Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

Identification and expression analysis of an IL-18 homologue and its
alternatively spliced form in rainbow trout (
Oncorhynchus mykiss
)
Jun Zou
1
, Steve Bird
1
, Jonathan Truckle
1
, Niels Bols
2
, Mike Horne
3
and Chris Secombes
1
1
Scottish Fish Immunology Research Centre, School of Biological Sciences, University of Aberdeen, UK;
2
Department of Biology,
University of Waterloo, Ontario, Canada;
3
Novartis Aquahealth, Enterprise House, Springkerse Business Park, Stirling, UK
A homologue of interleukin 18 has been identified from
rainbow trout, Oncorhynchus mykiss. The trout IL-18 gene
spans 3.7 kb and consists of six exons and five introns,
sharing the same gene organization with its human coun-
terpart. The putative translated protein is 199 amino acids
in length with no predicted signal peptide. Analysis of the
multiple sequence alignment reveals a conserved ICE cut
site, resulting in a mature peptide of 162 amino acids. The

trout IL-18 shares 41–45% similarity with known IL-18
molecules and contains an IL-1 family signature motif. It is
constitutively expressed in a wide range of tissues including
brain, gill, gut, heart, kidney, liver, muscle, skin and spleen.
Transcription is not modulated by lipopolysaccharide,
poly(I:C) or trout recombinant IL-1b in primary head kid-
ney leucocyte cultures and RTS-11 cells, a macrophage cell
line. However, expression is downregulated by lipopoly-
saccharide and rIL-1b in RTG-2 cells, a fibroblast-like cell
line. An alternatively spliced form of IL-18 mRNA has also
been found and translates into a 182 amino acid protein
with a 17 amino acid deletion in the precursor region of the
authentic form. This alternatively spliced form is also widely
expressed although much lower than the authentic form.
Interestingly, its expression is upregulated by lipopolysac-
charide and poly(I:C), but is not affected by rIL-1b in
RTG-2 cells. The present study suggests that alternative
splicing may play an important role in regulating IL-18
activities in rainbow trout.
Keywords: interleukin 18; alternative splicing; expression;
rainbow trout.
In the last few years, major advances have occurred in the
discovery of fish cytokine genes. This has been attributed
mainly to the enormous progress made in genome projects
for the Fugu and zebrafish genome, and the large increase of
fish EST (expressed sequence tag) entries in the Genebank.
To date, at least a dozen cytokine homologues have been
cloned in fish including TGF-b [1], IL-1b [2,3], TNF-a [4–7],
IL-10 [8], IL-12 [9], type I interferons [10–12], and several
chemokines such as IL-8 [13,14], cIP-10[15],CK-1[16]and

CK-2 [17].
Interleukin (IL) 18, produced mainly by activated macro-
phages, is an important cytokine with multiple functions in
innate and acquired immunity [18–20]. One of the primary
biological properties is to induce interferon gamma (IFN-c)
synthesis in Th1 and NK cells in synergy with IL-12 [21,22].
It promotes T and NK cell maturation, activates neutro-
phils and enhances Fas ligand-mediated cytotoxicity [23–25].
IL-18 structurally belongs to the IL-1 family but has low
sequence homology with IL-1a,IL-1b and the IL-1 receptor
antagonist (IL-Ra). It resembles IL-1b in many ways such
as possessing a similar b-trefoil structure and secretion
process but has distinct biological functions [18,26]. Like
IL-1b, it is synthesized as an inactive precursor of approxi-
mately 24 kDa and is stored intracellularly. Activation and
secretion of IL-18 is mainly effected through specific
cleavage of the precursor after D35 by caspase 1, also
termed IL-1b converting enzyme (ICE), which is believed
to be one of the key processes regulating IL-18 bioactivity
[27,28]. Some other enzymes, including caspase 3 and
neutrophil proteinase 3, also cleave the IL-18 precursor to
generate active or inactive mature molecules [29,30]. A
recently identified IL-18 binding protein (IL)18 BP), a
specific natural antagonist, inhibits IL-18 activities by
competing with the ligand for binding to the IL-18 receptors
[31,32]. IL-18 expression is also regulated at the gene level.
In mouse, there are at least two active promoters, one
constitutively drives gene expression and the other
up-regulates expression in response to stimuli such as
lipopolysaccharide (LPS) [33].

A nonmammalian IL-18 homologue has been sequenced
in birds, sharing approximately 30% amino acid identity
with the other characterized mammalian IL-18s [34,35].
Recently, a fish IL-18 homologue was identified by analy-
sing the Fugu genome database [36]. In contrast to IL-1b
where the ICE cut site is absent in most of the nonmam-
malian species [2], the ICE cut site is well-conserved in the
avian and Fugu IL-18s. Although native avian IL-18 has
Correspondence to C. J. Secombes, Scottish Fish Immunology
Research Centre, School of Biological Sciences, University of
Aberdeen, Zoology Building, Tillydrone Avenue, Aberdeen AB24
2TZ, UK. Tel.: + 44 1224 272872, Fax: + 44 1224 272396,
E-mail:
Abbreviations: IL, interleukin; IL-1Ra, interleukin 1 receptor
antagonist; ICE: interleukin 1b converting enzyme; IL)18 BP,
interleukin 18 binding protein; IFN, interferon; c-IP10, interferon
gamma induced protein 10; CK, chemokine; NK, natural killer;
Th1, T-helper type 1; CD4, cluster of differentiation antigen 4;
EST, expressed sequence tag; LPS, lipopolysaccharide; poly(I:C),
polyinosinic-cytidylic acid.
(Received 12 January 2004, revised 5 March 2004,
accepted 22 March 2004)
Eur. J. Biochem. 271, 1913–1923 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04101.x
not yet been purified, the bacteria-derived mature peptide of
chicken IL-18 has been shown to induce IFN-c synthesis in
cultured primary chicken spleen cells [35]. More recently, it
has been demonstrated that IL-18 promotes proliferation of
CD4+ T cells in chicken, suggesting a Th1-like system
is operating in birds [37]. In the present study, we have
identified an IL-18 homologue from rainbow trout, Onc-

