
,10mm dith-
iothreitol, 0.2 mm of each dNTP, 0.5 lm primer R-38 (5¢-
GGGCTAACAGTGCGGTAACACGCACTGGAGGTCC
GAAA-3¢), 50 ng poly(A), 50 units of M-MLV reverse
transcriptase (Amersham Biosciences) and the analysed
RNA sample. After incubation for 60 min at 45 °C, sam-
ples were precipitated with an ethanol : acetone mixture as
above.
PCR
Reactions were carried out using a RapidCycler
TM
(Idaho

Technology, Salt Lake City, UT, USA) in 10 lL capillaries
containing 50 mm Tris ⁄ HCl pH 8.7, 2.5 mm MgCl
2
,
0.2 mm of each dNTP, 0.2 lm each of primers R-38 and
F-39 (5¢-AAGCTTAATACGACTCACTATA
GGGGTTCC
AACCGGAAG-3¢, the underlined segment matches the
5¢-terminal sequence of RQ135 cDNA), 10 lg of casein,
12 ng of a His
6
-tagged Taq DNA polymerase [61], and a
cDNA preparation diluted in buffer comprising 10 mm
Tris ⁄ HCl pH 9.0, 0.1 mm Na-EDTA, 0.1% polyethylene
glycol 6000 and 10 ngÆlL
)1
poly(A). The first five cycles
(melting at 94 °C for 10 s, annealing at 60 °C for 10 s,
extension at 70 °C for 30 s) were followed by 35
cycles in which the melting temperature was reduced
to 88 °C and the annealing temperature was increased to
65 °C.
Acknowledgements
We thank L. A. Tolstova and A. A. Demidenko for
their help in the isolation of Tth PNPase. This work
was supported by the Russian Foundation for Basic
Research grant number 08-04-01660 to H. V. C., by
the program ‘Molecular and Cell Biology’ of the Rus-
sian Academy of Sciences, and by the program ‘Living
Systems’ of the Ministry of Industry, Science and

Technology of the Russian Federation.
References
1 Grunberg-Manago M & Ochoa S (1955) Enzymic
synthesis and breakdown of polynucleotides: poly-
nucleotide phosphorylase. J Am Chem Soc 77, 3165–
3166.
2 Littauer UZ & Soreq H (1982) Polynucleotide phos-
phorylase. In The Enzymes, Vol. XV (Boyer P, ed.),
pp. 517–553. Academic Press, New York, NY.
3 Zuo Y & Deutscher MP (2001) Exoribonuclease super-
families: structural analysis and phylogenetic distribu-
tion. Nucleic Acids Res 29, 1017–1026.
4 Symmons MF, Williams MG, Luisi BF, Jones GH &
Carpousis AJ (2002) Running rings around RNA: a
superfamily of phosphate-dependent RNases. Trends
Biochem Sci 27, 11–18.
5 Yehudai-Resheff S, Portnoy V, Yogev S, Adir N &
Schuster G (2003) Domain analysis of the chloroplast
polynucleotide phosphorylase reveals discrete functions
in RNA degradation, polyadenylation, and sequence
homology with exosome proteins. Plant Cell 15, 2003–
2019.
6 Leszczyniecka M, DeSalle R, Kang DC & Fisher PB
(2004) The origin of polynucleotide phosphorylase
domains. Mol Phylogenet Evol 31, 123–130.
7 Littauer UZ (2005) From polynucleotide phosphorylase
to neurobiology. J Biol Chem 280, 38889–38897.
8 Perrin R, Lange H, Grienenberger JM & Gagliardi D
(2004) AtmtPNPase is required for multiple aspects of
the 18S rRNA metabolism in Arabidopsis thaliana mito-

