Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc

Proteomic identification of all plastid-specific ribosomal proteins
in higher plant chloroplast 30S ribosomal subunit
PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue)
and PSRP-4 (Thx homologue)
Kenichi Yamaguchi* and Alap R. Subramanian
Max-Planck-Institut fuer molekulare Genetik, Berlin-Dahlem, Germany and Department of Biochemistry, University of Arizona,
Tucson, USA
Six ribosomal proteins are specific to higher plant chloro-
plast ribosomes [Subramanian, A.R. (1993) Trends Biochem.
Sci. 18, 177–180]. Three of them have been fully character-
ized [Yamaguchi, K., von Knoblauch, K. & Subramanian,
A. R. (2000) J. Biol. Chem. 275, 28455–28465; Yamaguchi,
K. & Subramanian, A. R. (2000) J. Biol. Chem. 275, 28466–
28482]. The remaining three plastid-specific ribosomal pro-
teins (PSRPs), all on the small subunit, have now been
characterized (2D PAGE, HPLC, N-terminal/internal pep-
tide sequencing, electrospray ionization MS, cloning/
sequencing of precursor cDNAs). PSRP-3 exists in two
forms (a/b, N-terminus free and blocked by post-transla-
tional modification), whereas PSRP-2 and PSRP-4 appear,
from MS data, to be unmodified. PSRP-2 contains two
RNA-binding domains which occur in mRNA processing/
stabilizing proteins (e.g. U1A snRNP, poly(A)-binding
proteins), suggesting a possible role for it in the recruiting of
stored chloroplast mRNAs for active protein synthesis.
PSRP-3 is the higher plant orthologue of a hypothetical
protein (ycf65 gene product), first reported in the chloroplast
genome of a red alga. The ycf65 gene is absent from the
chloroplast genomes of higher plants. Therefore, we suggest
that Psrp-3/ycf65, encoding an evolutionarily conserved
chloroplast ribosomal protein, represents an example of

organelle-to-nucleus gene transfer in chloroplast evolution.
PSRP-4 shows strong homology with Thx, a small basic
ribosomal protein of Thermus thermophilus 30S subunit
(with a specific structural role in the subunit crystallographic
structure), but its orthologues are absent from Escherichia
coli and the photosynthetic bacterium Synechocystis.We
would therefore suggest that PSRP-4 is an example of gene
capture (via horizontal gene transfer) during chloro-ribo-
some emergence. Orthologues of all six PSRPs are identifi-
able in the complete genome sequence of Arabidopsis
thaliana and in the higher plant expressed sequence tag
database. All six PSRPs are nucleus-encoded. The cytosolic
precursors of PSRP-2, PSRP-3, and PSRP-4 have average
targeting peptides (62, 58, and 54 residues long), and the
mature proteins are of 196, 121, and 47 residues length
(molar masses, 21.7, 13.8 and 5.2 kDa), respectively. Func-
tions of the PSRPs as active participants in translational
regulation, the key feature of chloroplast protein synthesis,
are discussed and a model is proposed.
Keywords: chloroplast-specific ribosomal protein; proteo-
mics.
We have recently completed a comprehensive proteome
analysis and protein identification of the chloroplast
ribosome (chloro-ribosome) of a higher plant [1,2]. The
results showed that the chloro-ribosomal 30S subunit
contains four chloroplast/plastid-specific ribosomal pro-
teins (PSRPs) in addition to the orthologues of the full
complement of Escherichia coli 30S subunit ribosomal
proteins [1]. The specific proteins were designated plastid-
specific ribosomal proteins (gene designation, Psrp),

PSRP-1 to PSRP-4. The chloro-ribosomal 50S subunit
comprised the orthologues of 31 E. coli 50S subunit
ribosomal proteins (only two E. coli ribosomal proteins
were unrepresented, L25 and L30), and two additional
PSRPs, namely, PSRP-5 and PSRP-6 [2]. The intact
Correspondence to A. R. Subramanian, 5110 East Woodgate Ln., Tucson, AZ 85712, USA. Fax: + 1 520 325 7957, Tel.: + 1 520 325 7957,
E-mail:
Abbreviations: PSRP, chloroplast/plastid-specific ribosomal protein; pRRF, plastid ribosome recycling factor; RBD, RNA-binding domain in
RNA-binding protein ( 80 amino-acid residues long); RNP1 and RNP2, conserved hexapeptide and octapeptide sequences in RBD;
cpRNP, chloroplast RNA-binding protein; EST, expressed sequence tag; ycf, hypothetical chloroplast frame.
*Present address: Department of Cell Biology and Skaggs Institute for Chemical Biology, The Scripps Research Institute, 10550 North Torrey
Pines Road, La Jolla, CA 92037, USA, E-mail:
Note: The spinach peptide sequences reported in this paper have been deposited in SWISS-PROT under accession numbers, P82277 (PSRP-2),
P82412 (PSRP-3) and P47910 (PSRP-4). The cDNA nucleotide sequences (spinach and Arabidopsis) have been submitted to the GenBank/EBI Data
Bank with accession numbers AF240462 (PSRP-2), AF239218 (PSRP-3), AF236825 (PSRP-4), spinach, and AF236826 (Arabidopsis PSRP-4).
(Received 29 July 2002, revised 30 October 2002, accepted 8 November 2002)
Eur. J. Biochem. 270, 190–205 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03359.x
chloro-ribosome (70S) revealed an additional protein in
stoichiometric amount, the plastid ribosome recycling
factor (pRRF), which is released on the dissociation of
chloro-ribosome into subunits [2]. Thus the chloro-ribo-
some proteome is composed of 59 distinct proteins: six
PSRPs, a bacterial-type pRRF (in E. coli pRRF is not a
component of the ribosome), and 52 orthologues of
eubacterial ribosomal proteins [2]. These results thus
confirmed the close kinship of the chloro-ribosome with
the eubacterial ribosome [3–5] and also revealed a distinct
departure, i.e. recruitment of several large proteins during
the chloro-ribosome evolution. The results also re-con-
firmed the great dissimilarities among the three (cyto-,

mito-, and chloro-) major types of ribosome [6].
The rate of protein synthesis in chloroplasts increases
dramatically on illumination, whereas the mRNA levels
remain relatively unchanged through light/dark transitions
(reviewed in [7,8]). Other significant differences between
chloroplasts and bacteria in both gene expression and
regulation of protein synthesis have been recognized.
Nuclear factors regulate chloroplast protein synthesis at
several key post-transcriptional steps, e.g. mRNA process-
ing, mRNA editing, mRNA stability [9–15], and the
translation initiation step plays a major role in the
expression of several plastid genes, e.g. light-induced
translation of psbA mRNA is regulated by cis-elements
including ribosome-binding sites and 5¢-UTR-binding
proteins [16–18]. Thus, while maintaining an overall resem-
blance to the eubacterial system, chloroplast transcrip-
tion-translation has evolved numerous additional control
elements to achieve its highly effective co-ordination
between photosynthetic protein requirements and the
ribosome function. The PSRPs, located on the ribosome
itself, are conceivably one set of control elements that have
permitted the observed translational co-ordination.
Plastids (general name for the organelle, of which
chloroplast is one of the differentiated forms) have their
own genome, and employ for gene expression a transcrip-
tion-translation system composed of both plastid-encoded
and nucleus-encoded proteins. Plastid ribosomes are
responsible for the synthesis of fewer than a hundred
polypeptides encoded in the plastid DNA, but these include
some of the most abundant proteins in the biosphere, e.g.

the large subunit of ribulose-1,5-bisphosphate carboxylase/
oxygenase. Moreover, certain key proteins of the photosys-
tems have high rates of protein turnover required during
their function (reviewed in [19]). Thus chloro-ribosomes
have to maintain a high rate of protein synthesis, but, being
dependent on photosynthetic chemical energy for function,
have had to evolve mechanisms dealing with the diurnal and
other variations in light intensity. It would be interesting if
PSRPs, either ribosome-bound or free, play a role in these
global regulations of chloroplast protein synthesis.
Here, we report the protein isolation and characteriza-
tion, and cloning of the cDNAs of three nuclear-encoded
PSRPs; PSRP-2, PSRP-3a/b, and PSRP-4. Together with
the previously reported results on PSRP-1, PSRP-5a/b/c
and PSRP-6 [1,2,20–22], characterization of all six PSRPs in
spinach (Spinacia oleracea) chloro-ribosome is now com-
plete. Homologues of all six PSRPs are identifiable in the
complete genome sequence of Arabidopsis thaliana and in
the expressed sequence tag database of other land plants.
We discuss light-dependent chloro-translational regulation,
other possible functions, and evolution of the PSRPs.
Materials and methods
Spinach chloroplast ribosome, 30S subunits, TP30
Spinach (S. oleracea, cv. Alwaro) chloroplast ribosomes
were prepared as previously described [23]. First, 5000 A
260
units of ribosomes were run on a zonal sucrose gradient to
obtain purified 70S ribosomes, and 3000 A
260
units of

purified 70S ribosomes were run on a dissociating zonal
gradient to obtain 30S and 50S subunits (details in [21]).
TP30 was prepared as described previously [1].
Protein/peptide electrophoresis, electroblotting
SDS/PAGE was performed by the method of Laemmli [24].
2D PAGE was performed as described previously [25].
Tricine SDS/PAGE of peptides was performed by the
method of Scha
¨
gger & von Jagow [26]. Molecular mass
markers used were ovalbumin (43 kDa), carbonic anhyd-
rase (29 kDa), b-lactoglobulin (18.4 kDa), lysozyme
(14.3 kDa), bovine trypsin inhibitor (6.2 kDa) and insulin
b-chain (3.4 kDa). Electroblotting was carried out as
described previously [2].
Protein/peptide purification with RP-HPLC
Protein or peptide was resolved with a Vydac C4 column
(4.6 · 150 or 250 mm) using the HPLC system described
previously [1]. The solvent systems and gradient conditions
are described in the figure legends.
Internal peptide preparation from PSRP-2
and PSRP-3a/b
After electrophoresis, 2D gels were stained for 30 min in
0.1% Coomassie Brilliant Blue R-250 (CBB)/45% ethanol/
10% acetic acid (w/v/v) and destained for 1–2 h in 25%
ethanol/8% acetic acid (v/v). ÔIn-gelÕ digestion of PSRP-2
using endoproteinase Lys-C was carried out basically by
the method of Hellman et al. [27] with the slight modifi-
cation described in our previous paper [2]. For Asp-N
digestion or CNBr cleavage, proteins from 2D gel spots

corresponding to PSRP-2 and PSRP-3a were extracted as
follows. Five spots containing 10 lg protein/spot were
placed in a 1.5-mL microtube and homogenized in 400 lL
extraction buffer (1% SDS, 20 m
M
Tris/HCl, pH 8.0)
using a small fitting pestle. A further 400 lLofextraction
buffer was added and the tube was shaken for 16 h at
room temperature. Peptide extract was separated from gel
fragments by centrifugation (0.45 lm filter unit, ULTRA-
FREE-MC; Millipore), concentrated to 250 lL in a Speed-
Vac, precipitated with acetone (1 mL ice-cold acetone;
16 h at )20 °C), and collected as a pellet by centrifugation
(20 000 g, 15 min). Endoproteinase Asp-N (Sigma) diges-
tion was performed [ 50 lg protein in 80 lL50m
M
Tris/
HCl (pH 8.0)/2
M
urea] for 16 h at 37 °C (enzyme/
substrate, 1 : 100). The reaction was stopped by adding
20 lL 5% (v/v) trifluoroacetic acid, and the digest was
subjected to HPLC. CNBr cleavage was performed in
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 191
100 lL0.15
M
CNBr/75% (v/v) trifluoroacetic acid (4 lg
protein, 16 h, room temperature in the dark). After the
reaction, CNBr and trifluoroacetic acid were evaporated
under N

