Báo cáo khoa học: Characterization, localization and possible anti-inflammatory function of rat histone H4 mRNA variants potx

Characterization, localization and possible
anti-inflammatory function of rat histone H4 mRNA
variants
Rene
´
Poirier, Irma Lemaire and Simon Lemaire
Department of Cellular and Molecular Medicine, University of Ottawa, Canada
Histones are known to play a key role in the pack-
aging of DNA within eukaryotic cells. The majority of
histone proteins or ‘core histones’ are produced during
the synthesis (S) phase of the cell cycle [1]. Core his-
tone mRNAs do not end with a polyadenylated tail
but, instead, contain within their 3¢UTR a conserved
stem–loop sequence that is involved in their matur-
ation and function [2]. There are also replication-
independent histone variants that transcribe poly-
adenylated mRNAs and whose translation products
accumulate preferentially in nondividing, terminally
differentiated tissues [3]. In contrast with core histone
mRNAs, histone mRNA variants can be expressed
throughout all phases of the cell cycle in inducible and
tissue-specific ways [3]. Histones derived from replica-
tion-independent mRNAs were originally suggested to
Keywords
C-terminal H4 peptides; extracellular
function; histogranin; histone H4 mRNA
variants; H4-v.1
Correspondence
S. Lemaire, Department of Cellular and
Molecular Medicine, Faculty of Medicine,
University of Ottawa, 451 Smyth Road,

Ottawa, Ontario, Canada K1H-8M5
Fax: +1 613 562 5646
Tel: +1 613 562 5800 ext. 8350
E-mail:
(Received 7 July 2006, accepted 1 August
2006)
doi:10.1111/j.1742-4658.2006.05444.x
Two histone H4 mRNA variants, H4-v.1 and histogranin mRNAs, were
detected in the rat genome and measured in various tissues and isolated
alveolar macrophages. Medium to high levels of both mRNAs were present
in the liver, adrenal glands, thymus, bone marrow and alveolar macrophag-
es. H4-v.1 cDNA contained an open reading frame that coded for unmodi-
fied whole histone H4, whereas histogranin cDNA lacked the first ATG
codon and contained an open reading frame that coded for modified
(Thr89) H4-(84–102). The two genes displayed a sequence homologous
(> 80%) to the open reading frame of core H4 somatic (H4s) and H4 ger-
minal (H4g) and their variant nature was supported by the absence of
histone consensus palindromic and purine-rich sequences in the proximal
3¢UTR, and the presence of a polyadenylation signal in the distal 3¢UTR
and of specific upstream transcription factor-binding sites. H4-v.1 and his-
togranin transcripts, but not H4s transcript, were selectively induced by
lipopolysaccharide and ⁄ or interferon gamma in alveolar macrophages.
In vitro transcription ⁄ translation experiments with H4-v.1 and histogranin
cDNA pCMV constructs produced peptides with the molecular mass
(2 kDa) of the alternative histone H4 translation product which, like syn-
thetic H4-(86–100) and [Thr89]H4-(86–100) or rat histogranin, inhibited
lipopolysaccharide-induced prostaglandin E
2
release from rat alveolar
macrophages. The synthetic peptides also inhibited the secretion of the

CXC chemokine interleukin-8 (GRO ⁄ CINC-1) in response to lipopolysac-
charide. The presence of H4-v.1 and histogranin mRNAs in tissues wherein
immune reactions take place and the inhibitory effects of their translation
products on prostaglandin E
2
and interkeukin-8 secretion by activated
alveolar macrophages suggest an anti-inflammatory function.
Abbreviations
AM, alveolar macrophage; AP, amplification primer; BAL, bronchoalveolar lavage; EST, expressed sequence tag; GSP, gene-specific primer;
HN, histogranin; IFN, interferon; IL, interleukin; LPS, lipopolysaccharide; NF-jB, nuclear factor kappa B; OGP, osteogenic growth peptide;
PGE
2
, prostaglandin E
2
; SP1, stimulating protein 1.
4360 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS
constitute a replacement pool of histones for nucleo-
somal maintenance throughout the cell cycle [4].
Recently, their expression was shown to regulate var-
ious processes that comprise heterochromatin ectopic
spread [5–7], DNA transcription (H2A.Z) [8–10], cen-
tromere formation (CENP-A) [11–13], X chromosome
inactivation (macroH2A) [14,15] and DNA repair
(H2AX) [16–19]. The observation that the translation
of histone mRNA variants follows the rules of typical
poly(A) track-containing mRNAs [20] suggests that
histone variants may also exert extranuclear functions.
In this regard, histones were reported to modulate
pituitary hormone secretions [21–24], pathogenic anti-
body production [25–27], microbial [28,29] and tumor-

al [30] cell growth, osteogenesis [31,32], pain [33–36]
and macrophage proinflammatory functions [37].
Histogranin (HN), a slightly modified C-terminal
histone H4 peptide homologous to histone H4-(86–
100), was first isolated in our laboratory from bovine
adrenal medulla [38]. The immunoreactive peptide was
detected in various rat tissues, including the pituitary,
adrenal glands, lungs, spleen, brain and plasma [39].
Synthetic HN was initially shown to block N-methyl-
d-aspartate-induced convulsions in mice [38]. More
recently, HN and related peptides were also shown to
display in vivo nonopioid analgesic effects and in vitro
anti-inflammatory activity [33–40]. Our initial search
to determine the structure of the HN gene was unsuc-
cessful but led to the discovery of the H4 mRNA vari-
ant H4-v.1 [41]. H4-v.1 was first isolated and
sequenced from a bovine adrenal medullary cDNA
phage library [41]. Bovine H4-v.1 was then shown to
be a polyadenylated mRNA coding for unmodified
whole histone H4. A similar mRNA variant was also
detected in the rat using a cDNA probe that recog-
nized part of the bovine H4-v.1 coding region,
although its sequence was not determined [42]. A close
correlation was then observed between the level of H4-
v.1 in various rat tissues and alveolar macrophages
(AMs) and the amounts of the histone H4 C-terminal
peptides, osteogenic growth peptide (OGP) [31] and
H4-(86–100), but not whole histone H4 protein or core
H4 mRNA [42]. This study suggested that the extra-
cellularly acting unmodified C-terminal histone H4

peptides OGP and H4-(86–100) may be translation
products of the alternative AUG start codon in H4-
v.1, but not core H4 mRNA. On the other hand, the
modified nature of the C-terminal histone H4 peptide
HN indicated that its synthesis might depend upon the
expression of another H4 mRNA variant akin to some
other types of histone variant, such as the H3 mRNA
variants that produce modified histone H3 proteins
[43,44].
As no report has indicated the structure of rat H4-
v.1 and HN mRNAs, we herein used rat genome data-
bases to search for the H4 variant candidates as well
as specific molecular approaches and in vitro assays to
assess their structure, expression and function. We also
verified whether the cell cycle regulatory region and
site II element, known to regulate the expression of H4
genes [45–47] or other specific elements, were present
upstream of the H4 mRNA variants. The results con-
firm the existence and illustrate the structures of H4-
v.1 and HN genes, two polyadenylated histone H4
mRNA variants with characteristics of the replication-
independent histone genes coding for unmodified
whole histone H4 and a modified C-terminal histone
H4 peptide, respectively. The particular localization
of the two genes in rat tissues, the identification of
upstream gene-specific regulatory elements and the
in vitro transcription ⁄ translation experiments with
gene-specific cDNA constructs indicate that the two
genes are independently expressed and produce C-ter-
minal H4 peptides with in vitro anti-inflammatory

activity.
Results
Gene BLAST search
A blast search of the rat TIGR database provided
an expressed sequence tag (EST) sequence (TC:
322388) that resembled that of the bovine H4-v.1
mRNA variant [41]. Like bovine H4-v.1, this EST
sequence contained an ORF that coded for unmodi-
fied histone H4 and a 3¢UTR that ended with an
AATAAA polyadenylation signal. Conversely, the
EST sequence was not complete at its 5¢ end, lack-
ing the 5¢UTR and the first ATG initiation codon
present in bovine H4-v.1. On the other hand, a
tblastn search of NCBI for histone H4 in the
rat genomic sequence provided another sequence
(NW_047492.1|Rn17_2014:1861737–1862016) that did
not code for whole histone H4, but a modified his-
tone H4 C-terminal peptide, [Thr89]H4-(84–102).
Since histone H4 is one of the most evolutionarily
conserved proteins [48], it was assumed that if a gene
with this modified H4 coding region was expressed, it
could be the gene encoding the modified C-terminal
H4 peptide HN [38], generating in this case
[Thr
89
]H4-(84–102) as an immediate precursor of rat
HN. Next, we sought to verify the expression of H4-
v.1 and HN mRNA transcripts in total mRNA prep-
arations from various rat tissues and isolated AMs,
and determine the complete structures of rat H4-v.1

