Báo cáo khoa học: Reconstitution in vitro of the GDP-fucose biosynthetic pathways of Caenorhabditis elegans and Drosophila melanogaster ppt

Reconstitution in vitro of the GDP-fucose biosynthetic
pathways of Caenorhabditis elegans and Drosophila
melanogaster
Simone Rhomberg
1
, Christina Fuchsluger
1
, Dubravko Rendic
´
1
, Katharina Paschinger
1
,
Verena Jantsch
2
, Paul Kosma
1
and Iain B. H. Wilson
1
1 Department fu
¨
r Chemie, Universita
¨
tfu
¨
r Bodenkultur, Vienna, Austria
2 Abteilung fu
¨
r Chromosomenbiologie, Vienna Biocenter II, Austria
Fucose is a key component of many oligosaccha-
rides involved in recognition events and therefore

has roles in disease and development [1]. For
instance, Notch, a protein involved in developmental
processes in animals, is modified with fucose
O-linked to the protein backbone [2], and a defect
in the relevant O-fucosyltransferase (POFUT1)is
lethal in mice [3], whereas the orthologous gene, nti,
is necessary for normal development of Drosophila
melanogaster [4,5]. A second O-fucosyltransferase
(POFUT2) is also known, and RNAi in Caenorhab-
ditis elegans of the relevant gene, pad-2, results in
severe body malformations [6]. Less drastic are the
effects of ablation of the FUT7 gene required for
biosynthesis of certain fucose-containing selectin lig-
ands; a lack of the encoded enzyme results in defi-
cient leukocyte trafficking [7]. On the other hand,
certain fucosylated glycans are immunogenic and
allergenic, an example of such a structure being the
modification of the N-glycan core by a1,3-linked
fucose [8]. This feature is recognized by, e.g. anti-
(horseradish peroxidase), which is used to stain
Keywords
Caenorhabditis; Drosophila; GDP-fucose
biosynthesis; GDP-keto-6-deoxymannose 3,
5-epimerase ⁄ 4-reductase; GDP-mannose
dehydratase
Correspondence
I. B. H. Wilson, Department fu
¨
r Chemie,
Universita

¨
tfu
¨
r Bodenkultur, Muthgasse 18,
A-1190 Vienna, Austria
Fax: +43 1 36006 6059
Tel: +43 1 36006 6541
E-mail:
Database
The nucleotide sequences of C. elegans and
D. melanogaster gmd and ger cDNA have
been submitted to the EMBL database
under accession numbers AM231683,
AM231684, AM231685, AM231686,
AM231687 and AM231688
(Received 30 November 2005, revised 17
February 2006, accepted 20 March 2006)
doi:10.1111/j.1742-4658.2006.05239.x
The deoxyhexose sugar fucose has an important fine-tuning role in regula-
ting the functions of glycoconjugates in disease and development in mam-
mals. The two genetic model organisms Caenorhabditis elegans and
Drosophila melanogaster also express a range of fucosylated glycans, and
the nematode particularly has a number of novel forms. For the synthesis
of such glycans, the formation of GDP-fucose, which is generated from
GDP-mannose in three steps catalysed by two enzymes, is required. By
homology we have identified and cloned cDNAs encoding these two pro-
teins, GDP-mannose dehydratase (GMD; EC 4.2.1.47) and GDP-keto-6-
deoxymannose 3,5-epimerase ⁄ 4-reductase (GER or FX protein; EC
1.1.1.271), from both Caenorhabditis and Drosophila. Whereas the nema-
tode has two genes encoding forms of GMD (gmd-1 and gmd-2) and one

GER-encoding gene (ger-1), the insect has, like mammalian species, only
one homologue of each (gmd and gmer). This compares to the presence of
two forms of both enzymes in Arabidopsis thaliana. All corresponding
cDNAs from Caenorhabditis and Drosophila, as well as the previously
uncharacterized Arabidopsis GER2, were separately expressed, and the
encoded proteins found to have the predicted activity. The biochemical
characterization of these enzymes is complementary to strategies aimed at
manipulating the expression of fucosylated glycans in these organisms.
Abbreviations
GER, GDP-keto-6-deoxymannose 3,5-epimerase ⁄ 4-reductase; GMD, GDP-mannose dehydratase.
2244 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
neural tissue and cells in many invertebrates, inclu-
ding Caenorhabditis and Drosophila [9–11].
Not only have the relevant fucosyltransferases and
fucose-containing glycans been the object of study, but
also the proteins required for the biosynthesis and
transport of the fucose donor, GDP-Fuc, have been
examined. This nucleotide sugar is generated de novo
from GDP-Man in three steps catalysed by two cytoso-
lic enzymes: GDP-mannose dehydratase (GMD; EC
4.2.1.47) and GDP-keto-6-deoxymannose 3,5-epi-
merase ⁄ 4-reductase (GER, otherwise known as GDP-
Fuc synthase; other synonyms include the FX protein
in man, the P35B tumour rejection antigen in mice, as
well as fcl or wcaG in bacteria and GMER in
Drosophila; EC 1.1.1.271) [12]. In eukaryotes, GDP-Fuc
is then transported into the Golgi [13], the site of action
of, at least the majority of, the fucosyltransferases.
To date, sequences encoding GMD and GER have
been cloned and expressed from man [14–16], Arabid-

opsis thaliana [17–19], Escherichia coli [20], Helicobact-
er pylori [21,22] and Paramecium bursaria Chlorella
virus 1 [23]. Indeed Arabidopsis has two GMD genes,
one of which corresponds to the MUR1 ⁄ GMD2 gene,
a defect in which results in deficiencies in cell wall bio-
synthesis [24]. GMD is also defective in the Chinese
hamster ovary Lec13 and murine lymphoma PL
R
1.3
mutant cell lines, and this absence results in resistance
to fucose-specific lectins [25,26]. Mice defective in
GER suffer from postnatal failure to thrive and an
absence of leukocyte selectin ligand expression [27],
whereas mutant strains of both the intestinal symbiont
Bacteriodes and the nodulation symbiont Sinorhizo-
bium fredii unable to produce GDP-Fuc display
reduced colonization competitiveness in the presence
of wild-type strains [28,29]. There also exists a Dicytos-
telium discoideum (slime mould) strain (HL250) with a
genetically undefined defect in the conversion of GDP-
Man into GDP-Fuc and a resultant reduced germina-
tion efficiency for older spores, suggesting that, as for
the aforementioned bacterial symbionts, the presence
of fucose may confer a selective advantage under
natural conditions [30]. However, although early stud-
ies were taken to suggest that GMD may be defective
in patients with leukocyte adhesion deficiency II
(OMIM 266265) [31,32], it now appears to be accepted
that mutations in the GDP-Fuc transporter are the
reason for the observed reduction in fucosylation