2
gas and dried in a Speed-Vac. The peptides
obtained were kept at )20 °C until used.
Protein/peptide sequencing and MS
Protein sequencing was carried out at the Laboratory for
Protein Sequencing and Analyses, University of Arizona,
using Applied Biosystem 477A Protein/Peptide sequencer
interfaced with a 120A HPLC analyzer. MS analysis was
carried out at the Mass Spectrometry Facility, Department
of Chemistry, University of Arizona, using a Finnigan LCQ
electrospray ionization mass spectrometer (ESI MS). About
50 pmol protein in 10 lL 4% acetic acid was subjected to
ESI MS.
Cloning and sequencing of PSRP-2, PSRP-3, PSRP-4
cDNAs
A kgt11 spinach cDNA library prepared previously in our
laboratory [28] was screened by thermal gradient PCR
using a Mastercycler gradient PCR apparatus (Eppendorf
Scientific, Inc.). PCR was performed (3 min at 94 °C, 35
cycles of 1 min at 94 °C, 1 min at 43–60 °C for degenerate
PCR or 1 min at 55 °C, 1.5 min at 72 °C, and 1 cycle of
10 min at 72 °C) with 1.25 U Taq DNA polymerase
(Gibco-BRL) in a 50-lL reaction volume containing 1 lL
kgt11 library ( 10
8
plaque-forming units), 1 l
M
gene-
specific primer or 2 l
M

degenerate primer, 1 l
M
lambda
arm primer (PF or PR), 200 l
M
each dNTP, 1.5 m
M
MgCl
2
,and50m
M
KCl in 20 m
M
Tris/HCl (pH 8.4). PF
(forward primer) and PR (reverse primer) are comple-
mentary to the cloning site of kgt11. Degenerate oligonu-
cleotide primers, P2-1, P3-1, and P4-1 were designed from
the internal peptide of PSRP-2 (peptide 3, -MDIATTQA-,
including CNBr-cleaved Met, see Fig. 4A) and N-terminal
sequence portions of PSRP-3 (-MGNEVDID-) and
PSRP-4 (-PKNKNKG-), respectively. Optimal annealing
temperatures for the degenerate RCR were observed to be
57–60 °C for amplifications of 3¢-portions of Psrp-2 (P2-1/
PR) and Psrp-3 (P3-1/PR), and 50–57 °C for amplification
of 3¢-portion of Psrp-4 (P4-1/PR). Here, for example, P2-
1/PR stands for PCR amplified DNA using lambda
library and primer sets P2-1 and PR. Gene-specific PCR
primers for Psrp-2, Psrp-3 and Psrp-4 (P2-2, P3-2 and P4-
2) were designed from the nucleotide sequence of PCR
products, P2-1/PR, P3-1/PR and P4-1/PR. Tag-sequence-

containing primers complementary to 5¢-termini and
3¢-termini of PSRP-2 and PSRP-4 cDNAs (P2-3, P2-4,
P4-3, and P4-4) were designed after sequencing the sets of
PCR products.
The full cDNAs encoding PSRP-2 and PSRP-4 were
amplified from the lambda library using the tagged primers.
The nucleotide sequences of Psrp-2 and Psrp-4 were
obtained by sequencing P2-3/P2-4 and P4-3/P4-4 using
sequencing primers, TAG1 and TAG2, and the two strands
were completely sequenced by primer walking. The phage
clone of PSRP-3 cDNA was obtained by the following
method. The PCR product encoding 5¢-PSRP-3 cDNA
portion (PF/P3-2) was labeled with
32
P as described by the
supplier of Random Primed DNA Labeling Kit (Boehringer
Mannheim). The lambda library (150 000 pfu) was plated
on four 132-mm plates, and the plaques were lifted on to
ICN BIOTRANS Nylon membrane. Prehybridization was
performedin500m
M
sodium phosphate, pH 7.0, at 50 °C
for 2 h and hybridization in 500 m
M
sodium phosphate
(pH 7.0)/7% SDS at 50 °C for 16 h. The membrane was
washed twice in 100 m
M
sodium phosphate (pH 7.0)/1%
SDS at 37 °Cfor10minfollowedbya10-minwashin

40 m
M
sodium phosphate (pH 7.0)/1% SDS at 37 °Cand
autoradiographed. Plaques giving positive signals were
purified and preserved by standard procedures [29]. Insert
DNA in the phage clone (PSRP-3-D1) was amplified by
PCR using primer sets PF and PR, then cleaved by EcoRI
digestion and subcloned into the plasmid vector pBluescript
SK
–
(Stratagene). The insert DNA in Psrp-3 plasmid clone
was sequenced. Nucleotide sequencing was carried out at
the DNA Sequencing Facility, University of Arizona, using
an Applied Biosystems model 377 sequencer. PCR products
were analyzed by agarose gel electrophoresis using 1% (w/v)
agarose gel and visualized by ethidium bromide staining.
Oligonucleotides used in this study were: PF, 5¢-CGGGATC
CGGTGGCGACGACTCCTGGAGCCC-3¢;PR,5¢-CG
GGATCCCAACTGGTAATGGTAGCGACCGGC-3¢;
P2-1, 5¢-ATGGAYATHGCIACIACICARGC-3¢;P2-2,
5¢-TAGCAACTCATTCGTCACTGTC-3¢; P2-3, 5¢-GGA
ATTCTAGATATCGTCGACAATTTGTGTTACTACC
AAAATC-3¢;P2-4,5¢-GGAATTCGTCGACGCGTTAA
AAAAGATAGCAGCATTGACAC-3¢;P3-1,5¢-ATGG
GIAAYGARGTIGAYATHG-3¢; P3-2, 5¢-CTAGACC
TATGTTTTTCTCCATCC-3¢; P4-1, 5¢-CCIAARAAYA
ARAAYAARGG-3¢; P4-2, 5¢-CAGATAGGAAGAGGG
GCAAGGA-3¢;P4-3,5¢-GGAATTCTAGATATCGTC
GACTTATCTTCAGAACTTGTTGC-3¢; P4-4, 5¢-GGA
ATTCGTCGACGCGTTTTTCAACAAATCATCATAT

A-3¢;TAG1,5¢-GGAATTCTAGATATCGTCG-3¢;
TAG2, 5¢-GGAATTCGTCGACGCG-3¢.
Computer analysis
A homology search was performed using the
BLAST
program. ORFs from cDNA sequences were analyzed
using the ÔmapÕ program from the GCG software package
[30]. Sequence alignments and comparisons were performed
using
PILEUP
and
GAP
programs in the same package or
CLUSTAL W
[31]. The results were displayed using
BOXSHADE
(version 3.21 written by K. Hofmann and M. D. Baron) or
manually modified. Secondary structure prediction was by
the methods of Chou & Fasman [32] and Garnier et al.[33]
using GCG software.
Protein and gene nomenclature
The protein and gene nomenclature in this paper are in
accordance with the Commission on Plant Gene Nomen-
clature rules [34], and follows our previous paper [1,2].
E. coli orthologues of ribosomal proteins S1–S21 were
designated PRP S1 to PRP S21 (P, for plastid; C was not
used for chloroplast to avoid confusion with C, cytosolic).
The six PSRPs are designated PSRP-1 to PSRP-6, and their
genes, Psrp-1 to Psrp-6 (see Table 1 and our previous papers
[1,2]).

192 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
Results and discussion
Identification, isolation, N-terminal/internal peptide
sequencing and MS of PSRP-2, PSRP-3 and PSRP-4
Spinach chloroplast ribosome was first purified on a zonal
sucrose gradient, and the ribosomal 70S peak collected was
then run on a dissociating zonal gradient to obtain pure 30S
and 50S subunits free of adhering stromal proteins (see [21]
for details and gradient profiles). As described [21], efficient
dissociation of chloroplast ribosome required a phosphate-
containing buffer. The total protein from the 30S subunit
(TP30, 200 pmol) was subjected to 2D PAGE (Fig. 1), and
the resolved proteins were electroblotted on to poly(viny-
lidene difluoride) membrane for N-terminal sequence ana-
lysis. All of the 30S protein spots were excised from the blot
and subjected to N-terminal protein sequencing analysis.
We identified in the chloroplast 30S subunit the orthologues
of all E. coli 30S ribosomal proteins (S1–S21) and the details
are reported in a previous paper [1]. We designated the four
additional proteins present in the chloroplast 30S subunit
PSRP-1, PSRP-2, PSRP-3 and PSRP-4 (see Fig. 1).
PSRP-1 has been previously characterized [20,21], and its
cDNA cloned and expressed in E. coli [35]. PSRP-4 has also
been previously identified but only partially sequenced and
had been designated S31 [36]. We therefore proceeded with
the characterization of PSRP-2, PSRP-3, and PSRP-4.
The N-terminal sequence and the yield/recovery of
phenylthiohydantoin (PTH)-amino acids from Edman
degradation were: PSRP-2, NH
2