and HN mRNAs.
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4361
Localization of H4-v.1 and HN mRNAs
Because H4-v.1 mRNA and immunoreactive HN had
already been detected within various rat tissues using
probes and antibodies that recognized bovine H4-v.1
mRNA and HN, respectively [39,42], initial tests were
performed to assess the level of expression of rat H4-
v.1 and HN mRNAs in total RNA preparations of
various rat tissues by the use of real-time PCR with
gene-specific primers (GSPs) designed from the blast
information. High levels of both HN and H4-v.1
mRNA transcripts were observed in the liver, adrenal
glands, thymus and bone marrow (Fig. 1A). However,
the HN mRNA transcript was more widely distri-
buted, being also abundant in endocrine, neuroendo-
crine and central nervous system tissues such as the
pituitaries, the spinal cord and the brain. Both
mRNAs were also detected in AMs, and their levels
were compared with that of core H4s (Fig. 1B). HN
mRNA was markedly increased by incubation of AMs
in the presence of interferon gamma (IFN-c) (8.97-
fold), whereas H4-v.1 was significantly stimulated by
both lipopolysaccharide (LPS) (2.67-fold) and IFN-c
(3.48-fold). In contrast, the level of H4s mRNA,
although 4.7 and 6.2 times higher than those of control
H4-v.1 and HN mRNAs, respectively, was not signifi-
cantly affected by incubation of AMs with LPS or
IFN-c.

Sequence determination of H4-v.1 and HN cDNAs
Determination of the length and sequences of H4-v.1
and HN mRNAs was accomplished by 3¢RACE and
5¢RACE experiments using a Marathon-Ready
TM
rat
spleen cDNA library. The 5¢RACE and 3 ¢RACE ampli-
cons of H4-v.1 and HN were designed to overlap one
another, resulting in complete cDNA structure amplifi-
cation. The 5¢RACE and 3¢RACE amplicons were inser-
ted into the TOPO cloning vector (Invitrogen) and
sequenced. Complete H4-v.1 and HN cDNAs (Gen-
Bank accession numbers: AY936209 and AY936210,
respectively) were compared with their respective
sequences within the rat genome. H4-v.1 and HN cDNA
sequences were considered to be accurate if three separ-
ate sets of sequenced 5¢RACE and 3¢RACE amplicon
clones and the corresponding genome sequences in the
NCBI genome database could be matched. The H4-v.1
cDNA transcript contained a short 5¢UTR (19 bp), an
ORF corresponding to unmodified whole histone H4, a
3147 bp missing intron, and a relatively long 3¢UTR
(965 bp) ending with a polyadenylation signal (AAT
AAA) and an auxiliary mRNA-processing facilitator-
like element (AAAGAT) (Fig. 2A; AY936209). On the
other hand, the HN cDNA transcript contained a
relatively long 5¢UTR (253 bp), a short ORF coding
for MDVVYTLKRQGRTLYGFGG as an immediate
Fig. 1. Relative abundance of H4-v.1 and HN mRNA transcripts in
various rat tissues (A) and isolated AMs (B). (A) Total RNA was

extracted from rat tissues (three pools of two animals) and the
amounts of H4-v.1 and HN mRNAs were determined by real-time
PCR with gene-specific primers as described in Experimental proce-
dures. The relative abundance of the cDNA amplicons was meas-
ured in comparison with GAPDH, using the lung as a comparative
tissue for calculation in the equation: mRNA ¼ 2 ) [(Ct mRNA test
tissue ) Ct GAPDH test tissue) ) (Ct mRNA comparative tis-
sue ) Ct GAPDH comparative tissue)]. In (B), freshly isolated AMs
(three preparations from two animals each) were incubated for
24 h in the absence or presence of LPS (1 lgÆmL
)1
) or IFN-c
(100 UÆmL
)1
) prior to total RNA extraction and measurement of H4-
v.1 and HN mRNA transcripts in comparison with core H4s. Results
represent the mean ± SEM of three duplicated sets of experi-
ments. Statistical significance was determined using one-way ana-
lysis of variance followed by a Bonferonni comparison test. (A)
*P 6 0.05 as compared with heart H4-v.1 cDNA amplicon;
§
P 6 0.05 as compared with heart HH cDNA amplicon;
†
P 6 0.05
as compared with H4-v.1 cDNA amplicon in the same tissue. (B)
§
P 6 0.05 as compared with control H4-v.1 mRNA; *P 6 0.05 as
compared with control HN mRNA.
Histone H4 mRNA variants R. Poirier et al.
4362 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS

precursor of rat HN (VVYTLKRQGRTLYGF, the
portion of the peptide homologous to bovine HN [38])
and a relatively long 3¢UTR (273 bp) ending with a non-
canonical polyadenylation signal (TATAAA) and an
auxiliary mRNA-processing facilitator-like element
(AAAGAT) (Fig. 2B; AY936209).
Comparisons of H4-v.1 and HN cDNAs with core
histone H4 cDNAs
A comparison of H4-v.1 and HN cDNAs with core
germinal (H4g) and somatic (H4s) histone H4 genes
showed 80–92% homology in a region corresponding
to the ORF of core histone H4 genes (Fig. 3). The
nucleotide substitutions in H4-v.1 did not affect the
highly conserved amino acid structure of the whole
histone H4 protein or the alternative initiation transla-
tion product H4-(84–102) (Fig. 2A). On the other
hand, the HN cDNA shared a high degree of homol-
ogy with the histone H4 coding region (Fig. 3), but
lacked the first ATG codon necessary to translate the
whole histone H4 protein and contained a modified
codon (ACT coding for Thr instead of Ala) in the
alternative ORF sequence to code for [Thr
89
]H4-(84–
102) (Fig. 2B).
Comparison of the structures of the proximal
3¢UTR of HN cDNA with those of H4g and H4s
revealed a GC-rich stem–loop structure followed clo-
sely by a purine-rich region similar to the histone con-
sensus palindromic and purine-rich sequences of H4g

and H4s (Table 1). However, the stem–loop structure
found in HN was considered to be noncanonical, being
distinct from that found in other histone genes [48].
No comparable stem–loop structure was found in the
proximal 3¢UTR of H4-v.1. Interestingly, the 3¢UTR
of both H4-v.1 and HN cDNAs contained an ATTT
repeat element (14 and 4 repeats, respectively;
AY936209 and AY936210) that is known to play a
post-transcriptional role in the synthesis of cytokines
in lymphoid cells [49]. Finally, the distal 3¢UTR of
H4-v.1 and HN cDNAs, but not H4g or H4s, con-
tained a polyadenylation signal characteristic of his-
tone cDNA variants (Table 1).
Comparison of upstream genome sequences of
H4-v.1 and HN genes with those of H4s and H4g
indicated a region similar to the site II cell cycle regula-
tory domain of the replication-dependent histone H4
genes (Table 1) comprising a TATA box-like motif, a
histone H4-specific GGTCCG element, and a motif
homologous to the human histone H4 gene cell cycle
Fig. 2. Schematic representation of H4-v.1
(A) and HN (B) genes in the rat genome.
Rat cDNA structures were determined by
combined 5¢RACE and 3¢RACE with a Mara-
thon-Ready rat spleen cDNA library as des-
cribed in Experimental procedures. The
complete sequences of H4-v.1 and HN
cDNAs were submitted to the NIH GenBank
and have been given the accession
numbers AY936209 and AY936210,

respectively. The ORFs of the H4-v.1 and
HN genes encode complete histone H4
protein and the H4 C-terminal peptide
MDVVYTLKRQGRTLYGFGG, respectively
(Fig. 3). The 5¢UTR, ORF, 3¢UTR, stem–loop
sequence and polyadenylation signals are
located as indicated in the schemes. Both
genes are preceded by the gene-specific
promoters as described in Table 1 and as
illustrated. The H4-v.1 gene contains a
3.5 kb intron and does not contain the
canonical histone stem–loop sequence
30 nucleotides downstream of the ORF.
The HN gene does not contain an intron and
its stem–loop sequence downstream of the
ORF is distinct from that of histone H4
genes [48].
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4363
control motif (5¢-CTTTCGGTTTT-3¢) [46]. Other
potential transcriptional regulatory binding motifs close
to the site II regulatory domain of the H4-v.1 gene
included the mitogen-activated protein (MAP) kinase
transcription factor ELK-1 (
)44
taagacGGAActgcttt
)28
),
a MAP kinase substrate transcription factor involved
in cell growth [50] and the cyclic AMP response

elements CREB (
)88
tccgccTGACgctccctgttt
)69
) and
CREB-P1 (
)152
ttgctcttACATgaactgaaa
)132
), two tran-
scription factors involved in the regulation of metabolic
and neuronal activities [51] (Fig. 2). Sequences
upstream of the HN gene comprised the Elk-1 motif
(
)33
gtacacGGAAgttttag
)17
) [52], the GC box motif
(
)121
aaatgaGGCGgagcaa
)107
), a specific stimulating
protein 1 (SP1)-binding site that can modulate the
action of the nuclear factor kappa B (NF-jB) DNA
site [52] and the NF-jB motif (
)181
tgGGGAaaacccc
ag
)167