[33,34]. On the other hand, the high level of fucosyla-
tion in human hepatocellular carcinoma has been cor-
related, at least in part, with high expression of GER
and increased concentrations of GDP-fucose [35].
Considering that the enzymes involved in GDP-Fuc
biosynthesis in the two model invertebrates C. elegans
and D. melanogaster have not been studied to date, even
though fucosylation appears to be important for their
development [4–6], we sought to clone cDNAs predicted
to encode GMD and GER genes in these two organ-
isms, using previously characterized A. thaliana homo-
logues as controls; indeed the encoded proteins were
successfully expressed in bacteria and found, in concert,
to direct the synthesis of GDP-Fuc in vitro. The two
Drosophila enzymes GMD and GMER were also puri-
fied; the GDP-Fuc product of these two enzymes was
also characterized by NMR and by a functional assay.
Results
Cloning and expression of Caenorhabditis and
Drosophila GMD and GER cDNAs
Homologues of the human GMD protein were identified
from Caenorhabditis and Drosophila, and the relevant
cDNAs cloned. Whereas Drosophila has, as previously
determined in a theoretical study [36], one gmd gene
(CG8890), Caenorhabditis has, like Arabidopsis [18], two
gmd genes (gmd-1 and gmd-2 corresponding to the
C53B4.7 and F56H6.5 Wormbase entries), which encode
proteins that are 88% identical with each other (see
Fig. 1 for alignment). The Caenorhabditis gmd-1 gene is
transcribed in two different forms resulting from use of

different 5¢ exons (the second and smaller form,
C53B4.7a, which is designated gmd-1a in this study);
both 5¢ -end gmd-1a EST clones in the databases contain
an SL1 spliced leader. In the case of the second worm
gene, encoding GMD-2, RT-PCR using a forward pri-
mer containing the predicted start codon was unsuccess-
ful, as was PCR using forward primers corresponding to
the SL1 or SL2 spliced leaders and gmd-2-specific
reverse primers. Finally, gmd-2 was cloned in an incom-
plete form starting with the second exon, which, how-
ever, still contains the first region (Gly-Leu-Glu)
conserved in comparison with the gmd-1 cDNAs.
As for GMD, homologues of the human GER pro-
tein were identified from Caenorhabditis and Droso-
phila, and the relevant cDNAs cloned; we also cloned
both Arabidopsis homologues. The Drosophila homo-
logue has already been named gmer (CG3495) [36],
whereas the Caenorhabditis ger-1 corresponds to the
R01H2.5 reading frame. As for the GMD enzymes,
alignments show a high degree of conservation
between GER homologues (Fig. 2).
Enzymatic activity of GMD and GER proteins
All Arabidopsis, Caenorhabditis and Drosophila GMD
and GER homologues were expressed using the
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2245
pET30a system in the presence of kanamycin and chlo-
ramphenicol; in addition, a pCRT7-NT vector carrying
Caenorhabditis gmd-1 was also coexpressed with the
pET30a clone of Caenorhabditis ger-1 in the presence

of ampicillin, kanamycin and chloramphenicol.
Western blotting with an antibody to His showed for
Fig. 1. Alignment of GMD sequences. The following GMD protein sequences were aligned: C1 (C. elegans GMD-1); C1a (C. elegans GMD-1
alternatively spliced form, first 56 residues only); C2 (C. elegans GMD-2); Dm (D. melanogaster GMD); Hs (Homo sapiens GMD); Sj (Schisto-
soma japonica GMD); Ec (E. coli GMD); Pb (P. bursaria Chlorella virus 1 GMD); A1 (A. thaliana GMD1); A2 (A. thaliana MUR1 ⁄ GMD2). Resi-
dues conserved in comparison with the fly and worm sequences are highlighted, whereas key conserved residues noted in the Discussion
(GXXGXXG as well as the Ser ⁄ Thr residue and YXXXK motif catalytically important for SDR family members) are marked underneath with an
asterisk.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2246 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
GMD homologues the expression of proteins of
 50 kDa, whereas in the case of the different forms of
GER the proteins were  35 kDa (Fig. 3). The Caenor-
habditis and Drosophila GMD and GER proteins were
tested for activity in coupled enzyme assays. The Ara-
bidopsis GMD2 (MUR1) and GER1 proteins were also
Fig. 2. Alignment of GER sequences. The following GER protein sequences were aligned: Ce (C. elegans GER-1); Dm (D. melanogaster
GMER); Hs (Homo sapiens GER ⁄ FX); Sj (Schistosoma japonica GMD); Ec (E. coli GMD ⁄ wcaG); Pb (P. bursaria Chlorella virus 1 GER); A1
(A. thaliana GER1); A2 (A. thaliana GER2). Residues conserved in comparison with the fly and worm sequences are highlighted, whereas
key conserved residues noted in the Discussion (GXXGXXG as well as the Ser ⁄ Thr residue and YXXXK motif catalytically important for SDR
family members) are marked underneath with an asterisk.
Fig. 3. Western blots of expressed GMD and GER isoforms. GMD and GER proteins from A. thaliana (MUR1, GMD1, GER1 and GER2),
C. elegans (GMD-1, GMD-1a, GMD-2, GER-1 and coexpressed GMD-1 and GER-1) and D. melanogaster (GMD and GMER) were expressed
in E. coli BL21(DE3)pLysS cells for 2 h, and the soluble fractions of the bacterial proteins (equal lysate equivalents) were subjected to
SDS ⁄ PAGE and western blotting using a primary antibody to His. The sizes of the molecular mass standards are shown in kDa.
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2247
tested as positive controls, as these have been previ-
ously shown to be enzymatically active when expressed
in E. coli [17,19].

The assays were performed using GDP-Man as sub-
strate; incubations were performed with extracts con-
taining either of the Arabidopsis, Caenorhabditis or
Drosophila enzymes alone or with both enzymes from
the various species together. The incubations were then
analysed by RP-HPLC, using authentic GDP-Man
and GDP-Fuc as external standards. Initially, 0.5 m
KH
2
PO
4
was used as eluent [37], but, analogous to the
use of ammonium formate buffers for the purification
of UDP-xylose [38], it was then decided to examine the
use of the formate buffer. As the results with the two
buffers were comparable, all subsequent analyses were
performed with the volatile formate buffer. Further-
more, it was not absolutely necessary to perform the
GMD reaction before boiling and then adding GER;
such a procedure, though, has been described for
assays with E. coli K12 Gmd and WcaG [39].
When GMD ⁄ GER ‘pairs’ of any one of the three
species were present, a component that was coeluted
with standard GDP-Fuc was produced (Fig. 4). In the
case of the Arabidopsis MUR1 and GER1 enzymes, the
putative GDP-Fuc product was shown to be a donor
substrate in fucosyltransferase assays (data not shown).
GDP-Fuc synthesis was also observed when either the
Arabidopsis MUR1 or the Caenorhabditis GMD-1a iso-
form were incubated with Caenorhabditis GER-1 and

GDP-Man (data not shown). In the absence of any
GER enzyme, but in the presence of any GMD, a
broad peak of intermediate retention time was
observed, as shown for Caenorhabditis GMD-1a and
Drosophila GMD (Fig. 4A,D); this presumably corres-
ponds to the previously observed ketone and hydrate
forms of GDP-4-keto-6-deoxymannose [40]. No inter-
mediate product was formed in the absence of any
GMD enzyme, and no GDP-Fuc was formed in the
absence of either GMD or GER, nor with the empty
vector control, showing that the strain of E. coli used
has no detectable GDP-Fuc synthesis system. The chro-
matograms also indicate that the amount of remaining
intermediate product was generally low or nonexistent
compared with the amount of GDP-Fuc, even though
GDP-Man was still present, and that the concentration
of GDP-4-keto-6-deoxymannose produced in the pres-
ence of GMD isoforms alone was greater than the con-
version of GDP-Man into products in the presence of
both enzymes (e.g. with Drosophila GMD alone the
conversion of GDP-Man into the intermediate was
 80%, whereas in the presence of both enzymes the
conversion into GDP-Fuc was only  50%; compare
Fig. 4A with 4C). This would indeed be compatible
with the feedback inhibition by GDP-Fuc previously
shown for other forms of GMD also occurring to some
extent with the fly and worm enzymes [14,39].
For the Caenorhabditis and Drosophila enzymes,
expression at room temperature was necessary to detect
activity: for the Drosophila enzymes, no activity was