orhynchus mykiss, and investigated where this molecule is
expressed. In addition, we have discovered an alternative
splicing form of the IL-18 mRNA that may have an
important role in regulating IL-18 expression and process-
ing in this species, the first report of such a phenomenon for
this cytokine.
Materials and methods
Cloning and sequencing of genomic DNA and cDNA
All products amplified by PCR were ligated into the
pGEM-Teasy vector (Promega) and transformed into
TAM competent cells (ActiveMotif, Belgium). Plasmid
DNA was purified using a plasmid miniprep kit (Qiagen)
and sequenced by MWG-Biotech (Germany).
By searching EST databases, several EST clones
(BX306040, BX316393, BX298965, BX316008, BX306507,
BX311712, BX306039, BX306506, BX311711, BX319716)
with homology to mammalian IL-18 protein sequences were
retrieved. Specific primers (Table 1) were synthesized to
obtain the full length cDNA sequence using the RACE–
PCR approach. Briefly, total RNA was extracted from
the rainbow trout RTS-11 cell line (provided by N. Bols)
[38] stimulated with 20 lgÆmL
)1
poly(I:C) (Sigma) for 4 h
and reverse-transcribed into cDNA with primer adapter
oligo(dT). 3¢-RACE–PCR was performed using primers F1/
ADAP and F2/ADAP to amplify the full length sequence of
the coding region and the 3¢-UTR [39]. For 5¢-RACE,
cDNA was tagged with oligo(dC)n at the 5¢-end with
terminal deoxynucleotidyl transferase (Promega) and used

as template for seminested PCR amplification with primers
oligo-dG/R2 and oligo-dG/R3 [39]. The cycling programs
for RACE–PCR were 5 cycles of 94 °C for 20 s, 72 °C
for 2 min; 32 cycles of 94 °Cfor20s,62°Cfor20s,72°C
for 45 s; followed by 1 cycle of 72 °C for 10 min. Twenty
micolitres of PCR products were loaded on a 1.5% (w/v)
agarose gel and visualized by staining the gel in 0.1 lgÆmL
)1
ethidium bromide.
For genomic cloning, rainbow trout tail fin was collected
and incubated with DNA lysis buffer (100 m
M
Tris/Cl
pH 8.5, 5 m
M
EDTA, 0.2% (w/v) SDS, 200 m
M
NaCl,
100 lgÆmL
)1
Proteinase K (Bioline), 20 lgÆmL
)1
RNase A)
(Sigma) at 52 °C for 3 h. The lysate was extracted twice with
an equal volume of phenol/chloroform (24 : 1, v/v) and
once with chloroform. Genomic DNA was precipitated
with two volumes of cold ethanol, washed with 70% (v/v)
ethanol, and dissolved in TE buffer (10 m
M
Tris, 1 m

M
EDTA, pH 8.0). Using genomic DNA as template, PCR
was performed to obtain the full length sequence of the
IL-18 gene using primers F1 and RR1 and the PCR
products sequenced. The PCR cycling programs for
genomic PCR were 1 cycle of 94 °C for 3 min; 30 cycles
of 94 °Cfor20s,60°C for 20 s, 72 °C for 3 min; followed
by1cycleof72°C for 10 min. The PCR products were
checked by electrophoresis as described above.
Sequencing analysis
BLAST was used for the identification of homologous
sequences in the GenBank databases. Multiple alignment
was generated using the
CLUSTAL W
program (version 1.83)
[40]. A phylogenetic tree was constructed with the
PHYLIP
package (version 1.1) [41] and visualized using
TREEVIEW
(version 1.6.6) [42]. Direct comparison of two sequences
was performed using the
GAP
analysis program within
the Wisconsin Genetics Computer Group Sequence Analysis
Software Package (version 10.0) [43]. Signal leader peptide
prediction was made using the
SIGNALP
program (version
2.0) [44].
RT-PCR studies of

IL-18
expression in rainbow trout
To determine tissue distribution of IL-18 expression in
healthy fish (Almond Bank Fish Farm, Perthshire,
Scotland) killed by severance of the spinal cord fol-
lowing anaesthesia, total RNA was extracted from tissues
Table 1. Primer sequences and use.
Primer name Sequence (5¢)3¢) Use
Adaptor oligo(dT) GGCCACGCGTCGACTAGTAC(dT)
17
3¢-RACE
ADAP GGCCACGCGTCGACTAGTAC 5¢-RACE
Oligo(dG) GGGGGGIGGGIIGGGIIG 5¢-RACE
F1 GCAATGCGACCGAGTGTCGGAG 3¢-RACE
Gene organization
F2 CGACATTTCCGAGTGACGTTC 3¢-RACE
R2 CCTTCAACACCCTGACTTCAC 5¢-RACE
R3 ATGTCCTCCTTGTCTACTACC 5¢-RACE
EF1 AGCAGCTCCGAATGTAAGGTG IL-18A expression
EF2 GCTCCGAATTCGAACATGAC IL-18B expression
ER1 AGGCAAAGGTTGCTCCAGTG IL-18 expression
Actin-F ATGGAAGATGAAATCGCC Gene expression
Actin-R TGCCAGATCTTCTCCATG Gene expression
RR1 TGGTACCACTCAACATGTCAGTAAGCG Gene organization
1914 J. Zou et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Fig. 1. Genomic DNA and the deduced protein
sequence of rainbow trout IL-18. Exons and
introns are indicated in uppercase and lower-
case, respectively. Intron splicing signal motifs
are boxed and the polyadenylation signal