), a transcription factor involved in the matur-
ation of immune cells and inflammation processes [53]
(Fig. 2). None of these sequences found upstream of
either the H4-v.1 gene or HN gene was observed
upstream of the replication-dependent H4g (NCBI
#m27433) and H4s (NCBI #x13554) genes.
Transcription
⁄
translation in an in vitro wheat
germ lysate system
The presence in H4-v.1 cDNA of both initial and
alternative ATG codons should allow its translation
into both whole histone H4 and the C-terminal peptide
Fig. 3. Comparison between the structures
of the ORF of H4 somatic (H4s), H4 germi-
nal (H4g) and H4-v.1 cDNAs and corres-
ponding 5¢UTR and ORF in HN cDNA.
Analyses were done with the
BLAST 2
sequences of NCBI. Start and stop codons
are indicated by bold letters. H4s (accession
number x13554) is 84% and 80% homolog-
ous with H4-v.1 and HN, respectively, and
84% homologous with H4g (accession num-
ber m27433). H4g is 92% and 88% homol-
ogous with H4-v.1 and HN, respectively,
whereas H4-v.1 is 89% homologous with
HN. H4s, H4g and H4-v.1 cDNA sequences
code for unmodified whole histone H4. HN
cDNA does not contain the initial ATG

codon found in H4s, H4g and H4-v.1
cDNAs, thus giving rise to a translation
product (pro-HN) of 19 amino acids corres-
ponding to the alternative translation prod-
uct in the other genes with a modification at
position 89 (T instead of A). The initial M
(M
0
) in the translated H4 protein is cleaved
to give rise to a protein of 102 amino acids
[48].
Histone H4 mRNA variants R. Poirier et al.
4364 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS
H4-(84–102) (Fig. 3) [41]. The presence in HN cDNA
of only the alternative H4 ATG codon should allow
its translation only into [Thr89]H4-(84–102) as an
immediate precursor of rat HN. Experiments per-
formed using pCMVTnT vector constructs with the
in vitro wheat germ lysate-coupled transcription ⁄ trans-
lation system (TnT, Promega) indicated that the
H4-v.1 construct synthesizes two radiolabeled (Met35)
protein ⁄ peptide products, one comigrating on SDS gel
electrophoresis with whole histone H4 (11.4 kDa), and
the other comigrating with synthetic H4-(84–102)
(approximately 2 kDa) (Fig. 4A). On the other hand,
the HN construct produced only one radiolabeled
compound, which migrated within the expected
molecular mass range of [Thr89]H4-(84–102) (approxi-
mately 2 kDa) (Fig. 4A). The empty pCMVTnT vector
did not produce any radiolabeled protein ⁄ peptide

product, whereas the Promega luciferase control plas-
mid showed multiple radiolabeled products, the major
band corresponding to luciferase (60 kDa) (Fig. 4A).
Inhibition of LPS-induced prostaglandin E
2
(PGE
2
)
release from cultured AMs
Prostaglandins are known to play an important role in
inflammation and pain. Rat AMs stimulated with LPS
(1 lgÆmL
)1
), the archetypal bacterial antigen, produced
significant amounts of PGE
2
(171.3 ± 23 pgÆmL
)1
compared to 76 ± 8.9 pgÆmL
)1
for unstimulated cells).
As shown in Fig. 4B, LPS-stimulated release of PGE
2
from primary cultures of rat AMs was reduced to
49.8% and 46.3% of the control value in the presence
of 10
)8
m synthetic H4-(86–100) and [Thr89]H4-(86–
100) (rat HN), respectively. Incubation of AMs in the
presence of the transcription ⁄ translation HN-pCMV-

TnT and H4-v.1-pCMVTnT products (20 lL) also
reduced LPS-evoked release of PGE
2
to 54.5% and
49.4% of the control value, respectively (Fig. 4B). In
contrast, the transcription ⁄ translation product (20 lL)
of the empty pCMVTnT plasmid had no significant
effect on PGE
2
release.
Inhibition of LPS-induced rat interleukin-8 (IL-8)
(GRO/CINC-1)
The CXC chemokine IL-8 is a potent neutrophil chem-
otactic and activating agent. As IL-8 and its rat ana-
log, GRO ⁄ CINC-1, are reported to be produced by
human and rat AMs [68], we next investigated whether
the synthetic translation products of H4-v.1 and HN
mRNAs also modulated the secretion of this inflam-
matory cytokine. Rat AMs incubated with LPS
(1 lgÆmL
)1
) for 4 h released into the culture medium
significant amounts of GRO ⁄ CINC-1 (4023 ± 325
pgÆmL
)1
), whereas GRO⁄ CINC-1 was undetectable in
culture supernatants of unstimulated AMs. Incubation
of AMs with 10
)8
m H4-(86–100) and [Thr89]H4-(86–

100) significantly decreased LPS-induced GRO ⁄ CINC-
1 secretion (to 58.3% and 62.5% of the control value,
respectively) (Fig. 5).
AM survival following treatment with H4-v.1 and
HN products
To verify whether inhibition of LPS-induced PGE
2
and GRO ⁄ CINC-1 by H4-v.1 and HN gene products
Table 1. Analysis of 3¢UTR palindromic and purine-rich sequences
a
(A) and upstream histone H4-like site II regulatory domain
b
(B) in rat H4g
(m27433), H4s (x13554), H4-v.1 (AY936209) and HN (AY936210). Sequence homologies were determined as indicated in Experimental pro-
cedures.
Gene Sequence characteristics Poly(A) signal
c
Cap site
A
H4g
35
GGCCCTTTTCAGGGCCACCCACGAACTCATTCAAAGGG
72
None
H4s
56
GGCCCTTTTCAGGGCCCCCAAACTATCCAAAAGGAG
91
None
H4-v.1 None AATAAA

HN
55
CCACACCATCAGGCTGTGGATACATAGATAAGGCAACATGG
95
TATAAA
B
H4g
–66
CGCCTGTGGTCTTCAATCAGGTCCGCAGAAGGTCTATTTAAA
)25
*CTTTT
H4s
–63
TCCCTGCTGTTTTCAAACAGGTCCGCTCCCAGGAAATATAAGC
)21
*CTGTA
H4-v.1
)80
CGCTCCCTGTTTTCACTCCGGTCCGCAAGTTCCATATAAGA
)40
*GAGCA
HN
)72
CACTTGAAGTTCTCAACCAGGTCCGATAAGAGTGTATACTT
-34
*TGGAA
a
Underlined sequences represent consensus stem–loop sequences for histone H4, the underlined bold letters indicate a noncanonical
stem–loop structure, and bold italic letters indicate purine-rich sequences. Superscript positive numbers indicate the position downstream of
the stop codon. TAAA repeat elements [49] are also present in H4-v.1 and HN 3¢UTRs.