detected on expression at 37 °C, whereas for the Caenor-
habditis enzymes, only minimal activity was found on
expression at 16 °C. GDP-Fuc synthesis on coexpres-
sion of Caenorhabditis GMD-1 and GER-1 was margin-
ally less efficient (12%) than synthesis in the presence of
both separately expressed enzymes (15–20%) assayed
under the same conditions; thus, there is no obvious
requirement to coexpress GMD and GER. This is unlike
the situation with expression of the Arabidopsis MUR1
in yeast, as in this system MUR1 was susceptible to
degradation when not coexpressed with GER1 [37].
Fig. 4. Activity of expressed GMD and GER isoforms. The soluble
fractions of lysates (equal lysate equivalents) of bacteria expressing
GMD and GER enzymes were incubated overnight with GDP-Man
and subjected to RP-HPLC. The chromatograms of the following
combinations are shown: (A) Drosophila GMD alone; (B) Drosophila
GMER alone; (C) Drosophila GMD and GMER; (D) Caenorhabditis
GMD-1a; (E) Caenorhabditis GMD-1 and GER-1; (F) Caenorhabditis
GMD-2 and GER-1; (G) Arabidopsis MUR1 (GMD2) and GER1; (H)
Arabidopsis GMD1 and GER2. The elution positions of GDP-Man
and GDP-Fuc standards are indicated. In the experiments shown,
the GMD and GER isoforms were expressed separately.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2248 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
In addition to using MUR1 and GER1 as controls,
we also examined the other Arabidopsis homologues
of these enzymes, respectively, GMD1 and GER2.
Whereas GMD1 has been previously shown to be active
[18], GER2 was only identified in silico as a putative
epimerase-reductase [19]. The assay data showed that,

as for MUR1 and GER1, incubations with both GMD1
and GER2 also resulted in synthesis of GDP-Fuc, con-
firming the activity of GER2 for the first time (Fig. 4H).
Properties of GMD and GER proteins from
different species
Initially, the composition of the assay mixture used was
based on previously published procedures [14]. There-
fore, to test the limits of the system, we performed
assays with the Arabidopsis enzymes in the absence of
one of each of the nonenzymatic components. Compar-
able to previous reports, we found that the synthesis by
GER1 of GDP-Fuc from the intermediate product was
absolutely dependent on NADPH, whereas reducing
the NADPH concentration by half, or increasing it
twofold, had no influence on the yield of GDP-Fuc.
Furthermore, reduced conversion of the intermediate
was observed in the absence of dithiothreitol. On the
basis of these data, we did not alter the assay mixture
composition for the later assays. However, to optimize
the preparation of GDP-Fuc in a ‘one-pot’ method, we
also examined the pH and temperature requirements
for its production from GDP-Man.
The Drosophila enzymes, taken together, displayed a
relatively broad pH optimum (pH 5–8), resulting,
under the conditions used, in 50% conversion of
GDP-Man into GDP-Fuc. Caenorhabditis GMD-1 and
GER showed, in combination, optimal activity at
pH 8–9 (15–20% conversion using the same amount
of soluble bacterial extract as for the Drosophila
enzymes); similarly, an optimum at pH 8 was reported

for the synthesis of GDP-Fuc by Aerobacter aerogenes
and CHO cell extracts [25,41], whereas both the sepa-
rately assayed GMD and GER from porcine thyroid
show optima at pH  7 [42,43] and recombinant forms
of human and E. coli GMD have optima of pH 7.5–
8.0 [32,44]. The recombinant E. coli K-12 GER enco-
ded by the wcaG gene was most active in the range
pH 6–7 [45].
As regards temperature, the Drosophila enzymes
were most active at temperatures of 16–30 °C, whereas
the Caenorhabditis enzymes (specifically GMD-1 and
GER-1) displayed a temperature optimum of 23–37 °C
(Fig. 5). Assays with recombinant GDP-mannose
dehydratases alone showed that both Caenorhabditis
GMD-1a and Drosophila GMD had temperature
optima  30 °C, whereas Caenorhabditis GMD-2 was
most active at 16–23 °C (data not shown).
Purification of Drosophila GMD and GMER
In the preceding studies, the identity of the GDP-Fuc
product was based on HPLC retention time; thus, it
was decided to purify the product of the fruitfly pro-
teins for further analysis. Thus Drosophila GMD and
GMER were subjected to nickel-chelation chromato-
graphy either separately or together and isolated after
elution with 250 mm imidazole (Fig. 6, upper panel).
The dominant bands (35 kDa and 50 kDa, corres-
ponding to GMER and GMD, respectively) eluted
with the latter buffer reacted with an antibody to His
(Fig. 6, lower panel), and their identity was verified by
MALDI-TOF tryptic peptide mapping. Protein assays

indicated that the yields of individually purified
Drosophila GMD and GMER were  0.5 mg from a
50-mL culture; when purified together, the total pro-
tein yield was 1 mg. Under the conditions used, the
yield of GDP-Fuc with the separately purified enzymes
was comparable to that using enzymes purified
together; it also appeared that, after purification,
GMER was more stable than GMD (data not shown).
Using the purified forms of Drosophila GMD and
GMER, scaled-up incubations were performed, prepu-
rified by passage over a small Lichroprep column and
subjected to RP-HPLC to yield an estimated total of
 1 mg GDP-Fuc (20% yield after purification). This
material was lyophilized and used successfully as a fuc-
osyltransferase substrate when an extract of Sf9 cells
transfected with Drosophila core fucosyltransferase
120
100
80
60
40
20
0
16 23
30
37
Ara
Ce
Dm
Temperature [ºC]

% Relative yield
Fig. 5. Relative yield of GDP-Fuc with respect to incubation tem-
perature. Assays of Arabidopsis MUR1 and GER1, Drosophila GMD
and GMER, and Caenorhabditis GMD-1 and GER-1 were performed
at different temperatures, and the relevant RP-HPLC peaks were
integrated. The data were then recalculated individually for each
enzyme pair relative to the respective activity at 23 °C.
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2249
FucTA was used as an enzyme source as judged by the
conversion of the dabsyl-GnGnF
6
glycopeptide sub-
strate into a species with an m ⁄ z 146 higher (data not
shown). Furthermore, the compound was subjected to
NMR, which confirmed its identity as GDP-Fuc
(Table 1), the data matching those reported for syn-
thetic GDP-Fuc [46].
Developmental expression profile in
Caenorhabditis
Considering the multiplicity of genes and transcripts
encoding GDP-mannose dehydratase in C. elegans,
semi-normalized RT-PCR was performed using cDNA
from L1 larvae, L2 ⁄ 3 larvae (combined as these are
difficult to distinguish), L4 larvae and adults. The
results (Fig. 7) would suggest minor variations in the
concentrations of the gmd-2 and ger-1 transcripts dur-
ing worm development. A peak of gmd-1 transcription
may be occurring in the L2 ⁄ 3 stage, but transcripts of
this form are seemingly under-represented in adults.