chondria. Nucleic Acids Res 32, 5174–5182.
9 Mian IS (1997) Comparative sequence analysis of ribo-
nucleases HII, III, II, PH, and D. Nucleic Acids Res 25,
3187–3195.
10 Symmons MF, Jones GH & Luisi BF (2000) A dupli-
cated fold is the structural basis for polynucleotide
phosphorylase catalytic activity, processivity, and regu-
lation. Structure 8, 1215–1226.
11 Kelly KO & Deutscher MP (1992) Characterization of
Escherichia coli RNase PH. J Biol Chem 267, 17153–
17158.
12 Siomi H, Matunis MJ, Michael WM & Dreyfuss G
(1993) The pre-mRNA binding K protein contains a
novel evolutionarily conserved motif. Nucleic Acids Res
21, 1193–1198.
13 Bycroft M, Hubbard TJ, Proctor M, Freund SM &
Murzin AG (1998) The solution structure of the S1
RNA binding domain: a member of an ancient nucleic
acid-binding fold. Cell 88, 235–242.
14 Valentine RC, Thang MN & Grunberg-Manago M
(1969) Electron microscopy of Escherichia coli polynu-
cleotide phosphorylase molecules and polyribonucleo-
tide formation. J Mol Biol 39, 389–391.
15 Baginsky S, Shteiman-Kotler A, Liveanu V, Yehudai-
Resheff S, Bellaoui M, Settlage RE, Shabanowitz J,
Hunt DF, Schuster G & Gruissem W (2001) Chloro-
plast PNPase exists as a homo-multimer enzyme
complex that is distinct from the Escherichia coli
degradosome. RNA 7, 1464–1475.
16 Lorentzen E, Walter P, Fribourg S, Evguenieva-

Hackenberg E, Klug G & Conti E (2005) The archa-
RNA phosphorolysis by Tth PNPase M. V. Falaleeva et al.
2224 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS
eal exosome core is a hexameric ring structure with
three catalytic subunits. Nat Struct Mol Biol 12,
575–581.
17 Pruijn GJM (2005) Doughnuts dealing with RNA. Nat
Struct Mol Biol 12, 562–564.
18 Coburn GA & Mackie GA (1999) Degradation of
mRNA in Escherichia coli: an old problem with
some new twists. Prog Nucleic Acid Res Mol Biol 62,
55–108.
19 Cheng ZF & Deutscher MP (2003) Quality control of
ribosomal RNA mediated by polynucleotide phosphory-
lase and RNase R. Proc Natl Acad Sci USA 100, 6388–
6393.
20 Li Z, Reimers S, Pandit S & Deutscher MP (2002)
RNA quality control: degradation of defective transfer
RNA. EMBO J 21, 1132–1138.
21 Houseley J, LaCava J & Tollervey D (2006) RNA-qual-
ity control by the exosome. Nat Rev Mol Cell Biol 7,
529–539.
22 Clements MO, Eriksson S, Thompson A, Lucchini S,
Hinton JC, Normark S & Rhen M (2002) Polynucleo-
tide phosphorylase is a global regulator of virulence
and persistency in Salmonella enterica. Proc Natl Acad
Sci USA 99, 8784–8789.
23 Sarkar D, Park ES & Fisher PB (2006) Defining the
mechanism by which IFN-b downregulates c-myc
expression in human melanoma cells: pivotal role for

human polynucleotide phosphorylase (hPNPase
OLD)35
).
Cell Death Differ 13, 1541–1553.
24 Sarkar D & Fisher PB (2006) Polynucleotide phos-
phorylase: an evolutionary conserved gene with an
expanding repertoire of functions. Pharmacol Ther 112,
243–263.
25 Perrin R, Meyer EH, Zaepfel M, Kim YJ, Mache R,
Grienenberger JM, Gualberto JM & Gagliardi D (2004)
Two exoribonucleases act sequentially to process
mature 3¢-ends of atp9 mRNAs in Arabidopsis mito-
chondria. J Biol Chem 279, 25440–25446.
26 Mohanty BK & Kushner SR (2000) Polynucleotide
phosphorylase functions both as a 3¢fi5¢ exonuclease
and a poly(A) polymerase in Escherichia coli. Proc Natl
Acad Sci USA 97, 11966–11971.
27 Yehudai-Resheff S, Hirsh M & Schuster G (2001) Poly-
nucleotide phosphorylase functions as both an exonu-
clease and a poly(A) polymerase in spinach
chloroplasts. Mol Cell Biol 21, 5408–5416.
28 Littauer UZ & Grunberg-Manago M (1999) Polynucle-
otide phosphorylase. In Encyclopedia of Molecular Biol-
ogy, Vol. 3 (Creighton TE, ed.), pp. 1911–1918. John
Wiley and Sons, New York.
29 Thang MN, Guschlbauer W, Zachau HG & Grunberg-
Manago M (1967) Degradation of transfer ribonucleic
acid by polynucleotide phosphorylase. I. Mechanism of
phosphorolysis and structure of tRNA. J Mol Biol 26,
403–421.