b
TATA-box sequences are indicated in bold letters,
histone H4 subtype-specific GGTCCG elements are underlined and in bold letters, and interferon regulatory factor recognition motifs are
underlined. Superscript negative numbers indicate the position upstream of the cap site (*).
c
The polyadenylation signals were preceded by
an auxiliary mRNA-processing facilitator-like element (AAAGAT).
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4365
is related to possible cytotoxic effects on rat AMs, the
percentage of living cells was determined on the basis
of the cytoplasmic esterase conversion of calcein-AM
to the green fluorescent product calcein by living cells.
Exposure to 10
)8
m H4-(86–100) or [Thr89]-H4-(86–
100) or to 20 lL of the transcription ⁄ translation prod-
ucts of either H4-v.1pCMVTnT, HNpCMVTnT or
control pCMVTnT for up to 24 h had no effect on the
percentage of viable green fluorescent cells, indicating
no loss of AM membrane integrity (Fig. 6).
A
B
Fig. 4. Electrophoretic gel separation of coupled transcription ⁄ trans-
lation (TnT) products with H4-v.1 and HN cDNA constructs (A) and
inhibition of LPS-induced PGE
2
release (B). (A) Biosynthesis experi-
ments with Promega luciferase control DNA plasmid, HN-pCMV-
TnT, H4-v.1-pCMVTnT and emptied pCMVTnT plasmids were

performed, and the radioactive products were separated by gel
electrophoresis as described in Experimental procedures. Arrows
show the molecular mass of [
35
S]Met-labeled protein and peptide
products as determined by comparison with the electrophoretic
pattern of a Mark 12 molecular weight ladder. (B) Biosynthetic
products (20 lL of reaction samples) obtained in parallel experi-
ments with unlabeled Met were incubated with primary cultures of
rat AMs as described in Experimental procedures, and their ability
to inhibit LPS-evoked PGE
2
secretion was compared with those
of synthetic H4-(86–100) and [Thr89]H4-(86–100) at 10
)8
M.
*P 6 0.05 is considered significant as compared with control.
Fig. 5. Inhibition of LPS-induced chemokine secretion. (A) Rat AMs
were stimulated for 4 h with LPS (1 lgÆmL
)1
) in the presence and
absence of synthetic [Thr89] H4-(86–100)) and H4-(86–100) at
10
)8
M as described in Experimental procedures, and secretion of
IL-8 (GRO ⁄ CINC-1) was measured in culture supernatants. Results
are means ± SEM of three experiments (*significantly different
from control at P 6 0.05).
Fig. 6. The percentage of live ⁄ dead cells following treatment of
AMs with TnT products of H4-v.1 and HN cDNA constructs (20 lL

reaction samples) and corresponding synthetic peptide products
(10
)8
M) was determined as described in Experimental procedures
by assessing the number of living cells, which take up calcein and
convert it to F-calcein (green fluorescence), and dead cells, which
take up ethidium bromide homodimer (red fluorescence).
Histone H4 mRNA variants R. Poirier et al.
4366 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS
Discussion
Each class of histones contains its gene variants. Bovine
H4-v.1, the first reported example of a histone H4
mRNA variant in mammals [41], contains the palin-
dromic and purine-rich sequences typical of cell cycle-
dependent histone mRNAs with a 1.3 kb downstream
extension that terminates with a polyadenylated track
characteristically found in cell cycle-independent his-
tone mRNAs. The present results indicate that rat H4-
v.1 cDNA differs somewhat from bovine H4-v.1 cDNA
by the absence of the consensus palindromic and pur-
ine-rich sequences and the excision of an intron, two
characteristics of the Drosophila replication-independ-
ent histone H4 cDNA [54]. Yet, like bovine H4-v.1 and
all other histone cDNA variants, rat H4-v.1 cDNA
contains a 3¢UTR extension that terminates with a
polyadenylation signal (AATAAA). On the other hand,
HN cDNA, the second polyadenylated histone H4-rela-
ted cDNA observed in rat, contains noncanonical pal-
indromic and purine-rich sequences in its proximal
3¢UTR and a noncanonical TATAAA polyadenylation

signal [55] in its distal 3¢UTR (Table 1; Fig. 2). Inter-
estingly, whereas the presence or absence of intronic
and palindromic sequences varies among subtypes of
replication-independent histone mRNAs [56], the pres-
ence of a polyadenylation signal is typical of all replica-
tion-independent histone mRNAs [2], suggesting that
the expression of both H4-v.1 and HN genes may be
independent of the cell cycle.
Even though the promoter regions of core histone
H4 genes are evolutionarily divergent among verteb-
rate species [47], they all contain an upstream region
named site II, consisting of the cell cycle control ele-
ment, H4 gene subtype element, and TATA box
[45,46]. The site II region is considered to play a key
role in the cell cycle dependency of expression [46,57].
On the other hand, histone gene variants are not
expected to be regulated by the same factors that
regulate the expression of core histone genes, because
variant transcripts accumulate preferentially in nondi-
viding and terminally differentiated cells [3]. Analysis
of genomic sequences upstream of the H4-v.1 and
HN genes indicated that both sequences contain a
region similar to the histone H4 site II cell cycle regu-
latory domain (Table 1) [46]. This finding suggests
that this region may not be the sole determinant for
cell cycle dependency of histone H4 gene expression.
Further analyses of the upstream genome region
proximal of the H4-v.1 and HN genes indicated the
presence of specific transcription regulator-binding
sequences that were not present upstream of either

somatic or germinal core histone H4 genes (Fig. 2).
Among these specific regulatory factor-binding motifs,
the CREB and NF-jB sites may play an important
role in the tissue-specific expression of H4-v.1 and
HN mRNAs, respectively. In this regard, marked
release of immunoreactive HN from perfused bovine
adrenal glands has been observed when the glands are
stimulated with carbamylcholine [39]. As carbachol
was shown to be a potent activator of NF-jB in iso-
lated canine gastric parietal cells [58], we may hypo-
thesize that the NF-jB-binding element located 167
nucleotides upstream of the rat HN cDNA cap site
has a role to play in the production and release of
HN. Interestingly, in contrast with granule prestored
enkephalins and catecholamines, which were suc-
cinctly and rapidly released after carbamylcholine sti-
mulation, the release of HN started only 30 min after
the beginning of the stimulation and lasted for more
than 1 h, thus allowing sufficient time for transcrip-
tion factor activation, HN mRNA formation and
translation [39].
Post-transcriptional control of cell cycle-dependent
histone mRNAs is monitored by the stem–loop struc-
ture present within their 3¢UTRs [20]. H4-v.1 mRNA
does not contain a stem–loop sequence, whereas HN
possesses a stem–loop sequence that differs from the
histone stem–loop consensus sequence observed in H4g
or H4s (Table 1). However, as both the H4-v.1 and
HN genes are polyadenylated, their post-transcrip-
tional maturation and processing are expected to be

regulated like those of polyadenylated mRNAs [47].
Interestingly, the 3¢UTRs in H4-v.1 and HN mRNAs
also contain TAAA repeat elements (14 and 4 repeats,
respectively) that are known to be involved in the
post-transcriptional regulation of IL-2 in lymphoid
cells [49]. The presence of this repeat element in H4-
v.1 and HN mRNAs may explain the particularly high
abundance of these genes in lymphoid tissues (Fig. 1)
along with OGP and HN [39,42]. In this regard, H4-
v.1 and HN cDNA transcripts, as well as C-terminal
H4 and HN related-peptides, were shown to be present
in nonreplicating and terminally differentiated rat
AMs (Fig. 1B) [42]. Synthesis, storage, processing and
release of C-terminal histone H4 and related peptides
were suggested to follow the same route as cytokines
[42], which are stored in microvesicles and processed
and released via a lysosomal pathway [59]. The distinct
induction of the expression of the H4-v.1 and HN
genes by the immunostimulants LPS and IFN-c in
AMs suggests that the two genes may have distinct
and ⁄ or complementary functions in response to immu-
nostimulants, whereas the noninduction of core H4s
by the same agents concurs with its known cell replica-
tion dependency (Fig. 1B).
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4367
Examination of the ORF of rat H4-v.1, H4s and
H4g cDNAs revealed the presence of two ATG initi-
ation codons that allow their translation into whole
histone H4 and the alternative C-terminal fragment

H4-(84–102) (Fig. 3). Interestingly, the 5¢UTR of rat
H4.v-1 cDNA (19 nucleotides; Fig. 2) was much shor-
ter than those of H4s and H4g cDNAs (> 100 nucleo-
tides). The short 5¢UTR in rat H4-v.1 mRNA may
enhance leaky ribosomal scanning, as the first ATG
codon could be too close to the 5¢ end to be recog-
nized efficiently [60]. Such a possibility is supported by
a previous observation indicating that LPS stimulation
of the expression of H4-v.1 mRNA in rat AMs is
accompanied by an increase in the cell contents of the
short peptides OGP and H4-(86–100), but not of
whole histone H4 or total H4 mRNA [42]. The in vitro
biosynthesis experiments with the H4-v.1 cDNA con-
struct also indicate that at least part of the first ATG
codon may be skipped to produce the C-terminal pep-
tide H4-(84–102) (Fig. 4A). The relatively high level of
production of complete histone H4 as compared with
H4-(84–102) by the H4-v.1 cDNA construct may be
due to the elongation of the 5¢UTR in the cDNA con-
struct by 5¢RACE Marathon adapter and 5¢ b-globin
leader sequences in the pCMVTnT vector. On the
other hand, Bab et al. [61] used a histone H4-CAT
reporter fused cDNA vector engineered to produce a
polyadenylated histone H4 mRNA. The recombinant
construct produced different ratios of whole histone
H4-CAT and H4-(84–102)-CAT, depending upon the
cell type in which the vector was expressed. Further
investigation is required to clarify whether, in the
in vivo situation, rat H4-v.1 synthesizes both whole his-
tone H4 and H4-(84–102) or mainly H4-(84–102), as