(ATTAAA) is underlined. The cytokine
instability motif (ATTTA) is in bold.
Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1915
including brain, gill, gut, heart, kidney, liver, muscle, skin
and spleen, using TRIZOL (Invitrogen) according to the
manufacturer’s instructions. The RNA was then reverse
transcribed into cDNA using Bioscript (Bioline) according
to the manufacturer’s instructions. PCR was performed to
detect IL-18A and IL-18B expression using primers EF1/
ER1 and EF2/ER1 in a single PCR reaction. Three fish
were used in the study.
The rainbow trout RTS-11 macrophage cell line and
RTG-2 cell line were maintained as described previously
[38,45]. The cells were passaged two days before stimulation
with 10 lgÆmL
)1
LPS (E.coli 0127:B8, Sigma), 50 lgÆmL
)1
poly(I:C) (Sigma), or 100 ngÆmL
)1
recombinant trout IL-1b
(rIL-1b) [46] for 4 h, the peak time of gene expression for
many of the cytokine genes studied in trout to date [5,46].
Total RNA was extracted using TRIZOL (Invitrogen) and
reverse transcribed into cDNA using Bioscript (Bioline) as
described above. The sythesized cDNA was checked and
titrated by PCR using b-actin primers to ensure equal
amount of templates were used for quantitation of gene
expression. Two pairs of primers, EF1/ER1 and EF2/ER1
were used in a single PCR reaction, to determine the

expression level of IL-18A and IL-18B, respectively. Five
microlitres of cDNA templates was used for a 50 lLPCR
reaction. The PCR cycling programs for gene expression
study were 1 cycle of 94 °C for 3 min; 35 cycles of 94 °Cfor
20 s, 60 °C for 20 s, 72 °C for 20 s; followed by 1 cycle of
72 °C for 10 min. Twenty microlitres of PCR products
were loaded on a 2.0% (w/v) agarose gel and visualized
by staining the gel in 0.1 lgÆmL
)1
ethidium bromide. The
relative levels of mRNA were quantified by densitometric
scanning of the ethidium bromide stained gels, using an
Ultra Violet Products Ltd gel imaging system and UVP
GELWORKS ID
advanced software, and expressed relative to
the b-actin transcript level.
Modulation of IL-18 expression was also studied in trout
head kidney leucocytes. The head kidney leucocytes from
three fish were isolated using a 51% (w/v) percoll gradient as
described by Hardie et al. [47]. Cells were seeded at a
density of 2.0 · 10
6
cells per culture flask in a final volume
of 50 mL medium and cultured at 22 °C in L15 medium
(Gibco) containing 2% (v/v) fetal bovine serum (Sigma),
penicillin (100 lgÆmL
)1
) (Gibco), and streptomycin (100
unitsÆmL
)1

) (Gibco). The cells were either unstimulated,
stimulated for 4 h with 20 lgÆmL
)1
LPS, 100 ngÆmL
)1
rIL-
1b or a combination of 20 lgÆmL
)1
LPS and 100 ngÆmL
)1
rIL-1b. Total RNA was extracted and RT-PCR performed
as described previously to determine IL-18 expression.
Results are shown from two of the three fish investigated.
Results
Cloning and sequence analysis
By analysing EST databases, several salmon ESTs were
found with 25–29% amino acid identity to known IL-18
molecules by BLAST searching. Thus, primers were
synthesized to obtain the full length cDNA sequence by
RACE–PCR using cDNA generated from poly(I:C) stimu-
lated RTS-11 cells. Subsequently, the full length sequence of
genomic DNA was obtained by PCR using primer F1/RR1
(Fig. 1). The trout IL-18 gene spans approximately 3.7 kb
and is much smaller than its human counterpart
(> 12.7 kb) but larger than that in the pufferfish species
(Fig. 2). It has a similar genomic organization to the human
IL-18 gene, consisting of six exons and five introns. The
Fig. 2. Comparison of the genomic organization of IL-18 and IL-1b genes in human, rainbow trout and the predicted Fugu/tetraodon organization.
GenBank accession numbers: human IL-18, E17138, Fugu IL-18, AJ548845; tetraodon IL-18, AJ555460. The size of the coding region in the exons
is indicated. Open boxes represent untranslated regions, whilst closed boxes represent coding regions.

1916 J. Zou et al.(Eur. J. Biochem. 271) Ó FEBS 2004
intron sizes of the IL-18 genes differ among species but the
size of the coding region within the exons was similar
(Fig. 2). For example, an extremely small exon (exon 3 in
trout), consisting of 12 bp, is present in both the fish and
human IL-18 genes. The trout IL-18 has a very short
3¢-UTR of 234 bp, containing a single mRNA instability
Fig. 3. Multiple alignment of the known IL-18 molecules. Conserved residues shared with the putative trout peptide are indicated with a dash (–) and
gaps in the alignment are represented with Ô*Õ. Conservation of amino acid identity is indicated in the consensus line with Ô*Õ whereas Ô:Õ and Ô.Õ
indicate high and low levels of amino acid similarity, respectively. Arrows indicate the potential ICE cleavage site (fl) and the potential alternative
cleavage site (
). The 12 b-sheets (solid horizontal bars) and two a-helices (open horizontal bars) in human IL-18 [26] are shown above the alignment.
The signature sequence is in bold and highlighted. GenBank accession numbers of the IL-18 genes are as follows: cow, Q9TU73; dog, Q9XSR0;
Fugu, AJ548844; horse, Q9XSQ7; human, Q14116; mouse, P70380; pig, O19073; rat, P97636; chicken, AJ277865; tetraodon, AJ555460.
Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1917
motif (ATTTA) shortly after a nonconventional polyade-
nylation signal sequence (ATTAAA).
The deduced trout IL-18 precursor consists of 199 amino
acids with no typical signal peptide detected using the
SIGNALP
prediction program. Analysis of multiple alignment
demonstrated a well conserved ICE cut site signature
(LXXD), generating a 167 amino acid putative mature
peptide for the trout IL-18 (Fig. 3). Compared to trout
IL-1b, as another member of the IL-1 family known in
trout, it has a shorter N-terminal precursor region
(32 amino acids). The putative trout IL-18 mature peptide
is cysteine rich, consisting of seven cysteine residues, more
than that in any known mature molecule to date,
and lacks any putative N-glycosylation sites. An IL-1