Fig. 6. Purification of recombinant Drosophila GMD and GMER.
GMD and GMER expressed separately were subjected to nickel
chelation chromatography; fractions marked ‘co’ are from the purif-
ication of GMD and GMER from mixed lysates. Fractions (wash,
20 m
M imidazole and 250 mM imidazole) were then electrophor-
esed and stained using Coomassie blue (upper panel) or transferred
to nitrocellulose and probed with an antibody to His (lower panel).
In the case of copurification, some GMER, but no GMD, was elut-
ed with 20 m
M imidazole (lane 4). The sizes of the molecular mass
standards are shown in kDa.
Table 1. NMR data of GDP-b-L-fucose prepared using recombinant Drosophila enzymes. ND, not determined. Further signals at 3.76 p.p.m.
in the proton spectrum and at 60.16 in the carbon spectrum are from residual Tris buffer.
Atom H ⁄ C ⁄ P (p.p.m.) 1 2 3 4 5 6
b-Fuc1 fi
1
H 4.94 3.58 3.69 3.72 3.77 1.25
J (Hz) 6.5 10.0 3.5 ND 6.6
13
C 99.19 71.81 73.30 72.24 71.98 16.22
b-Rib1 fi
1
H 5.95 4.84 4.56 4.37 4.25–4.22 (2H)
J (Hz) 6.4 5.2 3.5 ND ND
13
C 87.57 74.27 71.32 84.76 66.17
b-Fuc1-P-
31
P ) 12.65

J (Hz) J
PP
20.5, J
HP
8.0
P-5-Rib
31
P ) 10.8
Guanine
1
H 8.13
13
C 138.48
Fig. 7. Development RT-PCR profile for GMD and GER transcripts
in Caenorhabditis. RT-PCR was performed using RNA isolated from
L1, L2 ⁄ L3, L4 and adult C. elegans using primers specific for
gmd-1, gmd-1a (alternatively spliced form of GMD-1), gmd-2 and
ger-1. The amounts of cDNA used in the PCRs were normalized on
the basis of the intensity of actin transcripts.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2250 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
On the other hand, the alternatively spliced gmd-1a
transcript is present at its lowest concentrations in L1
larvae and is relatively more abundant in the later sta-
ges. The expression of the GDP-Fuc biosynthesizing
enzymes throughout development is compatible with
the rich variety of fucosylated N-glycans and O-gly-
cans in this species [47,48].
Discussion
GDP-fucose was first found in 1958 [49], and its bio-

synthesis is a process present in many life forms, from
bacteria through to plants, invertebrates and verte-
brates. There appear to be two basic strategies for the
formation of GDP-Fuc: either the route through
GDP-Man, using GMD and GER enzymes, or the
‘salvage’ pathway through fucose 1-phosphate. The
first route was first found in A. aerogenes and shown
to be dependent on the presence of NADPH (then
called TPNH) [50]. GMD was first isolated from
Phaseolus vulgaris [51], whereas GER was initially
purified from porcine thyroid [43]. The presence of a
fucose salvage pathway was first suggested in 1964
because of the ability to radiolabel glycoproteins after
administration of [
14
C]Fuc to rats [52] and confirmed
by detection of l-fucose kinase and GDP-l-Fuc pyro-
phosphorylase [53,54] in porcine liver. More recent
studies indicate that there are varying levels of fuco-
kinase activity in different rat tissues [55].
Some organisms have both pathways, as shown by
biochemical work; initially both routes were consid-
ered to be only present in mammals, but now the
two pathways have been demonstrated in Bacteriodes
[28]. The genomic ‘revolution’, however, means that
further phylogenetic analyses can now be performed.
By this approach, it can be seen that the
GMD ⁄ GER route is probably present in all organ-
isms known to produce fucose-containing glycoconju-
gates; on the other hand, as noted previously,

Drosophila has no genetically detectable ‘salvage’
pathway. Plants and mammals do have relevant
homologues, although the putative plant ‘salvage’
pathway is seemingly closer to that of Bacteriodes,
as plant genomes contain homologues of the fkp
gene from Bacteriodes, a gene that encodes a protein
with both fucokinase and GDP-Fuc phosphorylase
activities [28]. In mammals, however, these activities
are encoded by separate genes. Caenorhabditis
appears, on the other hand, only to have an obvious
fucokinase homologue (C26D10.4). In addition,
GMD is also required for the de novo synthesis of
GDP-Rha in Ps. aeruginosa, as the product of
GMD, GDP-4-keto-6-deoxy-d-mannose, can also be
acted on by a reductase [56], whereas the GMD of
the P. bursaria Chlorella virus 1 can directly convert
GDP-4-keto-6-deoxy-d-mannose into GDP-Rha [23].
Thus it is conceivable that GMD is more ancient
than GER.
The GMD and GER sequences across the various
kingdoms of life are remarkably highly conserved;
both proteins are members of the short chain dehy-
drogenase (SDR) family and display homologies to
other enzymes of sugar nucleotide metabolism, such as
dTDP-glucose dehydrogenase, UDP-Gal epimerase
and UDP-GlcA decarboxylase. Phylogenetic trees (not
shown) suggest that the plant enzymes are closer to
the bacterial, than to the animal, ones; regardless of
this, however, residues found by crystallographic or
mutagenesis studies to be important for binding or

catalysis are identical across all sequences. A Ross-
mann motif (Gly-Xaa-Xaa-Gly-Xaa-Xaa-Gly), which
is a common feature of nucleotide-binding proteins, is,
for instance, conserved in all the GMD and GER
sequences from worm and fly. Furthermore, the resi-
dues corresponding to Gln39, Asp40, Ser117 and
Arg220 in MUR1 3D structure, which form hydrogen
bonds with the NADPH cofactor, and the residues
that correspond to Asn214, Lys228, Arg253, Arg314
and Glu317 of the MUR1 sequence and form hydro-
gen bonds with the GDP moiety [57] are retained in
the worm and fly GMD enzymes. The Ser ⁄ Thr residue
and Tyr-Xaa-Xaa-Xaa-Lys motif catalytically import-
ant for SDR family members are also conserved in all
sequences. If the corresponding Ser ⁄ Thr, Tyr and Lys
residues of the E. coli GMD or GER are separately
subjected to site-directed mutagenesis, then either
activity is abolished or the k
cat
drastically decreased
[58,59].
It is also noteworthy that some organisms have mul-
tiple GMD or GER genes. In particular, Arabidopsis
has two proven GMD enzymes (GMD1 and MUR1;
At5g66280 and At3g51160), displaying differential
expression [18], as well as the previously proven GER1
and now, by us, proven GER2 (respectively, At1g73250
and At1g17890): in both cases the genes are in, or at
least close to, regions that have putatively been duplica-
ted during the evolution of Arabidopsis [60,61]. Further-

more, the presence of duplicated genes means that
knocking-out one GMD, i.e. MUR1, does not totally
diminish the fucose content of Arabidopsis glycoconju-
gates [24]. Any strategy to abolish all fucosylation in
plants is possibly also complicated by the presence of
the aforementioned fkp homologue. On the other hand,
Drosophila has only one GMD and one GER homo-
logue; indeed, a GMD mutation has been isolated and
is lethal at the third larval stage [62], commensurate
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2251
with the putative key role for peptide O-fucosyl-
transferases in development and the probable lack of
any salvage pathway.
C. elegans, however, is somewhere between these
extremes, as it has two GMD enzymes (although the
related nematode Caenorhabditis briggsae appears to
have only one gmd gene, suggesting that the duplication
of gmd genes is an evolutionarily relatively recent event),
whose activities were proven in the course of our studies,
but only one GER isoform. Suggestive of functional
degeneracy are RNAi data on the two Caenorhabditis
GMD homologues: at least when performed individu-
ally, as part of a large-scale screen, RNAi of gmd-1,
gmd-2 and ger-1 resulted in no obvious associated lethal-
ity. However, in another large-scale RNAi screen with
the hypersensitive rrf-3 worm strain, various defects
were indeed reported upon knock-down of gmd-2 [63];
no data, however, on gmd-1 or gmd-1a were reported in
the study using rrf-3 worms, so neither the relative