suggested by our previous experiments with LPS-sti-
mulated rat AMs [42].
Use of the coupled transcription ⁄ translation system
with the HN pCMVTnT construct produced a single
radiolabeled compound with a molecular mass corres-
ponding to that of the expected translation product
[Thr89]H4-(84–102). The HN cDNA ORF has the
necessary translational start and stop codons to pro-
duce this modified H4 C-terminal peptide, but not the
first start codon necessary to produce total histone H4
(Figs 2B, 3). The ability of HN mRNA to translate a
small peptide allows the messenger to be considered as
a minigene. Minigenes are well recognized for their
role in the regulation of gene expression [62–65]. With-
out including the small interfering RNAs (siRNAs),
which affect gene expression but cannot be considered
as true genes, due to their lack of an ORF, there exist
at least two types of minigene that can affect transcrip-
tional or post-transcriptional gene expressions. For
instance, Tenson et al. [65] reported that the transla-
tion of a minigene with an ORF coding for a peptide
of eight amino acids or fewer inhibits protein synthesis
by a phenomenon of ‘dropping off’ of the peptide
from ribosomes under a form that is still attached to
the tRNA corresponding to its C-terminal amino acid,
thus creating a shortage of this tRNA for translation.
Other minigenes selectively inhibit the translation of
the functional downstream cistron [63,64]. As the bio-
synthetic products of H4-v.1 and HN cDNA constructs
display anti-inflammatory effects in isolated AMs com-

parable to those of the synthetic H4 C-terminal pep-
tides H4-(86–100) and [Thr89]H4-(86–100) (Figs 4B,
5), the question of whether the expression of these
H4 mRNA variants can affect some transcriptional
or post-transcriptional gene regulatory mechanisms, in
addition to producing the extracellularly acting anti-
inflammatory peptides, remains to be investigated.
In conclusion, a growing body of evidence indicates
that various histones or histone-derived products act
in an extranuclear and ⁄ or extracellular manner. Such
examples include the histones H2A and H2B, which
display growth hormone- and prolactin-releasing
activity [20–23], and the antimicrobial histone-H2A
peptide buforin I, produced by the action of pepsin
within gastric gland cells of the vertebrate stomach
[28,29]. In addition, the histone H4-derived peptides
HN and OGP have been shown to display antinoci-
ceptive and osteogenic activities, respectively [32–37];
whereas synthetic C-terminal histone H4 peptides
were reported to serve as potent epitopes for antigen-
presenting cells in in vitro models of T-lymphocyte
activation [25]. In the present study, we further dem-
onstrate that the C-terminal histone H4-related pep-
tides transcribed from H4-v.1 and HN genes
significantly inhibit the LPS-evoked release of PGE
2
and IL-8 (GRO ⁄ CINC-1), two potent proinflammato-
ry mediators produced by activated macrophages. The
particular interest in the effects of H4-(86–100) and
[Thr89]H4-(86–100) (or rat HN) on AM GRO ⁄ CINC-

1 secretion derives from the knowledge that IL-8 pro-
duction represents one of the primary responses of
macrophages to inflammation, and that such an effect
lasts as long as inflammation persists [69]. IL-8 not
only serves to attract inflammatory cells to a site of
inflammation and keep them there, but also stimulates
neutrophils to a higher activation state. Its release
from macrophages is evoked by LPS and cytokines
such as IL-1, and its high plasma level is associated
with various human inflammatory diseases [68,69].
Therefore, the presence of the H4-v.1 and HN genes
in tissues (thymus, bone marrow) wherein immune
reactions are known to take place and the potent
Histone H4 mRNA variants R. Poirier et al.
4368 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS
inhibitory effects of their translation products on
macrophage proinflammatory functions suggest that
histone H4 mRNA variants may have an important
role in the physiology and ⁄ or physiopathology of
inflammation.
Experimental procedures
Computer-assisted analysis of genomic sequence
The National Center for Biotechnology Information
(NCBI; and The
Institute for Genomic Research (TIgr; />tdb/tgi/) blast programs were used to gather information
regarding possible H4-related sequences carrying a down-
stream polyadenylation signal or coding for modified H4
proteins. GSPs were made with the aid of the primer3:
www primer tool ( />primer3_). Computer-assisted analysis of
potential upstream transcription factor-binding sites of the

H4-v.1 and HN genes was done using the matinspector
program ( />main.pl). Comparison of upstream sequences with homol-
ogy to the site II cell cycle regulatory domain of vertebrate
H4 genes was done using the lalign program (http://
www2.igh.cnrs.fr/bin/lalign-guess.cgi). Analysis of potential
palindromic sequences within the 3¢UTRs of the mRNAs
was done with the aid of the mfold program (http://
biotools.idtdna.com/Analyzer/).
Real-time RT-PCR
Reverse transcription was performed on 250 ng of rat
(Sprague-Dawley) tissue total RNA preparations (RNeasy
Mini Kit for total RNA isolation; Qiagen Mississauga,
Canada), pretreated with amplification grade DNase 1
(Invitrogen, Burlington, Canada), using database-deduced
gene-specific H4-v.1 (5¢-ccagggttttgtttgtttttg-3¢), HN (5¢-ca
cagcctgatggtgtggattggtg-3¢) and GAPDH (5¢-aggtcaat
gaaggggtcgttg-3¢) antisense primers and 4 U of omniscript
reverse transcriptase (Qiagen) (where U is defined as
enzyme activity which incorporates 1 nmol TTP into acid-
insoluble products in 10 min at 37 °C with poly A template
RNA and oligo-dT
12–18
primer). Real-time PCR was per-
formed using a standard Quantitect
TM
SYBR
R
Green PCR
kit (Qiagen) protocol on an Applied Biosystems (Foster
City, CA) 7900HT Sequence Detection System. PCR

amplifications (40 cycles) were performed using designed
rat H4-v.1 (sense, 5¢-ggcggctaagaaacaaagtg-3¢; antisense,
5¢-gaaaagttgggtggaagcaa-3¢) or rat HN (sense, 5¢-gccat
ggatgtggtctatact-3¢; antisense, 5¢-gccgaagccatagagagtg-3¢)
primers and the QuantiTect SYBR Green PCR Master Mix
(Qiagen). Validation was done with GAPDH using rat-spe-
cific GAPDH (sense, 5¢-aatggtgaaggtcggtgtgaac-3¢; anti-
sense, 5¢-aggtcaatgaaggggtcgttg-3¢) primers. The relative
quantification of mRNA transcripts was carried out by the
comparative Ct (cycle threshold) method, the theoretical
basis of which has previously been described in detail [66].
Amplicons were cloned into the pCR 4-TOPO vector 2.0
using the TOPO TA cloning kit for sequencing (Invitro-
gen), transformed, plated as outlined within Invitrogen’s
TOPO TA kit manual, and sequenced with a DNA seq-
uencer (AIB automatic sequencer; Biotechnology Research
Institute, BMI Department, University of Ottawa).
5¢RACE and 3¢RACE of rat H4-v.1 and HN mRNAs
in a rat spleen cDNA library
Full-length rat (Sprague-Dawley) H4-v.1 and HN cDNAs
were obtained using 0.5 ng of a Marathon-Ready
TM
spleen
cDNA library (BD Biosciences Clontech, Paolo Alto, CA)
by two successive rounds of PCR with outside and nested
gene-specific H4-v.1 and HN primers and the adapter
sequence-specific amplification primers (APs) supplied with
the Marathon-Ready spleen cDNA kit (AP1 and nested
AP2 primers). The initial H4-v.1 5¢RACE and 3¢RACE
reaction round used an H4-v.1 5¢-GSP (5¢-H4-v.1 GSP1:

5¢-tatagacatgcctgtagtatctgaacc-3¢) coupled with the adapter
primer AP1 (5¢-ccatcctaatacgactcactatagggc-3¢), and an H4-
v.1 3¢-GSP (3¢-H4-v.1 GSP1: 5¢-ctacacggagcacgccaag-3¢)
coupled with AP1. The initial HN 5¢RACE and 3¢RACE
reaction round used an HN 5¢-GSP (5¢-HN GSP1: 5 ¢-aga
ggtcctgagttcaattgct-3¢) coupled with AP1, and an HN 3¢-
GSP (3¢-HN GSP1: 5¢-ctaagcgcccaccgcaaagtcttg-3¢) coupled
with AP1. First-round RACE PCR reactions included
2.5 U (where U is defined as enzyme activity which incor-
porates 10 nmol dNTPs into acid-insoluble amplicon in
30 min at 72 °C) of pfuUltra Hotstart DNA polymerase
(Stratagene, La Jolla, CA) and were performed in accord-
ance with Stratagene’s PCR protocol, using 30 cycles of
amplification. Nested 5¢-H4-v.1 or 3¢-H4-v.1 RACE PCR
reactions were conducted using a 1 : 100 dilution of the
first PCR reactions with either the H4-v.1 5¢-nested GSP
(5¢-H4-v.1 GSP2: 5¢-ccagggttttgtttgtttttg-3¢) coupled with
AP2 (5¢-actcactatagggctcgagcggc-3¢), or the H4-v.1 3¢-nested
GSP (3¢-H4-v.1 GSP2: 5¢-ccaagactaataaaataaacctgaagg-3¢)
coupled with AP2. Nested 5¢ and 3¢ HN RACE reactions
were conducted as above, with an HN 5¢-nested GSP (5¢-
HN GSP2: 5¢-tggcgcttgagagtatagacc-3¢
) coupled with AP2,
and an HN 3¢-nested GSP (3¢-HN GSP2: 5¢-ggatgtggtcta-
tactctcaagc-3¢) coupled with AP2. The second-round nested
RACE PCR reaction included 2.5 U of HotstarTaq DNA
polymerase (Qiagen), and was performed in accordance
with the manufacturer’s PCR protocol, with 25 cycles of
amplification. Amplicons were cloned into the pCR 4-
TOPO vector 2.0 using the TOPO TA cloning kit for

sequencing (Invitrogen), transformed and plated as outlined
in Invitrogen’s TOPO TA kit manual, and sequenced.
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4369
Insertion of H4-v.1 and HN into pCMvTnT vector
H4-v.1 and HN amplicons containing the Marathon adap-
ter sequence and their respective 5¢UTR segments, ORFs
and a small amount of their respective 3¢UTRs were cre-
ated following the second-round nested RACE PCR
method as described above, including either the 5¢-H4-v.1
GSP2 (5¢-ccagggttttgtttgtttttg-3¢)or5¢-HN GSP2 (5¢-tat
gtatccacagcctgatggtg-3¢). The H4-v.1 or HN amplicons were
further cloned into the pCR 4-TOPO vector 2.0 and trans-
formed as described above. Six micrograms of the HN or
H4-v.1 vectors were digested with EcoR1 (Invitrogen) and
run on a 1.5% agarose gel, and the H4-v.1 or HN seg-
ments, including EcoR1 arms, were isolated using a gel
extraction kit (Qiagen). The H4-v.1-EcoR1 and HN-EcoR1
segments were ligated within the multiple cloning region of
a pCMVTnT vector (Promega, Madison, WI), which was
predigested with EcoR1 (Invitrogen) and dephosphorylated
with shrimp alkaline phosphatase (Roche, Laval, Quebec,
Canada). Ligation was performed with T4 DNA ligase
(Invitrogen) using a 3 : 1 to 5 : 1 ratio of insert to vector.
The pCMVTnT-H4-v.1 and pCMVTnT-HN vectors were
transformed into one-shot chemically competent TOP 10
Escherichia coli (Invitrogen) and plated as per the manufac-
turer’s instruction. Orientation and sequences of the inserts
were confirmed by PCR and sequencing using GSPs for
H4-v.1, HN and the pCMVTnT vector.

In vitro transcription
⁄
translation in the wheat
germ lysate system
In vitro biosynthesis using either H4-v.1-pCMVTnT or HN-
pCMVTnT vectors, positive luciferase control vector, and
empty pCMVTnT vector were performed with a TnT SP6
coupled transcription ⁄ translation wheat germ lysate system
(Promega), as per the manufacturer’s instructions, in the
presence of redivue-[
35
S]methionine (Met, 25 lCi; Amer-
sham Pharmacia, Baie D’urfe
´
, Quebec, Canada) or unlabe-
led Met and protease inhibitors (1 mm protease inhibitor
leupeptin; Sigma, Mississauga, Canada) in a final volume
of 50 lL, which was incubated for 45 min at 30 °C and
placed on ice to stop the reactions. Ten microliters of each
reaction was suspended in an equal amount of Novex
Tricine-SDS sample buffer (2·) (Invitrogen), heated to
85 °C for 2 min, and electophoresed on a Novex 10–20%
Tricine-SDS precast gel (Invitrogen) alongside the Low-
Range Rainbow Molecular Weight Markers (Amersham
Biosciences, Little Chalfont, UK). Gels were fixed in a solu-
tion containing 50% methanol, 10% acetic acid and 40%
H
2
O for 10 min, and radiolabeled translation products were
detected using a phosphorimaging screen exposed over

16 h. The migration positions of the radiolabeled bands
were compared to those of molecular weight markers. The
transcription ⁄ translation products of experiments in the
presence of the unlabeled Met were assayed in LPS-stimula-
ted AMs as described below.
Animals
Lung pathogen-free male Wistar rats weighing 225–250 g
were purchased from Harlan World (Indianapolis, IN).
These animals were shipped behind filter barriers and
housed in isolated temperature-controlled quarters under
pathogen-free conditions in an animal isolator unit (Johns
Scientific Inc., Toronto, Canada). They were given standard
laboratory chow and water ad libitum, and were used
within 2 weeks. Approval was obtained from the Animal
Care and Use Committee of the University of Ottawa for
all procedures.
Isolation of rat AMs and gene transcript
measurements
AMs were recovered from normal rats by bronchoalveolar
lavage (BAL) as described previously [67]. Briefly, the lungs
were lavaged with seven 7 mL aliquots of sterile NaCl ⁄ P
i
(pH 7.4; Wisent, St Bruno, Quebec, Canada), and BAL cells
were obtained by centrifugation at 200 g at 4 °C for 5 min
on an IEC centrifuge with a Centra-8R rotor. The cells were
resuspended in RPMI supplemented with 0.5% dialyzed fetal
bovine serum (Wisent), 0.005% gentamicin (Schering
Canada, Pointe Claire, Quebec, Canada) and 0.8% Hepes,
which will henceforth be referred to as tissue culture med-
ium. Cells were counted in a hemacytometer chamber, and

viability (98–100%) was determined by trypan blue exclu-
sion. Differential analysis of lavage cells made by cytocentri-
fuge smears (Shandon, Pittsburgh, PA; 2.5 · 10
4
cells) and
stained with Wright-Giemsa indicated that the BAL cell pop-
ulation was essentially composed of AMs (99%) in normal
rats. For measurement of H4-v.1 and HN gene transcripts,
AMs (1 · 10
6
cells) were incubated in 1 mL of tissue culture
medium for 20 h at 37 °C in a humidified 95% air ⁄ 5% CO
2
atmosphere alone or with LPS (1 lgÆmL
)1
; Sigma Chemical
Co., St Louis, MO) or IFN-c (100 ngÆmL
)1
; Biosource,
Camarillo, CA), and total RNA was extracted from the cells
with the RNeasy Mini Kit (Qiagen). The abundance of the
gene transcripts was determined by real-time PCR with
GSPs and GAPDH primers as described above for their
measurement in tissue extracts.
PGE
2
release from rat AMs
Alveolar AMs (1 · 10
6
) were incubated in 1 mL of tissue

culture medium for 20 h at 37 °C in a humidified 95%
air ⁄ 5% CO
2
atmosphere alone or with LPS (1 lgÆmL
)1
;
Sigma Chemical Co.) in the presence and absence of 20 lL
of the transcription ⁄ translation products or the indicated
synthetic compounds at 10
)8
m. The culture supernatants
Histone H4 mRNA variants R. Poirier et al.
4370 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS
were collected, centrifuged on an IEC centrifuge with Cen-
tra-8R rotor, and frozen at ) 80 °C. On the following day,
PGE
2
was determined in cell-free supernatants using a com-
petitive enzyme immunoassay system (Biotrak; Amersham
Biosciences, Little Chalfont, UK), according to the manu-
facturer’s instructions.
IL-8 (GRO
⁄
CINC-1) secretion from rat AMs
For the evaluation of the effects of synthetic HN- and H4-
related peptides on IL-8, the prototype of CXC chemokines,
AMs (0.2 · 10
6
) were cultured in 0.2 mL of tissue culture
medium for 4 h with and without LPS in the presence and