-VVTEETSSSSTASSSS
DGEGA- (21 amino acids, 41 pmol per spot); PSRP-3,
NH
2
-VAPETISDVAIMGNEVDIDDDLLVNKEKLK
VLVKPMDKXXLVL- (43 amino acids, 7 pmol per spot);
PSRP-4, NH
2
-GRGDRKTAKGKRFNHSFGNARPKN
KNKGRGPPKAPIFPKGDPS- (43 amino acids, 37 pmol
per spot). The yield of 37–41 pmol PTH-amino acids per
spot for PSRP-2 and PSRP-4 corresponded to that for the
other 30S ribosomal proteins (average, over 30 pmol). The
results supported the view that PSRP-2 and PSRP-4 are unit
proteins on the chloroplast 30S subunit. With respect to
PSRP-3, the yield of PTH-amino acids was significantly
lower (7 pmol per spot); however, the Coomassie Blue
staining intensity of its spot was similar to that of the other
spots in that region of the gel. Therefore, a partially blocked
N-terminus for PSRP-3 was indicated.
To confirm whether PSRP-3 is N-terminally blocked,
electrophoretic separation of the two forms (blocked and
unblocked) was attempted by running the first dimension
gel of the 2D PAGE for twice as long. The PSRP-3 spot was
resolved into two spots, a slower migrating spot marked a,
and a faster migrating spot marked b (Fig. 1 inset). The two
Fig. 1. Two-dimensional gel pattern of spinach chloroplast 30S subunit
proteins: resolving PSRP-2, PSRP-3a/b,andPSRP-4.TP30
(200 pmol) electropherogram stained with Coomassie Blue (as land-
marks, S1a/b,S4,S6a-e and S10a/b are shown). First dimension:

pH 5.0 in 4% (w/v) acrylamide gel containing 8
M
urea; second
dimension: pH 6.7 in 10% (w/v) acrylamide gel containing 0.2% SDS.
Inset shows a poly(vinylidene difluoride) blot of the acidic proteins,
stained with Amido Black. For better resolution, the gel was run twice
as long in the first dimension. PSRP-3 spots a and b (circled) indicate
the N-terminal blocked and unblocked forms, respectively. Note: small
acidic proteins are stained weakly by Amido Black. Molecular sizes
and isoelectric points (pI) shown are based on the characterization in
our two previous papers [1,2].
Table 1. Characteristics of chloroplast-specific ribosomal proteins (spinach).
Protein
name
Subunit
location
Chain
length
Molecular
mass
Isoelectric
point
a
Ref.
c
Other
name and ref. Similar protein and ref.
PSRP-1 30S 236 26 805
b
6.2 [21] CS-S5 [20]

S22 [92]
S30 [21]
Synechococcus lrtA light-
repressed transcript A product [86]
PSRP-2 30S 198 21 665
b
5.0 New Chloroplast ribonucleoproteins [44,45]
PSRP-3 30S 121 > 13 794
a
(a)
13 794
a
(b)
< 4.9 (a)
4.9 (b)
New P. purpurea ycf65 hypothetical chloroplast
reading frame product [48]
PSRP-4 30S 47 5 174
b
11.8 New S31 [36]
SCS23 [93]
T. thermophilus 30S ribosomal protein Thx [52]
PSRP-5 50S 80 (a)
58 (b)
54 (c)
9 255
b
(a)
7 066
b

(b)
6 638
b
(c)
11.5 (a)
12.2 (b)
12.2 (c)
[2] L40 [94]
PsCL18 [22]
PSRP-6 50S 69 7 387
a
10.6 [2] PsCL25 [22]
a
Calculated from mature protein sequence.
b
Obtained from mass spectrometry.
c
For cloning and sequencing of cDNA encoding full
precursor sequence.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 193
spots were excised and subjected to N-terminal analysis.
Edman degradation gave a clear N-terminal sequence for
the weaker staining b spot (9 pmol per spot), but an unclear
sequence for the stronger staining a spot (insignificant yield,
less than 2 pmol per spot). From its slower electrophoretic
migration in the first dimension gel, the a form is expected
to be more acidic than the b form (i.e. loss of a positive
charge/net gain of a negative charge, making the protein
more acidic).
To confirm that the more acidic a form is N-blocked

PSRP-3, a spots were excised from several gels, and the
extracted protein was cleaved with CNBr. The CNBr
fragments were separated by Tricine SDS/PAGE/electro-
blotting, and two of the CNBr fragments (Peptide 1 and
Peptide 2, Fig. 2D) were sequenced: Peptide 1, GNEVDI-;
Peptide 2, EKNIGLALDQTIPG Peptide 1 has the same
sequence as part of the N-terminal sequence of PSRP-3
(Gly13–Ile18) above. Peptide 2 is a new sequence, and it
was considered to be an internal peptide sequence from
PSRP-3 (subsequently confirmed by DNA sequencing of
PSRP-3 clone). The experiments thus demonstrated that
PSRP-3 exists in two forms (designated a and b), the
alpha form being N-blocked and the b form having a free
N-terminus. The approximate ratio of the two forms is
3:1.
For cloning PSRP-2 (by PCR screening a spinach
cDNA library using degenerate oligonucleotide pri-
mers), the predominantly serine/threonine-rich N-terminal
sequence obtained above was unsuitable. Therefore, inter-
nal peptides of PSRP-2 were prepared. HPLC resolution
of the peptides from two protease digests (endoproteinase
Lys-C and endoproteinase Asp-N) are shown in Fig. 2A,B.
Long peptides containing aromatic (high UV absorption)
and/or acidic amino acids are eluted late in RP-HPLC;
these amino acids (W, Y, F, D, E) have less than average
degeneracy. Therefore, four of the late-eluted tall peaks
were taken for sequence analysis. In addition, PSRP-2
spots were excised from several 2D gels and the extracted
protein was subjected to CNBr cleavage (CNBr generates
long fragments generally; also the cleavage occurs at the

carboxyl of Met which has zero degeneracy). Peptide frag-
ments were separated by Tricine SDS/PAGE (Fig. 2C),
and two were taken for sequencing. The five internal
sequences obtained were: Peptide 1, YDKYSGRSR
RFGFVTM-; Peptide 2, VNITEKPLEGM-; Peptide 3,
DIATTQAEDSQFVESPYKVY-; Peptide 3a, DSQFV-
(contained in Peptide 3 sequence); and Peptide 4,
DFFSEKGKVLGAKVQRTPG
Being a very basic protein, PSRP-4 could be readily
purified by RP-HPLC of 1 mg TP30 on a Vydac C
18
column (Fig. 3A); the purified protein showed a single
band, corresponding to the fastest migrating band of TP30
on the 1D gel, and a single spot on the 2D gel (Fig. 3A,
insets). The purified PSRP-4 was subjected to ESI MS. The
spectrum (Fig. 3B) showed multicharged (+ 4 to + 11)
ions in the 400–1400 m/z (mass to charge ratio) region. The
deconvoluted mass spectrum (Fig. 3C) showed a single
peak with a molecular mass of 5174 Da. This observed mass
and the sequence mass calculated from the PSRP-4 amino-
acid sequence (see next section, Fig. 4C) are in excellent
agreement. Thus, PSRP-4 is not post-translationally modi-
fied to any significant degree.
Isolation of PSRP-2 and PSRP-3 directly from TP30 on
an HPLC C
18
column was not effective, because they were
coeluted with a few other proteins [1]. However, LC/MS
analysis of an HPLC fraction (pool 18 in [1]), which
contained PSRP-2, PRP S4 and PRP S8 resolved the

molecular masses, and yielded an observed mass of
Fig. 2. Isolation of internal peptides from PSRP-2 and PSRP-3. (A)
HPLC separation of endoproteinase Lys-C Ôin-gelÕ digest of PSRP-2
(10 lg, extracted from 2D gel spots). Peptide 2 and the N-terminal
peptide were sequenced. CBB, peak of Coomassie Blue. (B) HPLC
separation of endoproteinase Asp-N digest of PSRP-2 (40 lg,
extracted from 2D gel spots). Peptides 3a and 4 were sequenced. RP-
HPLC was carried out on a Vydac C4 column (150 · 4.6 mm) using a
step linear gradient of acetonitrile (MeCN) in 0.1% (v/v) trifluoro-
acetic acid (0% MeCN up to 5 min, 40% MeCN at 65 min, 80%
MeCN at 75 min), at a constant flow rate of 0.5 mLÆmin
)1
.(C)
Poly(vinylidene difluoride) blot of CNBr-cleaved fragments of PSRP-2
(4 lg, CNBr fr.) and intact PSRP-2 (2 lg). Peptides 1 and 3 were
sequenced.(D)Poly(vinylidenedifluoride)blotofCNBr-cleaved
fragments of PSRP-3a (4 lg) and intact PSRP-3a (2 lg). Peptides 1
and 2 were sequenced. CNBr fragments were separated by Tricine
SDS/PAGE and electroblotted on to a poly(vinylidene difluoride)
membrane, and stained with Amido Black. Peptide peaks/bands
indicated were analyzed in an automated protein sequencer.
194 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
21 665 Da for PSRP-2. This value exactly corresponds to
the sequence-calculated mass of PSRP-2 (see next section,
Fig. 4A), suggesting almost no post-translational modifica-
tion in the mature protein.
PSRP-3 could not be observed using ESI-LC/MS or
MALDI-TOF MS. This may be due to the poor ionization
of this protein. A few other ribosomal proteins, e.g. PRP L2,
could also not be observed in our ESI MS and MALDI-