importance of the two genes nor the biological signifi-
cance of the alternative splicing of gmd-1 can be sur-
mised at present. Owing to the previous report as to the
effect of mutations in the C. elegans POFUT2 homo-
logue pad-2 [6], the Drosophila orthologue of which
modifies thrombospondin repeats [64], it is quite prob-
able that any effects of RNAi targeting of GDP-Fuc
biosynthesizing enzymes will be due to peptide O-fuco-
sylation defects. There may also be tissue-specific
expression of the two gmd genes. Apparently, gmd-1 is
expressed in body wall muscle and head neurons. (For
summaries of the various RNAi and expression data,
see: ¼
C53B4.7 for gmd-1, />gene?name ¼ F56H6.5 for gmd-2 and http://
www.wormbase.org/db/gene/gene?name ¼ R01H2.5 for
ger-1.). Our own developmental RT-PCR profile data
would suggest that there is no major developmental
regulation of the transcription of either GMD-encoding
gene, although there appears to be a peak of gmd-1
and gmd-1a expression at the L2 ⁄ L3 stage; such results,
however, are not incompatible with variation of expres-
sion within tissues and may reflect a requirement for
higher concentrations of GDP-Fuc at certain times or
in certain tissues during development (e.g. for Notch
signaling).
In summary, we have shown for the first time that
the GMD and GER homologues of Caenorhabditis
and Drosophila, as well as the Arabidopsis GER2, are
indeed functional enzymes, which can work together to
reconstitute GDP-Fuc synthesis in vitro. Biochemical

characterization of these enzymes lends confidence to
any subsequent reverse genetic or phylogenetic studies
or in the use of conditional mutants and lays the foun-
dation for future work on the role of fucose in the
biology of these model organisms.
Experimental procedures
Cloning of GMD and GER cDNAs
RNA was extracted from A. thaliana (Columbia), C. elegans
(N2) or D. melanogaster (Canton S) using Trizol reagent
(Invitrogen, Paisley, UK). Two-step RT-PCR was performed
using Superscript III reverse transcriptase (Invitrogen) and
Table 2. Primers used in this study.
AtGMD1 AtGMD1 ⁄ 1 ⁄ NcoI, CATGCCATGGCCTCCAGATCTCTC (fwd)
AtGMD1 ⁄ 2 ⁄ EcoRI, CGGAATTCAAGGTCGTGCTGAGCTC (rev)
AtMUR1 AtMUR1 ⁄ 1 ⁄ NcoI, CATGCCATGGCGTCAGAGAACAACGG (fwd)
AtMUR1 ⁄ 2 ⁄ XhoI, ACCCTCGAGTCAAGGTTGCTGCTTAGC (rev)
AtGER1 AtGER1 ⁄ 1 ⁄ NcoI, CATGCCATGGCTGACAAATCTGCC (fwd)
AtGER1 ⁄ 2 ⁄ XhoI, ACCCTCGAGTTATCGGTTGCAAACATTCTT (rev)
AtGER2 AtGER2 ⁄ 1 ⁄ NcoI, CATGCCATGGAATCAGGTTCGTTTATGTTA (fwd)
AtGER2 ⁄ 2 ⁄ XhoI, CCGCTCGAGTTACTGCTTCTTCTGCACAA (rev)
CeGMD-1 CeGMD1 ⁄ 1 ⁄ NcoI, CATGCCATGGCAACCGGCAAGTCTG (fwd),
CeGMD ⁄ 1 ⁄ BamHI, CGGGATCCAATGCCAACCGGCAAGTCTG (fwd),
or CeGMD1a ⁄ 1 ⁄ NcoI, CATGCCATGGCTGATCAAAATGCGAA (fwd)
CeGMD1 ⁄ 2 ⁄ HindIII, CCCAAGCTTAAGCCATTGGATTGGACTTC (rev)
CeGMD-2 CeGMD2 ⁄ 3 ⁄ NcoI, CATGCCATGGGTCTCGAATCATGTATTGA (fwd)
CeGMD2 ⁄ 1 ⁄ BamHI, CGGGATCCTAAGCCATTGGATCTGCC (rev)
CeGER-1 CeGER ⁄ 1 ⁄ NcoI, CATGCCATGGCTAAAACTATTCTAGTTACT (fwd)
CeGER ⁄ 2 ⁄ EcoRI, CGGAATTCTTATTTTCTAGCCGTCTCATAA (rev)
DmGMD DmGMD ⁄ 1 ⁄ BamHI, CGGGATCCATGCTAAATACCCGGC (fwd)
DmGMD ⁄ 2 ⁄ XhoI, CCGCTCGAGTTAAGCGATTGGATTTTTCCT (rev)

DmGMER DmGMER ⁄ 1 ⁄ BamHI, CGGGATCCATGAAGAAGGTTCTGGTTA (fwd)
DmGMER ⁄ 2 ⁄ XhoI, CCGCTCGAGTTACTTTCTAGCCTGGTCG (rev)
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2252 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
Expand polymerase (Roche, Vienna, Austria) using the pri-
mer pairs listed in Table 2. The PCR fragments were cut and
ligated into either pET30a (Novagen, Merck Biosciences,
Darmstadt, Germany) or pCRT7-NT (Invitrogen) digested
with the relevant restriction enzyme(s). DNA sequencing was
performed using the BigDye kit (Applera, Norwalk, CT,
USA). In the case of the Caenorhabditis gmd-1 and ger-1 pET
clones, the second codon encodes alanine (respectively a
replacement codon or an additional one) in order to accom-
modate an NcoI site.
Expression of GMD and GER proteins
Plasmids were used to transform BL21(DE3)pLysS Gold
cells (Stratagene, Amsterdam, the Netherlands), which were
grown overnight in 10 mL Luria–Bertani medium containing
kanamycin and chloramphenicol (also containing ampicillin
in the case of double transformation). In the case of trial
expression, 1 mL (or 2.5 mL for larger-scale cultures) was
taken from the overnight culture to inoculate 20 mL (or
50 mL) Luria–Bertani medium containing the relevant anti-
biotics. After the A
600
had reached  0.6 at 37 °C, small-scale
cultures were split, and to one half was added isopropyl
b-d-thiogalactoside to a concentration of 1 mm; in the case
of larger-scale cultures, isopropyl b-d-thiogalactoside was
added to the entire culture. The growth was continued at