absence of various concentrations of H4- and HN-related
peptides as indicated. Release of rat IL-8, i.e. growth-related
oncogene ⁄ cytokine-induced neutrophil chemoattractant
(GRO ⁄ CINC-1), was measured in cell culture supernatants
using a solid-phase ELISA assay (Assay Designs Inc., Ann
Arbor, MI), according to the manufacturer’s instructions.
Assessment of cell viability
⁄
death
Cell viability ⁄ cytotoxicity was measured using the Live-
Dead assay (Molecular Probes, Eugene, Canada), which
determines intracellular esterase activity and plasma mem-
brane integrity. This assay employs calcein-AM, a polyani-
onic dye, which is retained within live cells and produces a
green fluorescence. It also employs the ethidium bromide
homodymer dye (red fluorescence), which can enter the cells
through damaged membranes and bind to nucleic acids but
is excluded by the intact plasma membrane of live cells.
Cells cultured in the presence or absence of HN- and H4-
derived synthetic peptides and pCMVTnT vector products
were stained with Live ⁄ Dead reagent (2 lm ethidium bro-
mide homodimer, 1 lm calcein-AM) and incubated at
37 °C for 30 min. Cells were then analyzed under fluores-
cence microscopy using a Zeiss (North York, Canada)
Axiovert S1100TV inverted microscope equipped with a
fluorescein longpass filter and a 32· objective. At least 1000
cells per sample were examined, and data are expressed as
percentages of living and dead cells.
Statistical analysis
Results are expressed as means ± SEM. Statistical signifi-

cance was determined using one-way analysis of variance
and Bonferroni test (P 6 0.05; instat; Graph Pad, San
Diego, CA).
Acknowledgements
We thank Dr Re
´
mi Aubin for his judicious advice in
the design and engineering of gene-specific cDNA
constructs for in vitro transcription ⁄ translation experi-
ments. This work was supported by the Canadian
Institutes of Health Research (CIHR).
References
1 Zhao J (2004) Coordination of DNA synthesis and his-
tone gene expression during normal cell cycle progres-
sion and after DNA damage. Cell Cycle 3, e112–e114.
2 Marzluff WF, Gongidi P, Woods KR, Jin J & Maltais
LJ (2002) The human and mouse replication-dependent
histone genes. Genomics 80, 487–497.
3 Schumperli D (1986) Cell-cycle regulation of histone
gene expression. Cell 45, 471–472.
4 Wu RS & Bonner WM (1981) Separation of basal his-
tone synthesis from S-phase histone synthesis in dividing
cells. Cell 27, 321–330.
5 Dryhurst D, Thambirajah AA & Ausio
´
J (2004) New
twists on H2A.Z: a histone variant with a controversial
structural and functional past. Biochem Cell Biol 82,
490–497.
6 Meneghini MD, Wu M & Madhani HD (2003) Con-

served histone variant H2A.Z protects euchromatin
from the ectopic spread of silent heterochromatin. Cell
112, 725–736.
7 Pusarla RH & Bhargava P (2005) Histones in functional
diversification core histone variants. FEBS J 272, 5149–
5168.
8 Adam M, Robert F, Larochelle M & Gauvreau L
(2001) H2A.Z is required for global chromatin integrity
and for recruitment of RNA polymerase II under speci-
fic conditions. Mol Cell Biol 21, 6270–6279.
9 Abbott DW, Ivanova VS, Wang X, Bonner WM &
Ausio
´
J (2001) Characterization of the stability and
folding of H2A.Z chromatin particles. J Biol Chem 276,
41945–41949.
10 Guillemette B, Bataille AR, Ge
´
vry1 N, Adam M,
Blanchette M, Robert F & Gaudreau L (2006) Variant
histone H2A.Z is globally localized to the promoters of
inactive yeast genes and regulates nucleosome position-
ing. PLoS Biol 3, 2100–2110.
11 Carroll CW, Aaron F, Straight AF (2006) Centromere
formation: from epigenetics to self-assembly. TRENDS
Cell Biol 16, 70–78.
12 Pidoux AL & Allshire RC (2005) The role of hetero-
chromatin in centromere function. Phil Trans R Soc B
360, 569–579.
13 Lam AL, Boivin CD, Bonney CF, Rudd MK & Sullivan

BA (2006) Human centromeric chromatin is a dynamic
chromosomal domain that can spread over noncentro-
meric DNA. Proc Natl Acad Sci USA 103, 4186–4191.
14 Abbott DW, Chadwick BP, Thambirajah AA & Ausio
´
J
(2005) Beyond the Xi. MacroH2A chromatin distribu-
tion and post-translational modification in an avian sys-
tem. J Biol Chem 280, 16437–16445.
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4371
15 Chow JC & Brown CJ (2003) Forming facultative hetero-
chromatin: silencing of an X chromosome in mammalian
females. CMLS Cell Mol Life Sci 60, 2586–2603.
16 Li A, Eirı
´
n-Lo
´
pez JM & Ausio
´
J (2005) H2AX: tailor-
ing histone H2A for chromatin dependent genomic
integrity. Biochem Cell Biol 83 , 505–515.
17 Lee MS, Edwards RA, Thede GL & Mark Glover GN
(2005) Structure of the BRCT repeat domain of MDC1
and its specificity for the free COOH terminal end of the
c-H2AX histone tail. J Biol Chem 280, 32053–32056.
18 McManus KJ & Hendzel MJ (2005) ATM-dependent
DNA damage-independent mitotic phosphorylation of
H2AX in normally growing mammalian cells. Mol Biol

Cell 16, 5013–5025.
19 Foster ER & Downs JA (2005) Histone H2A phosphor-
ylation in DNA double-strand break repair. FEBS J
272, 3231–3240.
20 Cheng GH, Nandi A, Clerk S & Skoultchi AI (1989)
Different 3¢-end processing produces two independently
regulated mRNAs from a single H1 histone gene. Proc
Natl Acad Sci USA 86, 7002–7006.
21 Brown OA, Sosa YE, Naumovich D, Herenu CB &
Goya RG (2003) Hypophysiotropic activity of histone
H3 in vitro. Peptides 24, 671–678.
22 Brown OA, Sosa YE, Castro MG & Goya RG (2000)
Studies on the prolactin-releasing mechanism of histones
H2A and H2B. Life Sci 66, 2081–2089.
23 Brown OA, Sosa YE & Goya RG (1997) Histones as
extracellular messengers: effects on growth hormone
secretion. Cell Biol Int 21, 787–792.
24 Badamchian M, Spangelo BL, Damavandy T, MacLeod
RM & Goldstein AL (1991) Complete amino acid
sequence analysis of a peptide isolated from the thymus
that enhances release of growth hormone and prolactin.
Endocrinology 128, 1580–1588.
25 Kaliyaperumal A, Michaels MA & Datta SK (2002)
Naturally processed chromatin peptides reveal a major
autoepitope that primes pathogenic T and B cells of
lupus. J Immunol 168, 2530–2537.
26 Datta SK (2003) Major peptide autoepitopes for nucleo-
some-centered T and B cell interaction in human and
murine lupus. Ann NY Acad Sci 987, 79–90.
27 Madaio MP (2000) Major peptide autoepitopes for

nucleosome-specific T cells of human lupus. Am J
Kidney Dis 35, 992–996.
28 Kim HS, Park CB, Kim MS & Kim SC (1996) cDNA
cloning and characterization of buforin I, an antimicro-
bial peptide: a cleavage product of histone H2A. Bio-
chem Biophys Res Commun 229, 381–387.
29 Kim HS, Yoon H, Minn I, Park CB, Lee WT, Zasloff
M & Kim SC (2000) Pepsin-mediated processing of the
cytoplasmic histone H2A to strong antimicrobial pep-
tide buforin 1. J Immunol 165, 3268–3274.
30 Class R, Lindman S, Fassbender C, Leinenbach HP,
Rawer S, Emrich JG, Brady LW & Zeppezauer M (1996)
Histone H1 suppresses tumor growth of leukemia cells in
vitro, ex vivo and in an animal model suggesting extracel-
lular functions of histones. Am J Clin Oncol 19, 522–531.
31 Bab I, Gazit D, Chorev M, Muhlrad A, Shteyer A,
Greenberg Z, Namdar M & Kahn A (1992) Histone
H4-related osteogenic growth peptide (OGP): a novel
circulating stimulator of osteoblastic activity. EMBO J
11, 1867–1873.
32 Gurevitch O, Slavin S, Muhlrad A, Shteyer A, Gazit D,
Chorev M, Vidson M, Namdar-Attar M, Berger E,
Bleiberg I et al. (1996) Osteogenic growth peptide
increases blood and bone marrow cellularity and enhan-
ces engraftment of bone marrow transplants in mice.
Blood 88, 4719–4724.
33 Ruan H, Prasad JA & Lemaire S (2000) Non-opioid
antinociceptive effects of supraspinal histogranin and
related peptides: possible involvement of central dopa-
mine D(2) receptor. Biochem Behav 67, 83–91.