family-like signature sequence, NH
2
-FFMEVIPGTSQYR
FQSSLRTSSYLS-COOH, located near the C terminus, is
very similar to the IL-1 family like signature, F-X
10
-F-X-
S-[ALV]-X
2
-[AP]-X
2
-[FYLIV]-[LIV]-X-T [2], and the
signature sequence of F-[FY]-X
11-13
-[FL]-X
2
-S-[SL]-X
4
-
[FY]-L-[SA] appears to be unique for IL-18 as shown in
the multiple alignment.
The trout IL-18 precursor shares 41–46% similarity with
the IL-18 proteins from mammals, 42.9% with chicken,
40.5% with Fugu, and 42.4% with tetraodon (Table 2). It
has lower similarity with the other members of the IL-1
family; 30–38% with IL-1a, 26–36% with IL-1b and  30%
with IL-1Ra (data not shown). To further analyse the
relationship of trout IL-18 with the other three members of
the IL-1 family, IL-1a,IL-1b, and IL-1Ra, a phylogenetic
tree was constructed using the neighbor-joining method,

which revealed that the trout IL-18 molecule grouped
closely with other known IL-18 s (data not shown), and
away from IL-1a,IL-1b and IL-1Ra.
Alternative splicing
Using cDNA generated from the RTS-11 cells as template,
PCR with primers F1 and ADAP generated two PCR
products of approx. 950 bp and 1000 bp. Sequence com-
parison of the two PCR products indicated they were
identical except for a 51 nucleotide gap near the 5¢ end,
translating two proteins of 199 amino acids and 182 amino
acids, respectively (termed IL-18A and IL-18B) (Fig. 4).
The 17 amino acid deletion occurred within the putative
32 amino acid precursor region as shown in the multiple
alignment, suggesting the protein may be produced as an
intracellular form or processed at a cut site which is present
at a location different from the conserved ICE cut site
(LXXD) (Fig. 3). In fact, further analysis of the primary
sequence revealed a region (LVVD) 25 amino acid down-
stream of the predicted ICE cut site (LESD) which was quite
similar to the signature motif for ICE cleavage, suggesting
IL-18B could also be cleaved and secreted.
Fig. 4. Alternative splicing of the IL-18 gene in rainbow trout. (A) An
alternative mRNA splicing site is present in exon 2 of the trout IL-18
gene. Arrows indicate the splicing sites and the boxed letters represent
the splicing motif sequences. (B) The two transcripts, IL-18A and
IL-18B, resulting from the normal and the alternative splicing, and the
deduced amino acid sequences.
Table 2. Protein similarity and features of trout IL-18 with IL-18 from other species. Similarity was obtained by direct comparison of two IL-18
precursor sequences using the
GAP

analysis program. The mature peptide for some IL-18 molecules was predicted by the multiple alignments
showing the conserved ICE cut site.
Species
Similarity
(%)
Precursor length
(amino acids)
Mature peptide length
(amino acids)
N-terminal amino acid
of mature peptide
Cow 42.0 193 157 H
Dog 41.4 193 157 Y
Horse 45.6 193 157 Y
Human 42.1 193 157 Y
Mouse 44.3 192 157 N
Pig 42.6 192 157 Y
Rat 41.5 194 158 H
Chicken 42.9 198 160 A
Fugu 40.5 189 158 G
Tetraodon 42.4 189 158 S
Trout 100 199 168 D
1918 J. Zou et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Expression studies
To determine the tissue distribution of IL-18 expression,
RT-PCR was performed using two pairs of primers,
EF1/ER1 and EF2/ER1, specifically detecting IL-18A and
IL-18B expression in a single tube reaction. Figure 5 shows
that both IL-18A and IL-18B were globally expressed in all
the tissues examined, including brain, gill, gut, heart, kidney,

liver, muscle, skin, and spleen, although a lower expression
level was observed for IL-18B. Higher levels of expression
were detected in gut, heart and kidney.
Modulation of IL-18 expression was studied in primary
cultured head kidney leucocytes, macrophages (RTS-11)
and fibroblast cells (RTG-2). As shown in Fig. 6, both
IL-18A and IL-18B were constitutively expressed in the
RTS-11 cells (A) and the head kidney leucocytes (C). The
transcriptional level was not markedly affected by stimula-
tion with LPS, poly(I:C) or rIL-1b, although a higher
expression level was seen for both forms after stimulation of
the head kidney leucocytes with the LPS and rIL-1b
mixture. A higher expression level of IL-18A was seen
relative to IL-18B in stimulated and unstimulated head
kidney leucocytes and RTS-11 cells, being  2.6 times
increased according to the densitometric scanning of the
ethidium bromide stained gel. In contrast, transcription of
IL-18A and IL-18B in the RTG-2 cells was differentially
regulated by LPS, poly(I:C) and rIL-1b. In the unstimulated
RTG-2 cells, both IL-18 transcripts were constitutively
synthesized with a higher expression of IL-18A being
observed (ratio of IL18A/IL-18B  1.4) as in RTS-11 cells.
Stimulation with LPS or poly(I:C) inhibited IL-18A
expression but enhanced IL-18B transcription, such that
IL-18B rather than IL-18A was dominantly expressed after
stimulation with LPS (IL-18B/IL-18A  3.0) or poly(I:C)
(IL-18B/IL-18A  1.7). rIL-1b decreased expression of
IL-18A andtoalesserextentIL-18B mRNA levels, such
that again the ratio ( 1.9 times) was in favour of IL-18B.
Discussion