23 °C for up to three hours.
Cells were resuspended in 500 lL (small-scale) or 5 mL
(large-scale) lysis buffer containing 50 mm Tris, 400 mm
NaCl, 100 mm KCl, 10% glycerol, 0.5% Triton X-100,
10 mm imidazole, pH 7.8, and lysed by performing repeated
freeze–thaw cycles, using alternately a methanol bath and a
42 °C water bath. DNase I was added, and the lysates were
incubated for 10 min at 37 ° C before centrifugation for
1 min (small-scale) or 20 min (large-scale) at 14 000 g,
4 °C. The supernatant was taken for assays or, in the case
of large-scale cultures, purification. For the presented data,
the cells were always grown and lysed under the same con-
ditions (i.e. same initial cell density, temperature, time of
induction and concentration of isopropyl b-d-thiogalacto-
side). Aliquots of these lysates stored at )80 °C still dis-
played activity after 1 year of storage.
Purification by nickel-chelation chromatography
The supernatants from lysed cells were incubated with 2 mL
Ni ⁄ nitrilotriacetate resin (Qiagen, Vienna, Austria) for at
least 1 h at 4 °C. The lysate ⁄ resin mixture was poured into a
column at room temperature and washed twice with 1 mL
lysis buffer, before further washing twice with 4-mL aliquots
of a lysis buffer containing 20 mm imidazole. Elution was
performed using four 0.5-mL aliquots of a lysis buffer con-
taining 250 mm imidazole. All fractions were collected on ice.
Protein assays were performed using the modified Lowry kit
(Sigma, Vienna, Austria).
Western blotting
Aliquots of the soluble fractions of lysed bacteria or of
affinity chromatography fractions (20 lL) were precipitated

with a fivefold excess of cold methanol and, after 1 h at
)20 °C, centrifuged (14 000 g, 5 min). After removal of
residual methanol at 65 °C, the samples were resuspended
in Laemmli sample buffer (20 lL) and denatured at 95 °C
for 5 min; 5 lL of these samples were subjected to
SDS ⁄ PAGE with subsequent blotting on to nitrocellulose.
Recombinant His-tagged forms of GMD and GER were
then detected using antibody to His (HIS-1; Sigma; 1 : 3000
dilution) followed by anti-mouse IgG (Fc or c-specific) con-
jugated with alkaline phosphatase (Sigma; 1 : 10 000 dilu-
tion) and use of SigmaFAST BCIP ⁄ NBT substrate.
Assay of GMD and GER activity
To determine the enzymatic activity, aliquots of crude sup-
ernatants of lysed cells or of purified proteins (2 lL) were
typically incubated at room temperature in the presence
of 20 mm Tris ⁄ 5mm EDTA ⁄ 10 mm dithiothreitol ⁄ 1mm
GDP-mannose ⁄ 5mm NADPH ⁄ 1mm NAD
+
, pH 7.4 (final
volume 10 lL). RP-HPLC was then performed using a
Hypersil column with isocratic elution using 600 mm
ammonium formate, pH 3.2. Peak integrations were used
to estimate the yield of either GDP-4-keto-6-deoxymannose
(GMD assays) or GDP-Fuc (combined GMD ⁄ GER
assays).
NMR analysis
Approximately 1 mg of the HPLC-purified reaction product
of GDP-Man with purified Drosophila GMD and GMER
was lyophilized twice and taken up in D
2

O before NMR
analysis. Spectra were recorded at 300 K at 300.13 MHz
for
1
H, at 75.47 MHz for
13
C, and at 121.49 MHz for
31
P
with a Bruker AVANCE 300 spectrometer equipped with a
5-mm QNP-probehead with z gradients. Data acquisition
and processing were performed with the standard xwinnmr
software (Bruker BioSpin GmbH, Rheinstetten, Germany).
1
H-NMR spectra were referenced to 2,2-dimethyl-2-silapen-
tane-5-sulfonic acid (d ¼ 0),
13
C-NMR spectra were refer-
enced externally to 1,4-dioxane (d ¼ 67.40), and
31
P-NMR
spectra were referenced externally to H
3
PO
4
(d ¼ 0).
HMQC and HMBC spectra were recorded in the phase-
sensitive mode using TPPI and pulsed field gradients for
coherence selection.
Developmental transcript analysis

A total of 120 individual Caenorhabditis L1 larvae and
60 individuals of three other stages (L2 ⁄ L3 larvae, L4
larvae and adults) were picked; the RNA, extracted using
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2253
Trizol reagent in the presence of glass beads, was taken
up in 10 lL nuclease-free water. After reverse transcrip-
tion with Superscript III of each entire RNA preparation,
the cDNAs were diluted and subjected to a preliminary
PCR screen using 1 lL of a 1 : 10 000 cDNA dilution
and Expand polymerase with actin-specific primers in a
final volume of 10 lL in order to judge relative intensi-
ties. For the subsequent experiments, the volumes of
cDNA used were corrected so as to attain approximately
the same intensities for the actin PCR products. Semi-
normalized RT-PCR was then performed using the
primer pairs listed in Table 2 for gmd-1 (and its alternat-
ively spliced form), gmd-2, ger-1 and actin using an
annealing temperature of 58 °C and 1 lL diluted cDNA.
For analysing transcripts encoding GDP-Fuc biosynthesiz-
ing enzymes, 1 : 5 diluted cDNA was used with the L1
and L2 ⁄ 3 stages and 1 : 50 for the L4 and adult stages,
whereas actin transcripts were measured using dilutions
of 1 : 5000 or 1 : 50 000.
Acknowledgements
This work was funded by grants P15475 and P17681
from the Austrian Fonds zur Fo
¨
rderung der wissensc-
haftlichen Forschung to I.B.H.W. We also thank San-

dra Drozd, a previous project student in the
laboratory, for the initial cloning of the Caenorhabditis
gmd-1 and ger-1 cDNAs, and Dr Andreas Hofinger
for recording the NMR spectra.
References
1 Becker DJ & Lowe JB (2003) Fucose: biosynthesis and
biological function in mammals. Glycobiology 13, 41R–
53R.
2 Haltiwanger RS (2002) Regulation of signal transduc-
tion pathways in development by glycosylation. Curr
Opin Struct Biol 12, 593–598.
3 Shi S & Stanley P (2003) Protein O-fucosyltransferase 1
is an essential component of Notch signaling pathways.
Proc Natl Acad Sci USA 100, 5234–5239.
4 Sasamura T, Sasaki N, Miyashita F, Nakao S, Ishikawa
HO, Ito M, Kitagawa M, Harigaya K, Spana E, Bilder
D, et al. (2003) neurotic, a novel maternal neurogenic
gene, encodes an O-fucosyltransferase that is essential
for Notch–Delta interactions. Development 130, 4785–
4795.
5 Okajima T & Irvine KD (2002) Regulation of notch sig-
naling by O-linked fucose. Cell 111, 893–904.
6 Menzel O, Vellai T, Takacs-Vellai K, Reymond A, Mu-
eller F, Antonarakis SE & Guipponi M (2004) The Cae-
norhabditis elegans ortholog of C21orf80, a potential
new protein O-fucosyltransferase, is required for normal
development. Genomics 84, 320–330.
7 Maly´ P, Thall AD, Petryniak B, Rogers GE, Smith PL,
Marks RM, Kelly RJ, Gersten KM, Cheng GY,
Saunders TL, et al. (1996) The a(1,3)-Fucosyltransferase