TOF MS experiments [2]. Thus, we can offer no suggestions
on the nature of the N-terminal blocking in PSRP-3a or on
the possibility of additional post-translational modifications
in either form.
cDNA cloning and nucleotide sequencing of the
cytoplasmic mRNAs for PSRP-2, PSRP-3 and PSRP-4
PSRP-2, PSRP-3, and PSRP-4 were considered to be
nuclear-encoded proteins because the N-terminal sequences
and internal sequences, reported above, are not encoded in
the plastid genome sequence of spinach [37] or other higher
plants [38]. Therefore, inosine-containing degenerate prim-
ers were designed from the peptide sequence information,
and used to screen a previously described kgt11 cDNA
library [28]. First, partial cDNA was specifically amplified
using sets of degenerate primer/lambda arm primer, and
further PCR amplifications were carried out using sets of
gene-specific primer (based on the cDNA sequence ob-
tained) and lambda arm primer (PF or PR). The cDNA
clones were finally obtained by a third PCR amplification
using tagged primers complementary to the 5¢ and 3¢ ends of
cDNA inserts (see Materials and methods for further
information), and both strands of the cDNAs obtained were
completely sequenced. The nucleotide sequences of the
cDNAs encoding the precursors of PSRP-2, PSRP-3, and
PSRP-4areshowninFig.4.
The PSRP-2 precursor cDNA comprises 1242 bp [exclu-
ding poly(A) tail], the ORF (nucleotides138–920) encoding
a putative 220-residue protein. The N-terminal sequence of
mature PSRP-2 begins at residue 63, suggesting a 62-residue
transit peptide, and a 198-residue mature protein of

sequence mass 21 665.02 Da and theoretical pI 4.99. The
nucleotide sequence of PSRP-3 precursor cDNA comprises
751 bp, with an ORF (nucleotides 41–580) encoding a
putative 179-residue protein. The mature PSRP-3 begins at
residue 59, suggesting a 58-residue transit peptide and a 121-
residue mature protein of sequence mass 13 794.02 Da and
theoretical pI 4.93. [The molecular mass of PSRP-3,
estimated from Tricine SDS/PAGE (Fig. 3D) or SDS/
PAGE [2], is 14.0 kDa, close to the sequence mass,
indicating no heavy post-translational modifications.] The
nucleotide sequence of PSRP-4 precursor cDNA comprises
521 bp, with an ORF (nucleotides 22–327) encoding a
putative 101-residue protein. The mature PSRP-4 begins at
residue 55, indicating a 54-residue transit peptide and a 47-
residue mature protein of sequence mass, 5173.80 Da and
theoretical pI 11.80. The 87, 57, and 43 amino acids of
PSRP-2, PSRP-3, and PSRP-4 sequences, determined from
protein work (underlined in Fig. 4, corresponds to 44%,
47%, and 91%, respectively, of the mature protein chain
lengths), showed 100% match to the cDNA-derived
sequences. As noted above, the MS molar masses of mature
PSRP-2 and PSRP-4 suggest an absence of post-transla-
tional modifications.
Sequence homology of PSRP-2 to ribonucleoproteins
containing two U1A-type RNA-binding domains
A homology search using the
BLASTP
program revealed a
significant sequence similarity of PSRP-2 to a large
number of proteins that carry one or more conserved

RNA-binding domains. These domains (called RBD, but
also RRM for RNA recognition motif) are well charac-
terized in human U1A small nuclear ribonucleoprotein
(U1A snRNP). An RBD is defined as having an  80-
residue sequence, containing a conserved octapeptide
Fig. 3. Purification and MS of PSRP-4. (A) RP-HPLC profile of TP30
(1mg)resolvedonaVydacC
18
column (250 · 4.6mm)usingastep
linear gradient of isopropanol (IPA) in 0.1% (v/v) trifluoroacetic acid
(10% IPA from 0 to 10 min, 25% IPA at 80 min, 45% IPA at
250 min) at a constant flow rate of 0.5 mLÆmin
)1
.Everypeakinthe
0–100 min retention time was subjected to SDS/PAGE, MS, and
protein sequencing (asterisk, nonprotein peak). S17frg is a truncated
form of S17, see [1]. Inset (1D and 2D) shows that the smallest protein
band of TP30, a 7.5-kDa protein, corresponds to PSRP-4 in 2D PAGE.
(B) ESI MS of PSRP-4. Each peak represents an individual charged
ion. The m/z ratio and the number of positive charges on the ion are
shown above each peak. (C) Deconvoluted mass spectrum of the m/z
series in (B) indicates a single protein of molecular mass 5174.30 Da.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 195
(RNP1) and a hexapeptide (RNP2) separated by about 30
amino acids [39]. The RBD folds into a compact structure
of four antiparallel b-sheets and two a-helices (b1-a1-b2-
b3-a2-b4) with the conserved RNP1 and RNP2 located in
the b1andb3 antiparallel strands [39]. Both RNP1 and
RNP2 are important elements for recognizing the target
RNA.

The highest alignment score of PSRP-2 was actually to a
small group of RNA-binding proteins (cpRNPs) present in
the chloroplast stroma. Other high-alignment hits were:
polyadenylate-binding proteins, glycine-rich RNA-binding
proteins, heterogeneous nuclear ribonucleoproteins
(hnRNPs), and small nuclear ribonucleoprotein (snRNP)
[40–43]. The three tobacco cpRNPs, cp29A, cp31, and cp33
[44,45], are shown aligned with the PSRP-2 sequence in
Fig. 5A, with sequence identities (similarities) of 36.5%
(48.7%), 36.2% (48.9%), and 39.1% (48.7%), respectively.
The primary structure of PSRP-2 appears to be related
to that of the cpRNPs, with a similar arrangement of the
two RBDs, but with a shorter, less negatively charged
N-terminal domain and a truncated (by 8–30 residues)
C-terminal domain (Fig. 5A). A comparison of PSRP-2
with several other RBD-containing proteins (spinach 28
RNP, Chlamydomonas reinhardtii RB47 poly(A)-binding
protein, barley cold-inducible glycine-rich RNA-binding
protein, Anabaena variabilis RNA-binding protein, human
hnRNP, and human U1A snRNP) shows high conservation
of the RNP1 and RNP2 sequences between these proteins
and PSRP-2 (Fig. 5B).
Convergent evolution has been suggested for the
sequence relationship between bacterial RNA-binding pro-
teins and eukaryotic glycine-rich proteins, and a phylo-
genetic analysis has indicated that cpRNPs are likely to have
diverged from eukaryotic glycine-rich proteins, rather than
from cyanobacteria [46]. As it appears structurally closely
related to cpRNPs, PSRP-2 may also have a eukaryotic,
evolutionary origin.

The RBD-containing proteins are generally associated
with RNA processing: splicing, localization, and stabil-
izing. In the U1A protein, the aromatic residues of RNP1
and RNP2 are critical for RNA-base stacking [39].
Because such aromatic residues in the putative RBDs of
PSRP-2 are conserved (Fig. 5A,C), PSRP-2 probably
performs a similar RNA-binding activity. As protein
synthesis in chloroplasts is remarkable for its mRNA
storage in the dark and light-induced translational spurt,
we would like to suggest a role for PSRP-2 in this
process. However, as PSRP-2 could bind mRNA, rRNA
or both, and if it binds mRNA, it could just as well be
involved in translation initiation as in light-regulated
translation.
Fig. 4. Cytoplasmic precursors and complete mature forms: the nuc-
leotide sequences of PSRP-2, PSRP-3 and PSRP-4 cDNAs and corre-
lating experimentally determined peptide sequences. Initiation contexts
conforming to the Kozak rule [91] are boxed. Chloroplast-targeting
signal sequences (transit peptides) are shown in italics. Arrows indicate
the cleavage site of the transit peptide. The experimentally determined
N-terminal sequences and internal peptides are underlined. The stop
codon is indicated by an asterisk. (A)n, polyadenylation.
196 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
Fig. 5. Sequence alignment of PSRP-2 with three chloroplast RNA-binding proteins: domain arrangement/comparison of RBDs between PSRP-2 and
RBD-containing proteins. (A) PSRP-2 is aligned with three chloroplast RNA-binding proteins (cp29, cp31 and cp33, from wood tobacco, Nicotiana
sylvestris [44,45]), to which it is closely related in structure, having two RBDs in similar arrangement. The octapeptide RNP1 and the hexapeptide
RNP2 motifs in each of the two RBDs are boxed. Negatively charged amino acids (D/E) in the acidic N-terminal region of cpRNPs are shown in
bold letters. Identical amino acids or conserved replacements in the four proteins are shown shaded. Chain lengths of the mature proteins and
percentage identity (I) and similarity (S) are indicated after the C-terminus. (B) Schematic diagram of RBD domain arrangement (filled boxes) in
PSRP-2 and six other RBD-containing proteins. Abbreviations and accession numbers: cpRNP, chloroplast ribonucleoprotein 28RNP from

spinach (P28644); GRP, cold-inducible glycine-rich RNA-binding protein from barley (U49482); cyRBP, RNA-binding protein from a cyano-
bacterium, A. variabilis (I39621); PABP, poly(A)-binding protein from an alga, C. reinhardtii (T07933); hnRNP, heterogeneous nuclear ribonu-
creoprotein A1 from human (P09651); snRNP, small nuclear ribonucleoprotein U1A spliceosomal protein from human (P09012). (C) Alignment of
the  50-amino-acid sequence portion of RBD-1 and RBD-2 from PSRP-2 and the six other RBD-containing proteins in (B). The positions of
conserved amino-acid residues are highlighted: black, identical, and grey, similar.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 197
PSRP-3 and the hypothetical chloroplast reading frame
(
ycf65
) protein
A
BLAST
search of the PSRP-3 sequence against database
sequences showed several close homologues. They were all
unidentified hypothetical proteins, designated YCF65
(hypothetical chloroplast frame 65 product [47]), first
reported in the chloroplast genome of Porphyra purpurea,
a red alga [48]. Homologous sequences are present in the
prasinophycean alga, Mesostigma viride, and the crypto-
phyte alga, Guillardia theta.Theycf65 gene is absent from
the chloroplast genome of the green algae Chlorella vulgaris
[49] and C. reinhardtii (J. Maul, J. W. Lilly and D. B. Stern,
unpublished results, www.biology.duke.edu/chlamy_
genome/chloro.html). However, a PSRP-3 homologue can
be identified in the Chlamydomonas expressed sequence tag
(EST) sequences (Table 2), suggesting a relocation of the
ycf65 gene to the nuclear genome of C. reinhardtii.
A homologue of the Psrp-3/ycf65 gene is absent from
the database of eubacterial (nonphotosynthetic) and
archaebacterial genomes. However, a Psrp-3 homologue

is present in the two (photosynthetic) cyanobacterial
genomes (Synechocystis and Synechococcus) in the database.
Although not yet experimentally shown, it is likely that the
PSRP-3 protein is a component of cyanobacterial ribo-
somes. The overall sequence identities among higher plant
PSRP-3 homologues are high (71–80%), whereas those
between higher plant and algal/cyanobacterial PSRP-3
homologoues are lower (41–52%). The PSRP-3 sequences
contain five invariant residues which are the relatively rare
tryptophan, and, moreover, a highly conserved decapeptide
motif, -Y(Y/F)FWPRXDAW-, containing five conserved
aromatic amino acids, is present in the central region
(Fig. 6). Compared with the algal and cyanobacterial
sequences, the mature spinach PSRP-3 carries a negatively
charged N-terminal extension and a  20-residue truncation
at the C-terminus.
It is likely that the Psrp-3 gene, having had its origins in
the cyanobacterial genome, was retained during the emer-
gence of algal/higher plant chloroplasts. As PSRP-3 is
specifically associated with ribosomes that have to perform
protein synthesis in a photosynthetic environment, it may
have been evolved for a role that does not exist in E. coli,
e.g. linking protein synthesis and light. Spinach PSRP-3
coexists in two forms, a form post-translationally modified
at the N-terminus and an unmodified form. It is not known
if the ratio of these two forms is constant under all
conditions. The ratio could be variable, depending on the
intensity and duration of light, like the growth rate-
dependent N-terminal modification in certain E. coli ribo-
somal proteins [50]. It would be interesting to identify the