In the present study, we have identified an IL-18 homologue
from rainbow trout by analysing the salmonid EST
database. IL-18 is a member of the IL-1 family including
IL-1a,IL-1b, and the IL-1 receptor antagonist (IL-1Ra).
Although it has low sequence homology with other
members of the family, it contains the IL-1 like family
signature and shares a three dimensional b-trefoil structure
with IL-1b [26]. The identified trout IL-18 has higher
(approx. 41–46%) homology with other known IL-18
molecules than with the three other IL-1 family members.
Despite having the same number of exons and introns as the
trout IL-1b gene, the trout IL-18 gene resembles IL-18 genes
from human, Fugu, and tetraodon, rather than the IL-1b
genes, in terms of exon/intron organization, the size of
coding exons and the precursor molecules (Fig. 2). The
relationship between the trout IL-18 with the IL-1 family
members is supported further by phylogenetic tree analysis,
where the trout IL-18 molecule branched with other known
IL-18 molecules (data not shown).
Like IL-1b, IL-18 is synthesized as a biologically inactive
precursor in the cytoplasm and must be cleaved by ICE to
generate the active mature peptide. The sequence data of the
IL-1b homologues derived from nonmammalian species
indicates that the ICE cut site is absent in many nonmam-
malian species [2]. However, a recent study does suggest fish
IL-1b is cleaved in macrophages although where it is cleaved
and the mechanism involved is still undetermined [46]. By
analysing the multiple alignment of IL-18 molecules, an ICE
cleavage motif (LXXD) conserved from lower vertebrates
to mammals is evident (Fig. 3), strongly suggesting ICE

may be involved in processing of IL-18 in lower vertebrates.
A stretch of sequence LXXD(74–77; human) similar to the
ICE cleavage motif was also seen at a short distance
downstream of the LXXD(33–36) motif in some of the
IL-18s including human, mouse, rat, Fugu, tetraodon and
trout. It is possible that this LXXD(74–77) motif could be
used as an alternative cut site for ICE or other proteases
such as caspase 3. Previous studies in humans demonstrated
that IL-18 was cleaved not only by ICE at DY(36–37) to
release bioactive mature IL-18 but also by caspase 3 at
DS(71–72) and DN(76–77) to generate biologically inactive
products [29]. This is not surprising because cleavage at such
sites leads to proteins lacking the first two b-sheets (Fig. 3).
In addition, neutrophil proteinase 3 can cleave IL-18 in
human epithelial cells, leading to secretion of bioactive
IL-18 [30]. Interestingly, LVVD(54–57) in trout IL-18 is
aligned well with the alternative cut site D76 in the human
molecule in the multiple alignment (Fig. 3).
Fig. 5. Tissue distribution of IL-18 expression in healthy fish. The IL-18 mRNA levels were expressed as a ratio relative to b-actin mRNA levels after
densitomitric scanning of the gels stained with ethidium bromide. The data presented are for a representative experiment of three fish examined.
Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1919
An alternatively spliced transcript of IL-18 was detected
by RT-PCR in both RTS-11 and RTG-2 cells. This is the
first report of an alternative spliced form for IL-18 although
several alternative IL-18 proteins were reported recently in
human keratinocytes and blood plasma [48,49]. As shown in
Fig. 4, an mRNA splicing signal motif (gtaaag) was present
in the coding region of exon 2, resulting in partial deletion
of exon 2. However, this deletion did not disrupt protein
translation and thus the alternative spliced mRNA

remained in-frame and potentially translated into a 182
amino acid protein (IL-18B), 17 amino acids shorter than
the above form. The 17 amino acid deletion occurs in the
precursor region, which may affect the IL-18B cleavage.
Furthermore, no signal leader peptide was predicted for the
Fig. 6. RT-PCR analysis of IL-18 expression in rainbow trout cell lines and cultured primary head kidney leucocytes. The RTS-11 (A), RTG-2 cells (B)
and head kidney leucocytes (C) were stimulated with LPS, poly(I:C), rIL-1b or a mixture of LPS and rIL-1b as described in the materials and
methods. In C, two of the three fish investigated are shown and the average ratio of the IL-18 expression relative to b-actin presented.
1920 J. Zou et al.(Eur. J. Biochem. 271) Ó FEBS 2004
IL-18B molecule, excluding the possibility that it could be
released through a conventional secretion pathway. The two
potential protease cut sites, LESD and LVVD, were
retained in the IL-18B molecule, with the latter possibly a
more likely cut site based on the precursor length which
would be similar to that in known IL-18. However, it is also
possible that IL-18B could be synthesized as an intracellular
form.
A high level of constitutive expression of IL-18 was
observed in all tissues of healthy fish, including brain, gill,
gut, heart, kidney, liver, muscle, skin and spleen. This is in
agreement with studies in mammals showing that IL-18
was constitutively expressed in a wide range of cell types
including immune and nonimmune cells and stored as an
inactive precursor in the cytoplasm [50]. Active IL-18 is
secreted only after stimulation with appropriate stimuli and
activity is regulated at multiple levels. ICE processing of the
inactive IL-18 precursor is believed to be crucial in
mediating IL-18 secretion at the post-translational level.
In addition, circulating IL-18 can be antagonized by the
IL)18