Fuc-TVII controls leukocyte trafficking through an
essential role in L-, E-, and P-selectin ligand biosynthe-
sis. Cell 86, 643–653.
8 Paschinger K, Fabini G, Schuster D, Rendic D & Wil-
son IBH (2005) Definition of immunogenic carbohy-
drate epitopes. Acta Biochim Pol 52, 629–632.
9 Fabini G, Freilinger A, Altmann F & Wilson IBH
(2001) Identification of core a1,3-fucosylated glycans
and the requisite fucosyltransferase in Drosophila mel-
anogaster. Potential basis of the neural anti-horseradish
peroxidase epitope. J Biol Chem 276, 28058–28067.
10 Paschinger K, Rendic D, Lochnit G, Jantsch V &
Wilson IBH (2004) Molecular basis of anti-horseradish
peroxidase staining in Caenorhabditis elegans. J Biol
Chem 279, 49588–49598.
11 Rendic D, Linder A, Paschinger K, Borth N, Wilson
IBH & Fabini G (2006) Modulation of neural carbohy-
drate epitope expression in Drosophila melanogaster
cells. J Biol Chem 281, 3343–3353.
12 Tonetti M, Sturla L, Bisso A, Zanardi D, Benatti U &
De Flora A (1998) The metabolism of 6-deoxyhexoses
in bacteria and animal cells. Biochimie 80, 923–931.
13 Puglielli L & Hirschberg CB (1999) Reconstitution,
identification, and purification of the rat liver golgi
membrane GDP-fucose transporter. J Biol Chem 274,
35596–35600.
14 Sullivan FX, Kumar R, Kriz R, Stahl M, Xu GY,
Rouse J, Chang XJ, Boodhoo A, Potvin B & Cumming
DA (1998) Molecular cloning of human GDP mannose
4,6-dehydratase and reconstitution of GDP-fucose

biosynthesis in vitro. J Biol Chem 273, 8193–8202.
15 Ohyama C, Smith PL, Angata K, Fukuda MN, Lowe
JB & Fukuda M (1998) Molecular cloning and expres-
sion of GDP-D-mannose-4,6-dehydratase, a key enzyme
for fucose metabolism defective in Lec13 cells. J Biol
Chem 273, 14582–14587.
16 Tonetti M, Sturla L, Bisso A, Benatti U & De Flora A
(1996) Synthesis of GDP-L-fucose by the human FX
protein. J Biol Chem 273, 27274–27279.
17 Bonin CP, Potter I, Vanzin GF & Reiter W-D (1997)
The MUR1 gene of Arabidopsis thaliana encodes an iso-
form of GDP-D-mannose-4,6-dehydratase, catalyzing
the first step in the de novo synthesis of GDP-L-fucose.
Proc Natl Acad Sci USA 271, 2085–2090.
18 Bonin CP, Freshour G, Hahn MG, Vanzin GF & Reiter
W-D (2003) The GMD1 and GMD2 genes of Arabidop-
sis encode isoforms of GDP-D-mannose 4,6-dehydratase
with cell type-specific expression patterns. Plant Physiol
132, 883–892.
19 Bonin CP & Reiter W-D (2000) A bifunctional
epimerase-reductase acts downstream of the MUR1 gene
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2254 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS
product and completes the de novo synthesis of GDP-L-
fucose in Arabidopsis. Plant J 21, 445–454.
20 Andrianopoulos K, Wang L & Reeves PR (1998) Identi-
fication of the fucose synthetase gene in the colanic acid
gene cluster of Escherichia coli K-12. J Bacteriol 180,
998–1001.
21 Ja

¨
rvinen N, Ma
¨
ki M, Ra
¨
bina
¨
J, Roos C, Mattila P &
Renkonen R (2001) Cloning and expression of Helico-
bacter pylori GDP-L-fucose synthesising enzymes
(GMD and GMER) in Saccharomyces cerevisiae. Eur J
Biochem 268, 6458–6464.
22 Wu B, Zhang Y & Wang PG (2001) Identification and
characterisation of the GDP-D-mannose 4,6-dehydra-
tase and GDP-L-fucose synthetase in a GDP-L-fucose
biosynthetic gene cluster from Helicobacter pylori.
Biochem Biophys Res Commun 285, 364–371.
23 Tonetti M, Zanardi D, Gurnon JR, Fruscione F, Armir-
otti A, Damonte G, Sturla L, De Flora A & van Etten JL
(2003) Paramecium bursaria Chlorella virus 1 encodes two
enzymes involved in the biosynthesis of GDP-L-fucose
and GDP-D-rhamnose. J Biol Chem 278, 21559–21565.
24 Reiter WD, Chapple CCS & Somerville CR (1993)
Altered growth and cell walls in a fucose-deficient
mutant of Arabidopsis. Science 261, 1032–1035.
25 Ripka J, Adamany A & Stanley P (1986) Two chinese
hamster ovary glycosylation mutants affected in the
conversion of GDP-Mannose to GDP-Fucose. Arch
Biochem Biophys 249, 533–545.
26 Reitman ML, Trowbridge IS & Kornfeld S (1980)

Mouse lymphoma cell lines resistant to pea lectin are
defective in fucose metabolism. J Biol Chem 255, 9900–
9906.
27 Smith PL, Myers JT, Rogers CE, Zhou L, Petryniak B,
Becker DJ, Homeister JW & Lowe JB (2002) Condi-
tional control of selectin ligand expression and global
fucosylation events in mice with a targetted mutation at
the FX locus. J Cell Biol 158, 801–815.
28 Coyne MJ, Reinap B, Lee MM & Comstock LE (2005)
Human symbionts use a host-like pathway for surface
fucosylation. Science 307, 1778–1781.
29 Lamrabet Y, Bellogı
´
n RA, Cubo T, Espuny R, Gil A,
Krishnan HB, Megias M, Ollero FJ, Pueppke SG, Ruiz-
Sainz JE, et al. (1999) Mutation in GDP-fucose synthe-
sis genes of Sinorhizobium fredii alters nod factors and
significantly decreases competitiveness to nodulate
soybeans. Mol Plant-Microbe Interact 12, 207–217.
30 Gonzales-Yanes B, Mandell RB, Girard M, Henry S,
Aparicio O, Gritzali M, Brown RD, Erdos GW &
West CM (1989) The spore coat of a fucosylation
mutant in Dicytostelium discoideum. Dev Biol 133,
576–587.
31 Karsan A, Cornejo CJ, Winn RK, Schwartz BR, Way
W, Lannir N, Gershoni-Baruch R, Etzioni A, Ochs HD
& Harlan JM (1998) Leukocyte Adhesion Deficiency
Type II is a generalized defect of de novo GDP-fucose
biosynthesis: endothelial cell fucosylation is not required
for neutrophil rolling on human nonlymphoid endothe-

lium. J Clin Invest 101, 2438–2445.
32 Sturla L, Etzioni A, Bisso A, Zanardi D, De Flora G,
Silengo L, De Flora A & Tonetti M (1998) Defective
intracellular activity of GDP-D-mannose-4,6-dehydra-
tase in leukocyte adhesion deficiency type II syndrome.
FEBS Lett 429, 274–278.
33 Lu
¨
bke T, Marquardt T, von Figura K & Ko
¨
rner C
(1999) A new type of carbohydrate-deficient glyco-
protein syndrome due to a decreased import of GDP-
fucose into the Golgi. J Biol Chem 274, 25986–25989.
34 Lu
¨
hn K, Wild MK, Eckhardt M, Gerardy-Schahn R &
Vestweber D (2001) The gene defective in leukocyte
adhesion deficiency II encodes a putative GDP-fucose
transporter. Nature Genet 28, 69–72.
35 Noda K, Miyoshi E, Gu J, Gao C-X, Nakahara S, Kit-
ada T, Honke K, Suzuki K, Yoshihara H, Yoshikawa
K, et al. (2003) Relationship between elevated FX
expression and increased production of GDP-L-fucose,
a common donor substrate for fucosylation in human
hepatocellular carcinoma and hepatoma cell lines.
Cancer Res 63, 6282–6289.
36 Roos C, Kolmer M, Mattila P & Renkonen R (2002)
Composition of Drosophila melanogaster proteome
involved in fucosylated glycan metabolism. J Biol Chem