plant gene for the enzyme that catalyzes PSRP-3 post-
translational modification, and to check whether the
cyanobacterial genome carries a homologous enzyme gene.
Sequence homology of PSRP-4 with
Thermus
thermophilus
30S subunit protein Thx and a plant
mitochondrial protein
From the incomplete sequence data then available [36,51],
the T. thermophilus 30S ribosomal protein ÔThxÕ was
previously identified as a homologue of PSRP-4 protein
(it was then designated S31). Recently the complete
sequence of Thx, having only 26 residues, has been
confirmed by nucleotide sequencing [52]. Figure 7 shows
the sequence alignment.
Asearchusing
BLAST
revealed two PSRP-4 homologues
inthecompletegenomeofArabidopsis. One of them was
very closely related to the PSRP-4 sequence (chromosomal
locus number AT2g38140), and so we obtained the
corresponding EST (clone 122F4T7) from the Arabidopsis
EST Stock Center and sequenced it completely (see
accession number AF236826 for sequence data). The data
revealed the cDNA of the PSRP-4 precursor protein of
Arabidopsis chloroplast ribosome (see Fig. 7A). The other
homologue was a hypothetical protein, named here Ath-
PSRP-4h (chromosomal locus AT2g2129), with less PSRP-
4 homology. A transcript of this hypothetical protein was
not identifiable in the Arabidopsis EST database. However,

sequences closely related to it are found in the ESTs of other
plants, the closest one being a maize EST sequence.
The PSRP-4 precursor sequences from spinach (Sol-
PSRP-4), Arabidopsis (AthPSRP-4) and tomato (LesPSRP-
4) are aligned in Fig. 7A with the T. themophilus Thx, and
included there are the PSRP-4h hypothetical proteins from
Arabidopsis and maize. The PSRP-4 precursors carry plastid
transit peptides of  50 amino-acid residues. The mature
PSRP-4 proteins have (a) lysine/arginie-rich Thx-like
regions, (b) hydrophobic proline-rich motifs, and (c)
nonconserved C-terminal regions. The PSRP-4h hypothet-
ical proteins have shorter putative transit peptides, but
contain lysine/arginine-rich Thx-like regions, and con-
served, hydrophobic, proline-rich C-terminal regions
(-PWPLPFKLI-COOH).
Table 2. Homologues of spinach PSRPs in other angiosperms, a bryophyte, green alga, and photosynthetic bacterium. Accession numbers are in
parentheses. Chromosomal locus of Arabidopsis genes are shown in square brackets. EST, in italic. ?, Significant homologues not found in public
database, NI, not identified in the complete genome sequence.
Spinach Arabidopsis Barley Moss C. reinhardtii Synechocystis
PSRP-1 (M55322) AF370148 [AT5g24490] BF262651 AW561215 AV390148 P74518
PSRP-2 (AF240462) AY039568 [AT3g52150] BF267982 ?? NI
PSRP-3 (AF239218) AV530526 [AT1g68590]
? [AT5g15760]
AW201242 Z98114 BG847093 Q55385
PSRP-4 (AF236825) AF236826 [AT2g38140] BE558713 AW598994 BE452645 NI
PSRP-5 (AF261940) BE037671 [AT3g56910] BF621665 AW509867 ?NI
PSRP-6 (AF245292) AV532737 [AT5g17870] BG300387 AW126633 AV622927 NI
198 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
The hypothetical AthPSRP-4h and ZmaPSRP-4h
sequences were predicted to be chloroplast proteins by

the ChloroP program [53], but on the other hand, the
PSORT
program [54] predicted them as mitochondrial
matrix proteins or nuclear proteins. It has been suggested
that an N-terminal amphiphilic helix is a critical deter-
minant for mitochondrial sorting [55], and recent NMR
structures of mitochondrial and plastid transit peptides
[56,57] have shown a significant difference in their
secondary structures, i.e. mitochondrial transit peptides
have an N-terminal a-helix region, but plastid transit
peptides have a nonhelical N-terminal region. Secondary-
structure prediction of the N-terminal regions of Ath-
PSRP-4h and ZmaPSRP-4h showed arginine-containing
amphiphilic helices like those of known mitochondrial
transit peptides, whereas the N-termini of PSRP-4
precursors were predicted to be nonhelical structures
(Fig. 7A). Therefore, although the possibility of N-
terminal extended PSRP-4 homologues in the cytoplasm
or in the nuclear matrix cannot be ruled out, we suggest
that the PSRP-4h hypothetical proteins are probably
mitochondrial proteins.
Thx has been visualized in the crystal structure of
T. thermophilus 30S ribosomal subunit [58]. It fits into the
cavity found between the 16S rRNA helices H30, H41,
H41a, H42, and H43 at the top of the 30S ÔheadÕ,thehigh
positive charge of Thx stabilizing the organization of the
RNA elements [58]. These rRNA helices are also conserved
in the plastid 16S rRNA. Therefore, we suggest that PSRP-4
is most likely located at the top of the chloroplast 30S
subunit head, with the Thx-like N-terminal sequence

anchoring it to the ribosome.
The sequence homology between a Thermus ribosomal
protein and the higher plant PSRP-4 requires a comment. A
Thx homologue is not identifiable in the genome sequences
of not only E. coli and other mesophilic bacteria, but also in
the genomes of other thermophilic bacteria such as Aquifex
aelolicus and Thermotoga maritima. Thus, the unusual
sequence resemblance between Thx and PSRP-4 may be due
to a convergent evolution, i.e. PSRP-4 and Thx genes may
have arisen independently acquiring a similar function
(stabilization of the rRNA helices). Another possibility is
that PSRP-4 emerged during chloro-ribosome evolution by
a process of gene capture (by horizontal gene transfer) from
the progenitors of T. thermophilus. Whatever its origin,
experiments transforming E. coli with Thx or PSRP-4 gene
would probably address the questions of thermal stability
and function.
The two PSRPs on the chloroplast large ribosomal
subunit, PSRP-5 and PSRP-6, are also highly basic,
positively charged, small proteins (Table 1). Although these
proteins do not share significant sequence similarity, they
share certain structural characteristics with PSRP-4.
Figure 7B shows the sequences of PSRP-4, PSRP-5c (the
shortest form of PSRP-5 [2]), PSRP-6 and Thx (manually
aligned) and the schematic diagram of a discernible
consensus secondary structure, composed of an N-terminal
lysine/arginine-rich domain, a hydrophobic proline-rich
motif, and a nonconserved C-terminal region. The basic
N-terminal domains of PSRP-5 and PSRP-6 may also serve
Fig. 6. Sequence alignment of spinach PSRP-3 with algal ycf65 gene product and with homologues from higher plants and cyanobacteria. Aligned

sequences (and accession numbers) are: Arabidopsis (1: AT1g8590 and 2: AT5g15760, see also Table 2 and text), barley (AW201241); YCF65 gene
products from P. purpurea (P51351); Guillardia theta (O78422); and Mesostigma viride (AAF43868); YCF65-like hypothetical proteins from
Synechococcus PCC7942 (O05161) and Synechocystis PCC6803 (Q55385). The positions of conserved residues are highlighted: black, identical, and
grey, similar.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 199
to anchor these proteins on the ribosome, just as Thx does in
Thermus ribosomes [58].
In eukaryotic signal transduction, hydorophobic proline-
rich motifs, such as shown in Fig. 7B, have been identified
as the ligands of SH3 domain-containing modulator
proteins [59]. Thus, these three small PSRPs in the two
chloroplast ribosomal subunits, with their hydrophobic
proline-rich motifs anchored on the ribosome by the
N-terminal basic domains, may have the function of
providing accessible sites for nonribosomal factors specific
to the photosynthetic organelle.
The six PSRPs of spinach chloro-ribosome
are identifiable in other higher plants but not always
in lower plants and cyanobacteria
The work reported in this paper completes the identification
and sequence characterization of all the six PSRPs in a
higher plant chloro-ribosome (Table 1). In terms of protein
character PSRPs can be divided into two groups: (a) acidic
proteins, PSRP-1, PSRP-2 and PSRP-3; (b) small/basic
proteins, PSRP-4, PSRP-5 and PSRP-6. They can also be
divided into two groups in terms of their post-translational
modifications: PSRP-1, PSRP-2, PSRP-4 and PSRP-6
occurring without post-translational modification (other
than transit peptide cleavage/removal), and PSRP-3 and
PSRP-5 occurring post-translationally modified, PSRP-3 in

two forms (this paper) and PSRP-5 in three forms [2]. As we
reported previously, post-translational modifications also
occur in at least 14 other chloro-ribosomal proteins: (PRP-)
S1a/b, S5 (uncharacterized N-terminal modification), S6a-
e,S9(a-N-acetylation), S10a/b,S14a/b,S18a/b,S19a/b,L2
(a-N-monomethylation), L10a-c,L11(e-trimethylations of
Lys9 and Lys45), L16 (a-N-monomethylation), L18a/b,and
L31a-c [1,2]. Many of these specific modifications are not
observed in the corresponding E. coli orthologues. Thus,
the evolution of chloroplast ribosome involved not only the
PSRPs but many enzymes that are needed for the post-
translational modifications unique to this ribosome.
All six PSRPs are encoded in the nuclear genome and are
synthesized as precursor forms in the cytosol, carrying
transit peptides that target them to the chloroplast envelope
for import into the organelle. The six PSRP genes (Psrp)
could be identified in the complete genome sequence of
A. thaliana, with the gene loci distributed in four of the five
chromosomes (i.e. except IV). All Psrp genes are present as a
single copy, except for PSRP-3 for which two homologous
sequences are identifiable on chromosome I and chromo-
some V (AT1g68590, Arabidopsis1 and AT5g15760, Ara-
bidopsis2, in Fig. 6). However, while the transcript of
Fig. 7. Sequence alignment of PSRP-4 with mitochondrial proteins and T. thermophilus Thx. Apparent structural similarity of PSRP-4 to PSRP-5
and PSRP-6. (A) Alignment of the transit peptide sequences of pre-PSRP-4 and six other similar precursors. It is followed by the alignment of the
mature proteins and Thx. Predicted secondary structures in the aligned sequences are presented: a-helix, grey; b-sheet, open box; and b-turns,
underlined. Mitochondrial transit peptides of maize superoxide dismutase (ZmaMitoSD) and rice mitochondrial RPS11 (OsaMitoRPS11) are
shown. Conserved amino-acid residues, in bold letters. (B) Sequence alignment of Thx, PSRP-4, PSRP-5c form, and PSRP-6. Basic amino acids
lysine (light grey) and arginine (dark grey) are highlighted. A schematic representation of the shared secondary structure is shown under the
alignment, with the ribosome-binding site of Thx indicated (determined in crystal structure). Accession numbers are: AthPSRP-4 (AF236826),