BP
, which competes with the ligand for receptor
binding. In the trout macrophages and head kidney cells,
both the authentic and the alternatively spliced IL-18 were
constitutively expressed and not affected by stimulation
with LPS, poly(I:C) or rIL-1b, suggesting that IL-18
biological activities might be regulated in a similar way to
mammals in such cells. Surprisingly, in contrast to the head
kidney cells and the RTS-11 cells, differential expression
was seen for IL-18A and IL-18B in the RTG-2 cells after
stimulation, as seen with LPS and poly(I:C), which
significantly enhanced IL-18B expression whilst inhibiting
IL-18A expression. In mouse, IL-18 expression is con-
trolled by two promoters, one responsible for constitutive
expression and one for inducible expression [33]. It is
possible that synthesis of the two IL-18 transcripts are
initiated by two different promoters or regulated by
different elements in a single promoter. Thus, the present
study suggests that IL-18 production is mainly controlled
at the post-transcriptional level in trout macrophages whilst
in the RTG-2 cells, a fibroblast cell line, transcriptional
modulation is also important. Why IL-18A and IL-18B are
differentially regulated in such a different way in the
RTG-2 cells and how this affects IL-18 biological functions
will be of interest to pursue further. Perhaps, balancing the
expression ratio of the two IL-18 forms could be an
important mechanism in controlling IL-18 expression or
processing.
Interferon gamma (IFN-c), a Th1-type cytokine, has
been speculated to be present in lower vertebrates including

fish[51].However,todate,fishIFN-c has not yet been
isolated, although some of the associated factors such as the
receptors, the regulatory molecules and interferon-induced
proteins have been sequenced in fish in recent years [15,52].
It is known that IFN-c can be induced by two main
cytokines, IL-12 and IL-18. In chicken, the recombinant
IL-18 protein has been shown to induce IFN-c production
and promote proliferation of CD4+ T cells [37]. The
homologues for the two subunits of the IL-12 molecule have
recently been identified in the Japanese pufferfish [9]. All of
these studies, together with the finding of the trout IL-18 in
the present study, suggest the existence of the IFN-c
homologue in fish and perhaps a similar Th1-like network.
Acknowledgements
This work was funded by the Scottish Higher Education Funding
Council, a research contract from Novartis Aquahealth and a BBSRC
industrial case studentship to JT.
References
1. Hardie, L.J., Laing, K.J., Daniels, G.D., Grabowski, P.S.,
Cunningham,C.&Secombes,C.J.(1998)Isolationofthe
first piscine transforming growth factor beta gene: analysis
reveals tissue specific expression and a potential regulatory
sequence in rainbow trout (Oncorhynchus mykiss). Cytokine 10,
555–563.
2. Bird, S., Zou, J., Wang, T., Munday, B., Cunningham, C. &
Secombes, C.J. (2002) Evolution of interleukin-1b. Cytokine
Growth Factor Rev. 13, 483–502.
3.Zou,J.,Grabowski,P.S.,Cunningham,C.&Secombes,C.J.
(1999) Molecular cloning of interleukin 1b from rainbow trout
Oncorhynchus mykiss reveals no evidence of an ice cut site. Cyto-

kine 11, 552–560.
4. Bobe, J. & Goetz, F.W. (2001) Molecular cloning and expression
of a TNF receptor and two TNF ligands in the fish ovary. Comp
Biochem. Physiol. B Biochem. Mol. Biol. 129, 475–481.
5. Laing, K.J., Wang, T., Zou, J., Holland, J., Hong, S., Bols, N.,
Hirono, I., Aoki, T. & Secombes, C.J. (2001) Cloning and
expression analysis of rainbow trout Oncorhynchus mykiss tumour
necrosis factor-a. Eur. J. Biochem. 268, 1315–1322.
6. Zou,J.,Wang,T.,Hirono,I.,Aoki,T.,Inagawa,H.,Honda,T.,
Soma, G.I., Ototake, M., Nakanishi, T., Ellis, A.E. & Secombes,
C.J. (2002) Differential expression of two tumor necrosis factor
genes in rainbow trout, Oncorhynchus mykiss. Dev. Comp
Immunol. 26, 161–172.
7. Zou, J., Secombes, C.J., Long, S., Miller, N., Clem, L.W. &
Chinchar, V.G. (2003) Molecular identification and expression
analysis of tumor necrosis factor in channel catfish (Ictalurus
punctatus). Dev. Comp Immunol. 27, 845–858.
8. Zou, J., Clark, M.S. & Secombes, C.J. (2003) Characterisation,
expression and promoter analysis of an interleukin 10
homologue in the puffer fish, Fugu rubripes. Immunogenetics 55,
325–335.
9. Yoshiura, Y., Kiryu, I., Fujiwara, A., Suetake, H., Suzuki, Y.,
Nakanishi, T. & Ototake, M. (2003) Identification and char-
acterization of Fugu orthologues of mammalian interleukin-12
subunits. Immunogenetics 55, 296–306.
10. Altmann, S.M., Mellon, M.T., Distel, D.L. & Kim, C.H. (2003)
Molecular and functional analysis of an interferon gene from the
zebrafish, Danio rerio. J. Virol. 77, 1992–2002.
11. Long, S., Wilson, M., Bengten, E., Bryan, L., Clem, L.W., Miller,
N.W. & Chinchar, V.G. (2004) Identification of a cDNA encoding