277, 3168–3175.
37 Nakayama K-i, Maeda Y & Jigami Y (2003) Interaction
of GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reduc-
tase with GDP-mannose-4,6-dehydratase stabilises the
enzyme activity for formation of GDP-fucose from
GDP-mannose. Glycobiology 13, 673–680.
38 Harper AD & Bar-Peled M (2002) Biosynthesis of
UDP-xylose. Cloning and characterization of a novel
Arabidopsis gene family, UXS, encoding soluble and
putative membrane-bound UDP-glucuronic acid decar-
boxylase isoforms. Plant Physiol 130, 2188–2198.
39 Albermann C, Distler J & Piepersberg W (2000) Pre-
parative synthesis of GDP-b-L-fucose by recombinant
enzymes from enterobacterial sources. Glycobiology 10,
875–881.
40 Rentmeister A, Hoh C, Weidner S, Dra
¨
ger G, Elling L,
Liese A & Wandrey C (2004) Kinetic examination and
simulation of GDP-b-L-fucose synthetase reaction using
NADPH or NADH. Biocatalysis and Biotransformation
22, 49–56.
41 Ginsburg V (1960) Formation of guanosine diphosphate
l-fucose from guanosine diphosphate d-mannose. J Biol
Chem 235, 2196–2201.
42 Broschat KO, Chang S & Serif G (1985) Purification
and characterisation of GDP-D-mannose 4,6-dehydra-
tase from porcine thyroid. Eur J Biochem 133, 397–401.
43 Chang S, Duerr B & Serif G (1988) An epimerase-
reductase in l-fucose synthesis. J Biol Chem 263, 1693–

1697.
S. Rhomberg et al. GDP-fucose biosynthesis in invertebrates
FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS 2255
44 Bisso A, Sturla L, Zanardi D, De Flora A & Tonetti M
(1999) Structural and enzymatic characterisation of
human recombinant GDP-D-mannose-4,6-dehydratase.
FEBS Lett 456, 370–374.
45 Menon S, Stahl M, Kumar R, Xu G-Y & Sullivan F
(1999) Sterochemical course and steady state mechanism
of the reaction catalysed by GDP-fucose synthetase
from Escherichia coli. J Biol Chem 274, 26743–26750.
46 Gokhale UB, Hindsgaul O & Palcic MM (1990) Chemi-
cal synthesis of GDP-fucose analogs and their utiliza-
tion by the Lewis a (1 fi 4) fucosyltransferase. Can J
Chem 68, 1063–1071.
47 Haslam SM & Dell A (2003) Hallmarks of Caenorhabdi-
tis elegans N-glycosylation: complexity and controversy.
Biochimie 85, 25–32.
48 Guerardel Y, Balanzino L, Maes E, Leroy Y, Codde-
ville B, Oriol R & Strecker G (2001) The nematode Cae-
norhabditis elegans synthesises unusual O-linked glycans:
identification of glucose-substituted mucin-type O-gly-
cans and short chondroitin-like oligosaccharides.
Biochem J 357, 167–182.
49 Ginsburg V & Kirkman HN (1958) Isolation of guano-
sine diphosphate fucose from Aerobacter aerogenes.
J Am Chem Soc 80, 3481.
50 Ginsburg V (1958) Formation of guanosine diphosphate
fucose from guanosine diphosphate mannose. JAm
Chem Soc 80, 4426.

51 Liao T-H & Barber GA (1972) Purification of guanosine
5¢-diphosphate d-mannose oxidoreductase from Phaseo-
lus vulgaris. Biochim Biophys Acta 276, 85–93.
52 Coffey JW, Miller ON & Dellinger OZ (1964) The meta-
bolism of l-fucose in the rat. J Biol Chem 239, 4011–4017.
53 Ishihara H & Heath EC (1968) The metabolism of l-
fucose III. The biosynthesis of guanosine diphosphate
l-fucose in porcine liver. J Biol Chem 243, 1110–1115.
54 Ishihara H, Massaro DJ & Heath EC (1968) The meta-
bolism of 1-fucose IV. The enzymatic synthesis of b-l-
fucose 1-phosphate. J Biol Chem 243, 1103–1109.
55 Miller EN, Rupp AL, Lindberg MK & Wiese TJ (2005)
Tissue distribution of l -fucokinase in rodents. Comp
Biochem Physiol B 140, 513–520.
56 Ma
¨
ki M, Ja
¨
rvinen N, Ra
¨
bina
¨
J, Roos C, Maaheimo H,
Mattila P & Renkonen R (2002) Functional expression
of Pseudomonas aeruginosa GDP-4-keto-6-deoxy-
D-mannose reductase which synthesises GDP-rhamose.
Eur J Biochem 269, 593–601.
57 Mulichak AM, Bonin CP, Reiter W-D & Garavito RM
(2002) Structure of the MUR1 GDP-mannose 4,6-dehy-
dratase from Arabidopsis thaliana: implications for

ligand binding and specificity. Biochemistry 41, 15578–
15589.
58 Somoza JR, Menon S, Schmidt H, Joseph-McCarthy D,
Dessen A, Stahl ML, Somers WS & Sullivan FX (2000)
Structural and kinetic analysis of Escherichia coli GDP-
mannose 4,6-dehydratase provides insights into the
enzyme’s catalytic mechanism and regulation by GDP-
fucose. Structure 8, 123–135.
59 Rosano C, Bisso A, Izzo G, Tonetti M, Sturla L, De
Flora A & Bolognesi M (2000) Probing the catalytic
mechanism of GDP-4-keto-6-deoxy-D-mannose
epimerase ⁄ reductase by kinetic and crystallographic
characterisation of site-specific mutants. J Mol Biol 303,
77–91.
60 Blanc G, Barakat A, Guyot R, Cooke R & Delseny M
(2000) Extensive duplication and reshuffling in the
Arabidopsis genome. Plant Cell 12, 1093–1101.
61 Vision TJ, Brown DG & Tanksley SD (2000) The
origins of genomic duplications in Arabidopsis. Science
290, 2114–2117.
62 Okajima T, Xu A, Lei L & Irvine KD (2005) Chaper-
one activity of protein O-fucosyltransferase 1 promotes
notch receptor folding. Science 307, 1599–1603.
63 Simmer F, Moorman C, van der Linden AM, Kuijk E,
van den Berghe PVE, Kamath RS, Fraser AG, Ahringer
J & Plasterk RHA (2003) Genome-wide RNAi of C. ele-
gans using the hypersensitive rrf-3 strain reveals novel
gene functions. PloS Biol 1, 77–84.
64 Luo Y, Koles K, Vorndam W, Haltiwanger RS & Panin
VM (2006) Protein O-fucosyltransferase 2 adds O-fucose

to thrombospondin type 1 repeats. J Biol Chem 281,
9393–9399.
GDP-fucose biosynthesis in invertebrates S. Rhomberg et al.
2256 FEBS Journal 273 (2006) 2244–2256 ª 2006 The Authors Journal compilation ª 2006 FEBS