LesPSRP-4 (AW094412), AthPSRP-4h (AAD23677), ZmaPSRP-4h (AI667826), Thx (P32193), ZmaMitoSD (C48684), and OsaMitoRPS11
(T03690). LesPSRP-4 and ZmaPSRP-4h sequences were obtained from assembled ESTs.
200 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
AT1g68590 is present as an EST clone, that of AT5g15760
has not been reported. Thus, AT5g15760 (chromosome V)
could be a pseudo-gene or a relatively silent gene that is
transcribed under unusual circumstances. Homologues of
all the six Psrps are identifiable in the ESTs of other different
higher plants and a bryophyte. As representatives, Arabid-
opsis, barley and moss ESTs are listed in Table 2. PSRP-1
and PSRP-3 protein genes could be identified in the genome
sequence of a photosynthetic bacterium (Table 2).
Table 2 includes PSRP-2 homologous proteins showing
the highest similarity score. It is unclear whether PSRP-2
counterparts are present in the moss, C. reinhardtii,and
Synechocystis. PSRP-5 homologues are also missing from
the available data for the green alga C. reinhardtii, but
further accumulation of EST data and/or the complete
genome sequence must be awaited for a final decision.
Another uncertain point is whether PSRP homologues
identifiable in the lower plants, algae and photosynthetic
bacteria are true ribosomal proteins. A PSRP-1 homologue
has been immunologically detected in C. reinhardtii ribo-
somes [35]. Several Ôphase-specificÕ ribosome-associated
proteins in E. coli (YfiA, YhbH, SRA, RMF, ÔS22Õ)have
recently been reported [60–64]. PSRP-1 has weak similarity
to YfiA and YhbH proteins, whereas other PSRPs have no
sequence homology with these or any other E. coli proteins.
Regulation of chloroplast protein synthesis
and the evolution of PSRPs

The primary function of ribosome is to be the platform on
which mRNA, tRNA and the various protein synthesis
factors sequentially assemble to perform their functions
with acceptable decoding accuracy and speed, and to
catalyze the peptide bond synthesis. The crystal structure
of the Haloarcula marismortui large ribosomal subunit, at
2.4 A
˚
resolution, revealed the peptidyl transferase center
to be composed of only rRNA [65,66]. The specific
functions of the individual ribosomal proteins are still
unknown in most cases. The E. coli orthologues of the
chloro-ribosome (all except L25 and L30 are represented
in the chloro-ribosome) probably perform functions
similartothatintheE. coli ribosome. On the other
hand, the PSRPs of the chloro-ribosome would have been
evolved, in the energy-rich photosynthetic organelle, to
perform different functions. These may include regulating
protein synthesis in a more global manner, e.g. responding
to the diurnal light and dark cycle and the consequent
rapidly changing ATP/GTP levels in the organelle, and
meeting the high synthetic needs of certain rapidly turning
over proteins of the photosystems.
The human mitochondrial ribosome has 29 distinct
proteins in the small subunit, 14 E. coli orthologues and
15 mitochondrion-specific ribosomal proteins [67]. The
plastid 30S ribosomal subunit, on the other hand, has only
25 proteins, including all 21 of the E. coli orthologues and 4
PSRPs. Thus, whereas mammalian mito-ribosomes are
highly divergent from bacterial ribosome, the plastid

ribosome has apparently maintained its bacterial-type
building blocks while acquiring additional proteins for
specific new translational regulatory functions. The addi-
tional ribosomal proteins seem to have ribosome-binding
sites similar to those of E. coli. For example, PSRP-1
expressed in E. coli is readily assembled in E. coli 30S
subunits, 70S ribosomes and polysomes, and the incorpor-
ated PSRP-1 did not interfere with protein synthesis [35].
Light-activated translation of psbA mRNA has been
extensively investigated in the green alga, C. reinhardtii.A
light-activated translational initiation model has been
proposed, based on the characteristics of psbA mRNA
5¢-UTR-binding proteins which are modulated in a light-
dependent manner, e.g. sensing redox potential and ATP/
ADP ratio [7,8,68]. A model for light-regulated translation
activation has been proposed in C. reinhardtii viaaspecific
interaction between psbA mRNA 5¢-UTR and RB47, a
chloroplast poly(A)-binding protein [40,69]. In tobacco
chloroplast, most mRNAs encoding photosynthesis-related
proteins (psbA, rbcL, petD) occur ribosome free, and they
accumulate as stable mRNA–cpRNP complexes [70,71]. In
barley, it has been reported that there is a light-induced
increase in psbA mRNA abundance in membrane poly-
somes, and a shift of psbA mRNA into larger polysomes,
suggesting light activation of translation initiation [72]. It is
not known, and a model has not been proposed so far, on
how plastid ribosomes actually recognize light-activated
mRNA.
We have proposed that PSRPs in the chloro-30S may
form one or more Ôplastid-specific translation regulatory

modulesÕ [2]. Here we represent a working model for light-
activated translation initiation (Fig. 8), via such a plastid-
specific translation regulatory module, involving mainly
PSRP-2. In the dark, cpRNPs would bind mRNAs to
stabilize and protect them from nucleases [71] and to
prevent their association with 30S subunits. Spinach 28RNP
can be phosphorylated at its acidic N-terminal domain [73].
The RNA-binding affinity of the phosphorylated protein is
reduced three- to fourfold in vitro compared with the
nonphosphorylated form [73]. In the presence of light,
cpRNP would be phosphorylated at its N-terminal acidic
domain (and/or modulated by protein factors), weakening
the cpRNP–mRNA interaction, allowing PSRP-2, a
cpRNP homologue lacking the N-terminal acidic domain
Fig. 8. A model for light-activated translation regulation and the chloro-
ribosome cycle. Working model for light-activated translation initi-
ation (see text for details). A hypothetical translation regulatory
module (comprising mainly PSRP-2) is highlighted. The positions of
all PSRPs on spinach chloro-ribosome have been tentatively assigned
using cryo-electron microscopy (R. Agrawal, personal communica-
tion). Circled P stands for phosphorylation or protein factor associ-
ation. pRRF, plastid ribosome recycling factor.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 201
(Fig. 5), to take over the mRNA from the cpRNP–mRNA
complex on the ribosome (Fig. 8).
Photosynthetic bacteria possess several RNA-binding
proteins that have no counterparts in E.coli,aswellasa
nonribosomal nucleic acid-binding protein similar to E. coli
S1 (Nbp1), and the ribosomal orthologue of ribosomal
protein S1 [74]. Higher plant chloroplasts possess cpRNPs

and other RNA-binding proteins [41,44,45]. These nonri-
bosomal RNA-binding proteins in photosynthetic bacteria
and plant chloroplasts are likely to be required as transcript
mediators and stabilizers of mRNA, until the latter is able to
bind, in the illuminated state, to the small chloro-subunit
(Fig. 8).
It is possible that the PSRP-2 binding of mRNA involves
co-operation with the plasid ribosomal protein S1. E. coli
S1 protein (61 kDa) consists of six S1 motifs, each
comprising  70 amino-acid residues [75]. The two N-
terminal motifs are involved in ribosome binding, and three
of the C-terminal domains are required for mRNA
recognition [6,75,76], with the last domain involved in the
autoregulation of S1 mRNA [77]. Cyanobacterial and
chloro-S1 orthologues are truncated proteins ( 40 kDa),
and have essentially only a total of three S1 motifs, thus
showing similarity to only the N-terminal half of E. coli S1
[74,78]. Spinach chloro-S1 has been shown to associate with
the psbA mRNA 5¢-UTR [79], and the RNA-binding site
has been reported to be in the C-terminal half of the
molecule [80]. Recently, S1 protein mass has been visualized
in the cryo-electron microscopic map of the E. coli ribosome
[81]. S1 protein interacts with the 11 A/U-rich nucleotides
immediately upstream of the Shine-Dalgarno sequence, at
the junction of the head platform and the body of the small
subunit [81].
Most E. coli mRNAs have Shine–Dalgarno sequences
that are 2–7 nucleotides upstream from the initiation codon,
and this position is critical [82]. On the other hand,
photosynthetic bacterial and chloro-mRNAs have Shine–

Dalgarno-like sequences up to 30 nucleotides upstream
from the initiation codon or are often even missing [83].
Usingatobaccoin vitro translation system, Hirose &
Sugiura [18] have proposed formation of a factor-mediated
translation initiation complex at the 5¢-UTR of psbA
mRNA. As regulation of translation initiation is likely to
occur at or near the S1 protein and the trans-factors and cis-
elements in the 5¢-UTR of plastid mRNAs, PSRP-2 may be
located adjacent to the truncated plastid S1, complementing
the binding affinity at the 5¢-UTR of light-activated mRNA
(Fig. 8). Recently, significant progress has been made using
cryo-electron microscopy, to establish the 3D positions of
the PSRPs in the spinach chloro-ribosome (R. Agrawal,
personal communication).
A second possible light-activated pathway for chloroplast
translation initiation could be through chloro-ribosome
dissociation/association equilibrium (Fig. 8). We have iden-
tified stoichiometric amounts of the chloroplast ribosome
recycling factor (pRRF) in the plastid 70S ribosome [2] and
have proposed that pRRF acts as a de facto antidissociation
factor [2]. Thus, after translation termination and release of
mRNA/tRNA through RRF-mediated GTP hydrolysis,
chloro-ribosome is likely to be present as a stable ribosome–
pRRF complex. In this context, the activity of Euglena
gracilis chloro-initiation factor-3 (pIF-3) is reported to be
 100-fold modulated by the presence or absence of its
chloroplast-specific N-terminal and C-terminal extensions
[84]. It is important to recall that IF-3 was initially
discovered as a ribosome dissociation factor [85]. If
chloro-IF-3 is activated by illumination to dissociate the