34 Siegan JB, Hama AT & Sagen J (1997) A natural pep-
tide with NMDA inhibitory activity reduces tonic pain
in the formalin model. Brain Res 755, 331–334.
35 Hama AT, Siegan JB, Herzberg U & Sagen J (1999)
NMDA-induced spinal hypersensitivity is reduced by
naturally derived peptide analog [Ser1]histogranin.
Pharmacol Biochem Behav 62, 67–74.
36 Hama A & Sagen J (2002) Selective antihyperalgesic
effect of [Ser1] histogranin on complete Freund’s
adjuvant-induced hyperalgesia in rats. Pain 95,
15–21.
37 Le HT, Lemaire IB, Gilbert AK, Jolicoeur F, Yang L,
Leduc N & Lemaire S (2004) Histogranin-like antinoci-
ceptive and anti-inflammatory derivatives of o-phenylene-
diamine and benzimidazole. J Pharmacol Exp Ther 309,
146–155.
38 Lemaire S, Shukla VK, Rogers C, Ibrahim IH, Lapierre
C, Parent P & Dumont M (1993) Isolation and charac-
terization of histogranin, a natural peptide with NMDA
receptor antagonist activity. Eur J Pharmacol 245, 247–
256.
39 Lemaire S, Rogers C, Dumont M, Shukla VK, Lapierre
C, Prasad J & Lemaire I (1995) Histogranin, a modified
histone H4 fragment endowed with N-methyl-D-aspar-
tate antagonist and immunostimulatory activities. Life
Sci 56, 1233–1241.
40 Le HT, Lemaire I, Gilbert AK, Jolicoeur F & Lemaire
S (2003) Bioactive peptidic analogues and cyclostereo-
isomers of the minimal antinociceptive histogranin frag-
ment-(7–10). J Med Chem 46, 3094–3101.

41 Gendron N, Dumont M, Gagne
´
MF & Lemaire S
(1998) Poly A-containing histone H4 mRNA variant
(H4-v. 1): isolation and sequence determination from
bovine adrenal medulla. Biochim Biophys Acta 1396,
32–38.
42 Poirier R, Lemaire I, Dumont M, Leduc N, Le HT &
Lemaire S (2005) Correlation between the expression of
Histone H4 mRNA variants R. Poirier et al.
4372 FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS
the histone H4 mRNA variant H4-v.1 and the levels of
histone H4-(86–100) and H4-(89–102) (OGP) in various
rat tissues and alveolar macrophages. Peptides 26, 1503–
1511.
43 Franklin SG & Zweidler A (1977) Non-allelic variants
of histones 2A, 2B, and 3 in mammals. Nature 266,
273–275.
44 Frank D, Doenecke D & Albig W (2003) Differential
expression of human replacement and cell cycle depen-
dent H3 histone genes. Gene 312, 135–143.
45 Pauli U, Chrysogelos S, Stein G, Stein J & Nick H
(1987) Protein–DNA interactions in vivo upstream of a
cell cycle-regulated human H4 histone gene. Science
236, 1308–1311.
46 Xie R, van Wijnen AJ, van Der Meijden C, Luong MX,
Stein JL & Stein GS (2001) The cell cycle control element
of histone H4 gene transcription is maximally responsive
to interferon regulatory factor pairs IRF-1 ⁄ IRF-3 and
IRF-1 ⁄ IRF-7. J Biol Chem 276, 18624–18632.

47 van der Meijden CM, Vaughan PS, Staal A, Albig W,
Doenecke D, Stein JL, Stein GS & van Wijnen AJ
(1998) Selective expression of specific histone H4 genes
reflects distinctions in transcription factor interactions
with divergent H4 promoter element. Biochim Biophys
Acta 1442, 82–100.
48 Wells D & McBride C (1989) A comprehensive compila-
tion and alignment of histones and histone genes.
Nucleic Acids Res 17 (Suppl), 311–346.
49 Reeves R, Elton TS, Nissen MS, Lehn D & Johnson
KR (1987) Posttranscriptional gene regulation and spe-
cific binding of the nonhistone protein HMG-I by the 3¢
untranslated region of bovine interleukin 2 cDNA. Proc
Natl Acad Sci USA 84, 6531–6535.
50 Davis RJ (1995) Transcriptional regulation by MAP
kinases. Mol Reprod Dev 42, 459–467.
51 Waltereit R & Weller M (2003) Signaling from
cAMP ⁄ PKA to MAPK and synaptic plasticity. Mol
Neurobiol 27, 99–106.
52 Hirano F, Tanaka H, Hirano Y, Hiramoto M, Handa
H, Makino I & Scheidereit C (1998) Functional interfer-
ence of Sp1 and NF-kappaB through the same DNA
binding site. Mol Cell Biol 18, 1266–1274.
53 Tas SW, Remans PH, Reedquist KA & Tak PP (2005)
Signal transduction pathways and transcription factors
as therapeutic targets in inflammatory disease: towards
innovative antirheumatic therapy. Curr Pharm 11, 581–
611.
54 Akhmanova A, Miedema K & Hennig W (1996) Identi-
fication and characterization of the Drosophila histone

H4 replacement gene. FEBS Lett 388, 219–222.
55 Silver Key SC & Pagano JS (1997) A noncanonical
poly(A) signal, UAUAAA, and flanking elements in
Epstein–Barr virus DNA polymerase mRNA function
in cleavage and polyadenylation assays. Virology 234,
147–159.
56 Alvelo-Ceron D, Niu L & Collart DG (2000) Growth
regulation of human variant histone genes and acetyla-
tion of the encoded proteins. Mol Biol Rep 27, 61–71.
57 Mitra P, Xie RL, Medina R, Hovhannisyan H, Zaidi
SK, Wei Y, Harper JW, Stein JL, van Wijnen AJ &
Stein GS (2003) Identification of HiNF-P, a key activa-
tor of cell cycle-controlled histone H4 genes at the onset
of S phase. Mol Cell Biol 23, 8110–8123.
58 Todisco A, Ramamoorthy S, Pausawasdi N & Tacey K
(1999) Carbachol activates IkappaB kinase in isolated
canine gastric parietal cells. Biochem Biophys Res
Commun 261, 877–884.
59 Gardella S, Andrei C, Lotti LV, Poggi A, Torrisi MR,
Zocchi MR & Rubartelli A (2001) CD8(+) T lympho-
cytes induce polarized exocytosis of secretory lysosomes
by dendritic cells with release of interleukin-1beta and
cathepsin D. Blood 98, 2152–2159.
60 Kozak M (2002) Pushing the limits of the scanning
mechanism for initiation of translation. Gene 299, 1–34.
61 Bab I, Smith E, Gavish H, Attar-Namdar M, Chorev
M, Chen YC, Muhlrad A, Birnbaum MJ, Stein G &
Frenkel B (1999) Biosynthesis of osteogenic growth pep-
tide via alternative translational initiation at AUG
85

of
histone H4 mRNA. J Biol Chem 274, 14474–14481.
62 Brummelkamp TR, Bernards R & Agami R (2002)
Stable suppression of tumorigenicity by virus-mediated
RNA interference. Cancer Cell 2, 243–247.
63 Lee J, Park EH, Couture G, Harvey I, Garneau P &
Pelletier J (2002) An upstream open reading frame
impedes translation of the Huntington gene. Nucleic
Acids Res 30, 5110–5119.
64 Herna
´
ndez-Sa
´
nchez C, Mansilla A, De la Rosa EJ,
Pollerberg E, Martı
´
nez-Salas E & De Pablo F (2003)
Upstream AUGs in embryonic proinsulin mRNA con-
trol its low translation level. EMBO J 22, 5582–5592.
65 Tenson T, Herrera JV, Kloss P, Guarneros G &
Mankin AS (1999) Inhibition of translation and cell
growth by minigene expression. J Bacteriol 181, 1617–
1622.
66 Livak J & Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the
2(DDCt method. Methods 25, 402–408.
67 Lemaire I, Yang H, Lafond, Dornand J, Commes T &
Cantin MF (1996) Differential effects of macrophage-
and granulocyte–macrophage colony-stimulating factors
on cytokine gene expression during rat alveolar macro-

phage differentiation into multinucleated giant cells
(MGC). J Immunol 157, 5118–5125.
68 Zhang J, Tachado SD, Pateeeeel N, Zhu J, Imrich A,
Manfruelli P, Cushion M, Kinane TB & Koziel H
(2005) Negative regulatory role of mannose receptors
on human alveolar macrophage proinflammatory cyto-
kine release in vitro. J Leukoc Biol 78, 665–674.
69 Remick DG (2005) Interleukin-8. Crit Care Med 33,
S466–S467.
R. Poirier et al. Histone H4 mRNA variants
FEBS Journal 273 (2006) 4360–4373 ª 2006 The Authors Journal compilation ª 2006 FEBS 4373