30 Soreq H, Nudel U, Salomon R, Revel M & Littauer
UZ (1974) In vitro translation of polyadenylic acid-free
rabbit globin messenger RNA. J Mol Biol 88, 233–245.
31 Wood JN & Hutchinson DW (1976) Thermostable
polynucleotide phosphorylases from Bacillus stearother-
mophilus and Thermus aquaticus. Nucleic Acids Res 3,
219–229.
32 Hishinuma F, Hirai K & Sakaguchi K (1977) Thermo-
philic polynucleotide phosphorylase from Thermus ther-
mophilus. Purification and properties of an altered form
of enzyme which lacks phosphorolytic activity to poly-
nucleotide. Eur J Biochem 77, 575–583.
33 Regnier P, Grunberg-Manago M & Portier C (1987)
Nucleotide sequence of the pnp gene of Escherichia coli
encoding polynucleotide phosphorylase. Homology of
the primary structure of the protein with the RNA-
binding domain of ribosomal protein S1. J Biol Chem
262, 63–68.
34 Soreq H & Littauer UZ (1977) Purification and charac-
terization of polynucleotide phosphorylase from Escher-
ichia coli. Probe for the analysis of 3¢ sequences of
RNA. J Biol Chem 252, 6885–6888.
35 Martell AE (1964) Section II: Organic ligands. In Sta-
bility Constants of Metal-Ion Complexes (Sille
´
n LG,
Martell AE & Bjerrum J, eds), pp. 634–641. The Chemi-
cal Society, London.
36 Chou JY, Singer MF & McPhie P (1975) Kinetic stud-
ies on the phosphorolysis of polynucleotides by polynu-

cleotide phosphorylase. J Biol Chem 250, 508–514.
37 Munishkin AV, Voronin LA, Ugarov VI, Bondareva
LA, Chetverina HV & Chetverin AB (1991) Efficient
templates for Qb replicase are formed by recombination
from heterologous sequences. J Mol Biol 221, 463–472.
38 Ugarov VI, Demidenko AA & Chetverin AB (2003) Qb
replicase discriminates between legitimate and illegiti-
mate templates by having different mechanisms of initi-
ation. J Biol Chem 278, 44139–44146.
39 Bermu´ dez-Cruz RM, Garcı
´
a-Mena J & Montan
˜
ez C
(2002) Polynucleotide phosphorylase binds to ssRNA
with same affinity as to ssDNA. Biochimie 84, 321–328.
40 Steinschneider A & Fraenkel-Conrat H (1966) Studies
of nucleotide sequences in tobacco mosaic virus ribonu-
cleic acid. III. Periodate oxidation and semicarbazone
formation. Biochemistry 5, 2729–2734.
41 Steinschneider A & Fraenkel-Conrat H (1966) Studies
of nucleotide sequences in tobacco mosaic virus ribonu-
cleic acid. IV. Use of aniline in stepwise degradation.
Biochemistry 5, 2735–2743.
42 Thang MN, Beltchev B & Grunberg-Manago M (1971)
Phosphorolysis of tRNA. Multiple conformational
states of tRNA in solution. Eur J Biochem 19, 184–193.
43 Milligan JF, Groebe DR, Witherell GW & Uhlenbeck
OC (1987) Oligonucleotide synthesis using T7 RNA
polymerase and synthetic DNA templates. Nucleic Acids