stable ribosome–pRRF complex, this pathway of light-
activated translation initiation may provide a second
regulatory loop for chloroplast protein synthesis (Fig. 8).
Possible nonribosomal functions for PSRPs
PSRPs are unitary constituents of the chloro-ribosome, as
they are present in the same stoichiometry as the chloro-
orthologues of E. coli ribosomal proteins [1,2]. However,
PSRP-1 has been reported to be present in a free state, at a
high concentration, in the chloroplast stromal fluid [20].
Thus multiple organelle functions for this protein are
indicated. Interestingly, PSRP-1 shows significant sequence
similarity to a host of unusual nonribosomal proteins: e.g.
the light-repressed transcript (LrtA) of Synechococcus and
bacterial transcription modulator protein sigma 54 [86].
There are several examples of E. coli ribosomal proteins
sharing functions in the transcription machinery: ribosomal
protein S10 is also known as transcription antitermination
protein NusE [87], and recent reports suggest that
ribosomal proteins S4, L3, L4, and L13 are also involved
in the E. coli antitermination transcription complex [88].
Ribosomal protein S1 has long been known to be a
required component of the replicase enzyme of E. coli
RNA phages [75]. Many of the human and animal
cytosolic ribosomal proteins have been suggested to
perform a wide variety of ÔextraribosomalÕ functions in
the cell (reviewed in [89]). Recently, PSRP-1 has been
copurified with chloroplast RNase P, suggesting its poss-
ible participation in organelle RNA processing (P. Gegen-
heimer, personal communication). As described above,
PSRP-2 has sequence similarity to a large group of RNA-

binding proteins involved in mRNA processing, and we
have made use of this finding in our proposed general
model for PSRP function (Fig. 8). A correlation between
the processing of psbA mRNA 5¢-UTR and ribosome
association in Chlamydomonas has been reported [90].
Thus, it appears possible that PSRPs, either in free form or
on the ribosomal subunits, may be involved in certain
nontranslational functions in photosynthetic organelles.
Acknowledgements
We thank Klaus von Knoblauch for skilful technical assistance. The
research at the University of Arizona was supported by the Max-
Planck Gesellschaft through a Sponsored Research Grant to A.R.S.
(Protein Synthesis and Regulation). We would like to dedicate this
paper to the memories of Bernard D. Davis, Herman M. Kalckar and
Heinz-Guenter Wittmann (senior colleagues of A.R.S.), and recall their
contributions on antibiotics, ATP/GTP, and protein biosynthesis.
References
1. Yamaguchi, K., von Knoblauch, K. & Subramanian, A.R. (2000)
The plastid ribosomal proteins: Identification of all the proteins in
the 30S subunit of an organelle ribosome (chloroplast). J. Biol.
Chem. 275, 28455–28465.
202 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
2. Yamaguchi, K. & Subramanian, A.R. (2000) The plastid riboso-
mal proteins: Identification of all the proteins in the 50S subunit of
an organelle ribosome (chloroplast). J. Biol. Chem. 275, 28466–
28482.
3. Subramanian, A.R., Stahl, D. & Prombona, A. (1990) Ribosomal
proteins, ribosomes, and translation in plastids. In: The Molecular
Biology of Plastids (Bogorad, L. & Vasil, I.K., eds), pp. 191–215.
Academic Press, New York, USA.

4. Subramanian, A.R. (1993) Molecular genetics of chloroplast
ribosomal proteins. Trends Biochem. Sci. 18, 177–180.
5. Harris, E.H., Boynton, J.E. & Gillham, N.W. (1994) Chloroplast
ribosomes and protein synthesis. Microbiol. Rev. 58, 700–754.
6. Subramanian, A.R. (1985) The ribosome: Its evolutionary diver-
sity and the functional role of one of its components. Essays
Biochem. 21,45–85.
7.Mayfield,S.P.,Yohn,C.B.,Cohen,A.&Danon,A.(1995)
Regulation of chloroplast gene expression. Annu. Rev. Plant
Physiol. Plant Mol. Biol. 46, 147–166.
8. Somanchi, A. & Mayfield, S.P. (2001) Regulaion of chloroplast
translation. In Advances in Photosynthesis and Respiration,Vol.11
Regulation of Photosynthesis (Aro, E M. & Andersson, B., eds),
pp. 137–151. Kluwer. Academic Publishers, the Netherlands.
9. Rochaix (1992) Post-transcriptional steps in the expression of
chloroplast genes. Annu. Rev. Cell Biol. 8, 1–28.
10. Herrmann, R.G., Westhoff, P. & Link, G. (1992) Biogenesis of
plastids in higher plants. In Advances in Plant Gene Research,Vol.
VI Cell Organelles. (Herrmann, R.G., ed.), pp. 276–349. Springer-
Verlag, Berlin, Germany.
11. Gruissem, W. & Tonkyn, J.C. (1993) Control mechanisms of
plastid gene expression. Crit. Rev. Plant Sci. 12, 19–55.
12. Mullet, J.E. (1993) Dynamic regulation of chloroplast transcrip-
tion. Plant Physiol. 103, 309–313.
13. Sugita, M. & Sugiura, M. (1996) Regulation of gene expression in
chloroplasts of higher plants. Plant Mol. Biol. 32, 315–326.
14. Barkan, A. & Goldschmidt-Clermont, M. (2000) Participation
of nuclear genes in chloroplast gene expression. Biochimie 82,
559–572.
15. Hirose, T. & Sugiura, M. (2001) Involvement of a site-specific

trans-acting factor and a common RNA-binding protein in the
editing of chloroplast mRNAs: development of a chloroplast
in vitro RNA editing system. EMBO J. 20, 1144–1152.
16. Staub, J.M. & Maliga, P. (1993) Accumulation of D1 polypeptide
in tobacco plastids is regulated via the untranslated region of the
psbA mRNA. EMBO J. 12, 601–606.
17. Berry, J.O., Breiding, D.E. & Klessig, D.F. (1990) Light-mediated
control of translational initiation of ribulose-1,5-bisphosphate
carboxylase in amaranth cotyledons. Plant Cell 2, 795–803.
18. Hirose, T. & Sugiura, M. (1996) Cis-acting elements and trans-
acting factors for accurate translation of chloroplast psbA
mRNAs: development of an in vitro translation system from
tobacco chloroplasts. EMBO J. 15, 1687–1695.
19. Barber, J. (1998) Photosystem two. Biochim. Biophys. Acta 1365,
269–277.
20. Zhou, D.X. & Mache, R. (1989) Presence in the stroma of
chloroplasts of a large pool of a ribosomal protein not structurally
related to any Escherichia coli ribosomal protein. Mol. General
Genet. 219, 204–208.
21. Johnson, C.H., Kruft, V. & Subramanian, A.R. (1990) Identifi-
cation of a plastid-specific ribosomal protein in the 30 S subunit of
chloroplast ribosomes and isolation of the cDNA clone encoding
its cytoplasmic precursor. J. Biol. Chem. 265, 12790–12795.
22. Gantt, J.S. (1988) Nucleotide sequences of cDNAs encoding four
complete nuclear-encoded plastid ribosomal proteins. Curr. Genet.
14, 519–528.
23. Bartsch, M., Kimura, M. & Subramanian, A.R. (1982) Purifica-
tion, primary structure, and homology relationships of a chloro-
plast ribosomal protein. Proc. Natl Acad. Sci. USA 79, 6871–
6875.

24. Laemmli, U.K. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680–685.
25. Subramanian, A.R. (1974) Sensitive separation procedure for
Escherichia coli ribosomal proteins and the resolution of high-
molecular-weight components. Eur. J. Biochem. 45, 541–546.
26. Scha
¨
gger, H. & von Jagow, G. (1987) Tricine-sodium dodecyl
sulfate-polyacrylamide gel electrophoresis for the separation of
proteins in the range from 1 to 100 kDa. Anal. Biochem. 166,368–
379.
27. Hellman, U., Wernstedt, C., Gonez, J. & Heldin, C.H. (1995)
Improvement of an ÔIn-GelÕ digestion procedure for the micro-
preparation of internal protein fragments for amino acid sequen-
cing. Anal. Biochem. 224, 451–455.
28. Giese, K. & Subramanian, A.R. (1989) Chloroplast ribosomal
protein L12 is encoded in the nucleus: construction and identifi-
cation of its cDNA clones and nucleotide sequence including the
transit peptide. Biochemistry 28, 3525–3529.
29. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, USA.
30. G.C.G. (1998) Wisconsin Package, Version 10.0. Genetics Com-
puter Group, Madison, Wisconsin, USA.
31. Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res. 22, 4673–
4680.
32. Chou, P.Y. & Fasman, G.D. (1978) Empirical predictions of

protein conformation. Annu.Rev.Biochem.47, 251–276.
33. Garnier, J., Levin, J.M., Gibrat, J.F. & Biou, V. (1990) Secondary
structure prediction and protein design. Biochem. Soc. Symp 57,
11–24.
34. Price, C.A., Reardon, E.M. & Lonsdale, D.M. (1996) A guide to
naming sequenced plant genes. Plant Mol. Biol. 30, 225–227.
35. Bubunenko, M.G. & Subramanian, A.R. (1994) Recognition of
novel and divergent higher plant chloroplast ribosomal proteins
by Escherichia coli ribosome during in vivo assembly. J. Biol.
Chem. 269, 18223–18231.
36. Schmidt, J., Srinivasa, B., Weglo
¨
hner, W. & Subramanian, A.R.
(1993) A small novel chloroplast ribosomal protein (S31) that has
no apparent counterpart in the E. coli ribosome. Biochem. Mol.
Biol. Int. 29,25–31.
37. Schmitz-Linneweber, C., Maier, R.M., Alcaraz, J.P., Cottet, A.,
Herrmann, R.G. & Mache, R. (2001) The plastid chromosome of
spinach (Spinacia oleracea): complete nucleotide sequence and
gene organization. Plant Mol. Biol. 45, 307–315.
38. Sugiura, M. (1992) The chloroplast genome. Plant Mol. Biol. 19,
149–168.
39. Oubridge, C., Ito, N., Evans, P.R., Teo, C.H. & Nagai, K. (1994)
Crystal structure at 1.92 A
˚
resolution of the RNA-binding domain
of the U1A spliceosomal protein complexed with an RNA hairpin.
Nature 372, 432–438.
40. Yohn, C.B., Cohen, A., Danon, A. & Mayfield, S.P. (1998) A poly
(A) binding protein functions in the chloroplast as a message-