channel catfish interferon. Dev. Comp Immunol. 28, 97–111.
12. Robertsen, B., Bergan, V., Rokenes, T., Larsen, R. & Albu-
querque, A. (2003) Atlantic salmon interferon genes: cloning,
sequence analysis, expression, and biological activity. J. Interferon
Cytokine Res. 23, 601–612.
13. Laing, K.J., Zou, J.J., Wang, T., Bols, N., Hirono, I., Aoki, T. &
Secombes, C.J. (2002) Identification and analysis of an interleukin
8-like molecule in rainbow trout Oncorhynchus mykiss. Dev. Comp
Immunol. 26, 433–444.
14. Najakshin, A.M., Mechetina, L.V., Alabyev, B.Y. & Taranin,
A.V. (1999) Identification of an IL-8 homolog in lamprey (Lam-
petra fluviatilis): early evolutionary divergence of chemokines. Eur.
J. Immunol. 29, 375–382.
15. Laing, K.J., Bols, N. & Secombes, C.J. (2002) A CXC chemokine
sequence isolated from the rainbow trout Oncorhynchus mykiss
resembles the closely related interferon-gamma-inducible
Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1921
chemokines CXCL9, CXCL10 and CXCL11. Eur. Cytokine Netw.
13, 462–473.
16. Dixon, B., Shum, B., Adams, E.J., Magor, K.E., Hedrick, R.P.,
Muir, D.G. & Parham, P. (1998) CK-1, a putative chemokine of
rainbow trout (Oncorhynchus mykiss). Immunol. Rev. 166,
341–348.
17. Liu, L., Fujiki, K., Dixon, B. & Sundick, R.S. (2002) Cloning
of a novel rainbow trout (Oncorhynchus mykiss) CC chemokine
with a fractalkine-like stalk and a TNF decoy receptor using
cDNA fragments containing AU-rich elements. Cytokine 17,
71–81.
18. Dinarello, C.A. & Fantuzzi, G. (2003) Interleukin-18 and
host defense against infection. J. Infect. Dis. 187 (Suppl. 2),

S370–S384.
19. Gracie, J.A., Robertson, S.E. & McInnes, I.B. (2003) Interleukin-
18. J. Leukoc. Biol. 73, 213–224.
20. Sugawara, I. (2000) Interleukin-18 (IL-18) and infectious diseases,
with special emphasis on diseases induced by intracellular patho-
gens. Microbes. Infect. 2, 1257–1263.
21. Micallef,M.J.,Ohtsuki,T.,Kohno,K.,Tanabe,F.,Ushio,S.,
Namba, M., Tanimoto, T., Torigoe, K., Fujii, M., Ikeda, M.,
Fukuda, S. & Kurimoto, M. (1996) Interferon-gamma-inducing
factor enhances T helper 1 cytokine production by stimulated
human T cells: synergism with interleukin-12 for interferon-c
production. Eur. J. Immunol. 26, 1647–1651.
22. Okamura, H., Nagata, K., Komatsu, T., Tanimoto, T., Nukata,
Y.,Tanabe,F.,Akita,K.,Torigoe,K.,Okura,T.&Fukuda,S.&
(1995) A novel costimulatory factor for gamma interferon
induction found in the livers of mice causes endotoxic shock.
Infect. Immun. 63, 3966–3972.
23. Dao, T., Mehal, W.Z. & Crispe, I.N. (1998) IL-18 augments
perforin-dependent cytotoxicity of liver NK-T cells. J. Immunol.
161, 2217–2222.
24. Leung,B.P.,Culshaw,S.,Gracie,J.A.,Hunter,D.,Canetti,C.A.,
Campbell, C., Cunha, F., Liew, F.Y. & McInnes, I.B. (2001) A
role for IL-18 in neutrophil activation. J. Immunol. 167,
2879–2886.
25. Xu, D., Trajkovic, V., Hunter, D., Leung, B.P., Schulz, K.,
Gracie, J.A., McInnes, I.B. & Liew, F.Y. (2000) IL-18 induces
the differentiation of Th1 or Th2 cells depending upon
cytokine milieu and genetic background. Eur. J. Immunol. 30,
3147–3156.
26. Kato,Z.,Jee,J.,Shikano,H.,Mishima,M.,Ohki,I.,Ohnishi,H.,

Li, A., Hashimoto, K., Matsukuma, E., Omoya, K., Yamamoto,
Y., Yoneda, T., Hara, T., Kondo, N. & Shirakawa, M. (2003) The
structure and binding mode of interleukin-18. Nat. Struct. Biol. 10,
966–971.
27. Ghayur,T.,Banerjee,S.,Hugunin,M.,Butler,D.,Herzog,L.,
Carter, A., Quintal, L., Sekut, L., Talanian, R., Paskind, M.,
Wong, W., Kamen, R., Tracey, D. & Allen, H. (1997) Caspase-1
processes IFN-c-inducing factor and regulates LPS-induced
IFN-c production. Nature 386, 619–623.
28. Gu, Y., Kuida, K., Tsutsui, H., Ku, G., Hsiao, K., Fleming, M.A.,
Hayashi, N., Higashino, K., Okamura, H., Nakanishi, K.,
Kurimoto,M.,Tanimoto,T.,Flavell,R.A.,Sato,V.,
Harding, M.W., Livingston, D.J. & Su, M.S. (1997) Activation
of interferon-gamma inducing factor mediated by interleukin-1b
converting enzyme. Science 275, 206–209.
29. Akita, K., Ohtsuki, T., Nukada, Y., Tanimoto, T., Namba, M.,
Okura, T., Takakura-Yamamoto, R., Torigoe, K., Gu, Y., Su,
M.S., Fujii, M., Satoh-Itoh, M., Yamamoto, K., Kohno, K.,
Ikeda, M. & Kurimoto, M. (1997) Involvement of caspase-1 and
caspase-3 in the production and processing of mature human
interleukin 18 in monocytic THP1 cells. J. Biol. Chem. 272,
26595–26603.
30. Sugawara, S., Uehara, A., Nochi, T., Yamaguchi, T., Ueda, H.,
Sugiyama, A., Hanzawa, K., Kumagai, K., Okamura, H. &
Takada, H. (2001) Neutrophil proteinase 3-mediated induction
of bioactive IL-18 secretion by human oral epithelial cells.
J. Immunol. 167, 6568–6575.
31. Aizawa, Y., Akita, K., Taniai, M., Torigoe, K., Mori, T., Nishida,
Y., Ushio, S., Nukada, Y., Tanimoto, T., Ikegami, H., Ikeda, M.
& Kurimoto, M. (1999) Cloning and expression of interleukin-18