Res 15, 8783–8798.
M. V. Falaleeva et al. RNA phosphorolysis by Tth PNPase
FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS 2225
44 Spickler C & Mackie GA (2000) Action of RNase II
and polynucleotide phosphorylase against RNAs con-
taining stem-loops of defined structure. J Bacteriol 182,
2422–2427.
45 Lorentzen E & Conti E (2005) Structural basis of 3¢ end
RNA recognition and exoribonucleolytic cleavage by an
exosome RNase PH core. Mol Cell 20, 473–481.
46 Singer MF (1958) Phosphorolysis of oligoribonucleo-
tides by polynucleotide phosphorylase. J Biol Chem
232, 211–228.
47 Chou JY & Singer MF (1970) A kinetic analysis of the
phosphorolysis of oligonucleotides by polynucleotide
phosphorylase. J Biol Chem 245, 995–1004.
48 Littauer UZ & Kornberg A (1957) Reversible synthesis
of polyribonucleotides with an enzyme from Escherichia
coli. J Biol Chem 226, 1077–1092.
49 Grunberg-Manago M (1959) Phosphorolyse et configu-
ration macromole
´
culaire polyribonucle
´
otides biosynthe
´
-
tiques et des acides ribonucle
´
iques. J Mol Biol 1,

240–259.
50 Chou JY & Singer MF (1970) The effect of chain length
on the phosphorolysis of oligonucleotides by polynucle-
otide phosphorylase. J Biol Chem 245, 1005–1011.
51 Donis-Keller H, Maxam AM & Gilbert W (1977) Map-
ping adenines, guanines, and pyrimidines in RNA.
Nucleic Acids Res 4, 2527–2538.
52 Tabor S (1990) Expression using the T7 RNA polymer-
ase ⁄ promoter system. Curr Protocols Mol Biol 1,
16.2.1–16.2.6.
53 Sambrook J & Russell DW (2001) Molecular Cloning,
3rd edn. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
54 Studier FW, Rosenberg AH, Dunn JJ & Dubendorf JW
(1990) Use of T7 RNA polymerase to direct expression
of cloned genes. Methods Enzymol 185, 60–89.
55 Panusz HT, Graczyk G, Wilmanska D & Skarzynski J
(1970) Analysis of orthophosphate–pyrophosphate mix-
tures resulting from weak pyrophosphatase activities.
Anal Biochem 35, 494–504.
56 Lowry OH, Rosebrough NJ, Farr AL & Randall RJ
(1951) Protein measurement with the Folin phenol
reagent. J Biol Chem 193, 265–275.
57 Blumenthal T (1979) Qb RNA replicase and protein
synthesis elongation factors EF-Tu and EF-Ts. Methods
Enzymol 60, 628–638.
58 Chetverin AB, Chetverina HV, Demidenko AA &
Ugarov VI (1997) Nonhomologous RNA recombination
in a cell-free system: evidence for a transesterification
mechanism guided by secondary structure. Cell 88, 503–

513.
59 Igloi GL (1983) A silver stain for the detection of nano-
gram amounts of tRNA following two-dimensional
electrophoresis. Anal Biochem 134, 184–188.
60 Gaillard C & Strauss F (1990) Ethanol precipitation of
DNA with linear polyacrylamide as carrier. Nucleic
Acids Res 18, 378.
61 Chetverina HV, Samatov TR, Ugarov VI & Chetverin
AB (2002) Molecular colony diagnostics: detection
and quantitation of viral nucleic acids by in-gel PCR.
BioTechniques 33, 150–156.
Supplementary material
The following supplementary material is available for
this article online:
Fig. S1. Expression of the T. thermophilus pnp gene in
E. coli cells and isolation of the expression product.
Fig. S2. Inability of E. coli PNPase to completely
degrade the 3¢ fragment of RQ135 RNA.
This material is available as part of the online article
from
Please note: Blackwell Publishing are not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
RNA phosphorolysis by Tth PNPase M. V. Falaleeva et al.
2226 FEBS Journal 275 (2008) 2214–2226 ª 2008 The Authors Journal compilation ª 2008 FEBS