binding protein. FEBS Lett. 445, 338–342.
32. Novick, D., Kim, S.H., Fantuzzi, G., Reznikov, L.L., Dinarello,
C.A. & Rubinstein, M. (1999) Interleukin-18 binding protein: a
novel modulator of the Th1 cytokine response. Immunity. 10,
127–136.
33. Tone, M., Thompson, S.A., Tone, Y., Fairchild, P.J. & Wald-
mann, H. (1997) Regulation of IL-18 (IFN-c-inducing factor)
gene expression. J. Immunol. 159, 6156–6163.
34. Kaiser, P. (2002) Turkey and chicken interleukin-18 (IL18) share
high sequence identity, but have different polyadenylation sites in
their 3¢ UTR. Dev. Comp Immunol. 26, 681–687.
35. Schneider, K., Puehler, F., Baeuerle, D., Elvers, S., Staeheli, P.,
Kaspers, B. & Weining, K.C. (2000) cDNA cloning of biologically
active chicken interleukin-18. J. Interferon Cytokine Res. 20,
879–883.
36. Bird, S., Zou, J. & Secombes, C.J. (2003) Takifugu rubripes
mRNA for IL-18 precursor. Genbank accession no. AJ
548844.
37. Gobel, T.W., Schneider, K., Schaerer, B., Mejri, I., Puehler, F.,
Weigend, S., Staeheli, P. & Kaspers, B. (2003) IL-18 stimulates the
proliferation and IFN-gamma release of CD4+ T cells in the
chicken: conservation of a Th1-like system in a nonmammalian
species. J. Immunol. 171, 1809–1815.
38. Ganassin, R.C. (1998) Development of a monocyte/macrophage-
like cell line, RTS11, from rainbow trout spleen. Fish Shellfish
Immunol. 8, 457–476.
39. Bird, S., Wang, T., Zou, J., Cunningham, C. & Secombes, C.J.
(2002) The first cytokine sequence within cartilaginous fish: IL-1
beta in the small spotted catshark (Scyliorhinus canicula).
J. Immunol. 168, 3329–3340.

40. Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994)
CLUSTAL W: improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, position-specific
gap penalties and weight matrix choice. Nucleic Acids Res. 22,
4673–4680.
41. Saitou, N. & Nei, M. (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4,
406–425.
42. Page, R.D. (1996) TreeView: an application to display phylo-
genetic trees on personal computers. Comput. Appl. Biosci. 12,
357–358.
43. Needleman, S.B. & Wunsch, C.D. (1970) A general method
applicable to the search for similarities in the amino acid sequence
of two proteins. J. Mol. Biol. 48, 443–453.
44. Nielsen, H., Engelbrecht, J., Brunak, S. & von Heijne, G. (1997)
Identification of prokaryotic and eukaryotic signal peptides and
prediction of their cleavage sites. Protein Eng 10,1–6.
45. Wolf, K. & Quimby, M.C. (1962) Established eurythermic line of
fish cells in vitro. Science 135, 1065–1066.
46. Hong, S., Zou, J., Crampe, M., Peddie, S., Scapigliati, G., Bols,
N., Cunningham, C. & Secombes, C.J. (2001) The production and
bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant
IL-1b. Vet. Immunol. Immunopathol. 81, 1–14.
47. Hardie, L.J., Chappell, L.H. & Secombes, C.J. (1994) Human
tumornecrosisfactora influences rainbow trout Oncorhynchus
mykiss leucocyte responses. Vet. Immunol. Immunopathol. 40,
73–84.
1922 J. Zou et al.(Eur. J. Biochem. 271) Ó FEBS 2004
48. Koizumi, H., Sato-Matsumura, K.C., Nakamura, H., Shida, K.,
Kikkawa, S., Matsumoto, M., Toyoshima, K. & Seya, T. (2001)

Distribution of IL-18 and IL-18 receptor in human skin: various
forms of IL-18 are produced in keratinocytes. Arch. Dermatol.
Res. 293, 325–333.
49. Shida, K., Shiratori, I., Matsumoto, M., Fukumori, Y.,
Matsuhisa, A., Kikkawa, S., Tsuji, S., Okamura, H.,
Toyoshima, K. & Seya, T. (2001) An alternative form of IL-18
in human blood plasma: complex formation with IgM defined by
monoclonal antibodies. J. Immunol. 166, 6671–6679.
50. Nakanishi, K., Yoshimoto, T., Tsutsui, H. & Okamura, H. (2001)
Interleukin-18 regulates both Th1 and Th2 responses. Annu. Rev.
Immunol. 19, 423–474.
51. Graham, S. & Secombes, C.J. (1990) Cellular requirements for
lymphokine secretion by rainbow trout Salmo gairdneri leuco-
cytes. Dev. Comp Immunol. 14, 59–68.
52. Hansen, J.D. & La Patra, S. (2002) Induction of the rainbow trout
MHC class I pathway during acute IHNV infection.
Immunogenetics 54, 654–661.
Ó FEBS 2004 IL-18 homologue in rainbow trout (Eur. J. Biochem. 271) 1923