specific translation factor. Proc. Natl Acad. Sci. USA 95, 2238–
2243.
41. Dunn, M.A., Brown, K., Lightowlers, R. & Hughes, M.A. (1996)
A low-temperature-responsive gene from barley encodes a protein
with single-stranded nucleic acid-binding activity which is phos-
phorylated in vitro. Plant Mol. Biol. 30, 947–959.
42. Buvoli, M., Biamonti, G., Tsoulfas, P., Bassi, M.T., Ghetti, A.,
Riva, S. & Morandi, C. (1988) cDNA cloning of human hnRNP
protein A1 reveals the existence of multiple mRNA. Nucleic Acids
Res. 16, 3751–3770.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 203
43. Query, C.C., Bentley, R.C. & Keene, J.D. (1989) A common RNA
recognition motif identified within a defined U1 RNA binding
domain of the 70K, U1 snRNP protein. Cell 57, 89–101.
44. Li, Y.Q. & Sugiura, M. (1990) Three distinct ribonucleoproteins
from tobacco chloroplasts: each contains a unique amino terminal
acidic domain and two ribonucleoprotein consensus motifs.
EMBO J. 9, 3059–3066.
45. Ye, L.H., Li, Y.Q., Fukami-Kobayashi, K., Go, M., Konishi, T.,
Watanabe, A. & Sugiura, M. (1991) Diversity of a ribonucleo-
protein family in tobacco chloroplasts: two new chloroplast
ribonucleoproteins and a phylogenetic tree of ten chloroplast
RNA-binding domains. Nucleic Acids Res. 19, 6485–6490.
46. Maruyama, K., Sato, N. & Ohta, N. (1999) Conservation of
structure and cold-regulation of RNA-binding proteins in cya-
nobacteria: probable convergent evolution with eukaryotic gly-
cine-rich RNA-binding proteins. Nucleic Acids Res. 27, 2029–2036.
47. Stoebe, B., Martin, W. & Kowallik, K.V. (1998) Distribution and
nomenclature of protein-coding genes in 12 sequenced chloroplast
genomes. Plant Mol. Biol. Report 16, 243–255.

48. Reith, M.E. & Munholland, J. (1995) Complete nucleotide
sequence of the Porphyra purpurea chloroplast genome. Plant Mol.
Biol. Report 13, 333–335.
49. Wakasugi, T., Nagai, T., Kapoor, M., Sugita, M., Ito, M., Ito, S.,
Tsudzuki, J., Nakashima, K., Tsudzuki, T., Suzuki, Y., Hamada,
A., Ohta, T., Inamura, A., Yoshinaga, K. & Sugiura, M. (1997)
Complete nucleotide sequence of the chloroplast genome from the
green alga Chlorella vulgaris: the existence of genes possibly
involved in chloroplast division. Proc. Natl Acad. Sci. USA 94,
5967–5972.
50. Ramagopal, S. & Subramanian, A.R. (1974) Alteration in the
acetylation level of ribosomal protein L12 during the growth cycle
of Escherichia coli. Proc. Natl Acad. Sci. USA 71, 2136–2140.
51. Tsiboli, P., Herfurth, E. & Choli, T. (1994) Purification and
characterization of the 30S ribosomal proteins from the bacterium
Thermus thermophilus. Eur. J. Biochem. 226, 169–177.
52. Leontiadou, F., Triantafillidou, D. & Choli-Papadopoulos, T.
(2001) On the characterization of the putative S20-Thx operon of
Thermus thermophilus. Biol. Chem. 382, 1001–1006.
53. Emanuelsson, O., Nielsen, H. & von Heijne, G. (1999) ChloroP, a
neural network-based method for predicting chloroplast transit
peptides and their cleavage sites. Protein Sci. 8, 978–984.
54. Nakai, K. & Kanehisa, M. (1992) A knowledge base for predicting
protein localization sites in eukaryotic cells. Genomics 14, 897–911.
55. von Heijne, G. (1986) Mitochondrial targeting sequences may
form amphiphilic helices. EMBO J. 5, 1335–1342.
56. Lancelin, J.M., Bally, I., Arlaud, G.J., Blackledge, M., Gans, P.,
Stein, M. & Jacquot, J.P. (1994) NMR structures of ferredoxin
chloroplastic transit peptide from Chlamydomonas reinhardtii
promoted by trifluoroethanol in aqueous solution. FEBS Lett.

343, 261–266.
57. Lancelin, J.M., Gans, P., Bouchayer, E., Bally, I., Arlaud, G.J. &
Jacquot, J.P. (1996) NMR structures of a mitochondrial transit
peptide from the green alga Chlamydomonas reinhardtii. FEBS
Lett. 391, 203–208.
58. Wimberly, B.T., Brodersen, D.E., Clemons, W.M. Jr, Morgan-
Warren, R.J., Carter, A.P., Vonrhein, C., Hartsch, T. &
Ramakrishnan, V. (2000) Structure of the 30S ribosomal subunit.
Nature 407, 327–339.
59. Cohen, G.B., Ren, R. & Baltimore, D. (1995) Modular binding
domains in signal transduction proteins. Cell 80, 237–248.
60. Agafonov, D.E., Kolb, V.A., Nazimov, I.V. & Spirin, A.S. (1999)
A protein residing at the subunit interface of the bacterial ribo-
some. Proc. Natl Acad. Sci. USA 96, 12345–12349.
61. Maki, Y., Yoshida, H. & Wada, A. (2000) Two proteins, YfiA and
YhbH, associated with resting ribosomes in stationary phase
Escherichia coli. Genes Cells 5, 965–974.
62. Izutsu, K., Wada, C., Komine, Y., Sako, T., Ueguchi, C., Nakura,
S. & Wada, A. (2001) Escherichia coli ribosome-associated protein
SRA, whose copy number increases during stationary phase.
J. Bacteriol. 183, 2765–2773.
63.Wada,A.,Yamazaki,Y.,Fujita,N.&Ishihama,A.(1990)
Structure and probable genetic location of a Ôribosome modulation
factorÕ associated with 100S ribosomes in stationary-phase
Escherichia coli cells. Proc. Natl Acad. Sci. USA 87, 2657–2661.
64. Wada, A. (1998) Growth phase coupled modulation of Escheri-
chia coli ribosomes. Genes Cells 3, 203–208.
65. Ban, N., Nissen, P., Hansen, J., Moore, P.B. & Steitz, T.A. (2000)
The complete atomic structure of the large ribosomal subunit at
2.4 A

˚
resolution. Science 289, 905–920.
66. Nissen, P., Hansen, J., Ban, N., Moore, P.B. & Steitz, T.A. (2000)
The structural basis of ribosome activity in peptide bond synthesis.
Science 289, 920–930.
67. Koc, E.C., Burkhart, W., Blackburn, K., Moseley, A. & Spre-
mulli, L.L. (2001) The small subunit of the mammalian
mitochondrial ribosome. Identification of the full complement of
ribosomal proteins present. J. Biol. Chem. 276, 19363–19374.
68. Danon, A. & Mayfield, S.P. (1994) ADP-dependent phosphor-
ylation regulates RNA-binding in vitro: implications in light-
modulated translation. EMBO J. 13, 2227–2235.
69. Fong, C.L., Lentz, A. & Mayfield, S.P. (2000) Disulfide bond
formation between RNA binding domains is used to regulate
mRNA binding activity of the chloroplast poly(A)-binding pro-
tein. J. Biol. Chem. 275, 8275–8278.
70.Nakamura,T.,Ohta,M.,Sugiura,M.&Sugita,M.(1999)
Chloroplast ribonucleoproteins are associated with both mRNAs
and intron-containing precursor tRNAs. FEBS Lett. 460, 437–
441.
71.Nakamura,T.,Ohta,M.,Sugiura,M.&Sugita,M.(2001)
Chloroplast ribonucleoproteins function as a stabilizing factor
of ribosome-free mRNAs in the stroma. J. Biol. Chem. 276,
147–152.
72. Kim, J. & Mullet, J.E. (1994) Ribosome-binding sites on chloro-
plast rbcL and psbA mRNAs and light-induced initiation of D1
translation. Plant Mol. Biol. 25, 437–448.
73. Lisitsky, I. & Schuster, G. (1995) Phosphorylation of a chloroplast
RNA-binding protein changes its affinity to RNA. Nucleic Acids
Res. 23, 2506–2511.

74. Sugita, C., Sugiura, M. & Sugita, M. (2000) A novel nucleic acid-
binding protein in the cyanobacterium Synechococcus sp.
PCC6301: a soluble 33-kDa polypeptide with high sequence
similarity to ribosomal protein S1. Mol. General Genet. 263, 655–
663.
75. Subramanian, A.R. (1983) Structure and functions of ribosomal
protein S1. Prog. Nucleic Acid Res. Mol. Biol. 28, 101–142.
76. Subramanian, A.R. (1984) Structure and functions of the largest
Escherichia coli ribosomal protein. Trends Biochem. Sci. 9, 491–
494.
77. Boni, I.V., Artamonova, V.S. & Dreyfus, M. (2000) The last
RNA-binding repeat of the Escherichia coli ribosomal protein S1
is specifically involved in autogenous control. J. Bacteriol. 182,
5872–5879.
78. Franzetti, B., Carol, P. & Mache, R. (1992) Characterization and
RNA-binding properties of a chloroplast S1-like ribosomal pro-
tein. J. Biol. Chem. 267, 19075–19081.
79. Alexander, C., Faber, N. & Klaff, P. (1998) Characterization of
protein-binding to the spinach chloroplast psbA mRNA 5¢
untranslated region. Nucleic Acids Res. 26, 2265–2272.
80. Shteiman-Kotler, A. & Schuster, G. (2000) RNA-binding char-
acteristics of the chloroplast S1-like ribosomal protein CS1.
Nucleic Acids Res. 28, 3310–3315.
81. Sengupta, J., Agrawal, R.K. & Frank, J. (2001) Visualization of
protein S1 within the 30S ribosomal subunit and its interaction
204 K. Yamaguchi and A. R. Subramanian (Eur. J. Biochem. 270) Ó FEBS 2003
with messenger RNA. Proc. Natl Acad. Sci. USA 98, 11991–
11996.
82. McCarthy, J.E.G. & Brimacombe, R. (1994) Prokaryotic trans-
lation: the interactive pathway leading to initiation. Trends Genet.

10, 402–407.
83. Sugiura, M., Hirose, T. & Sugita, M. (1998) Evolution and
mechanism of translation in chloroplasts. Annu.Rev.Genet.32,
437–459.
84. Yu, N.J. & Spremulli, L.L. (1998) Regulation of the activity of
chloroplast translational initiation factor 3 by NH2- and COOH-
terminal extensions. J. Biol. Chem. 273, 3871–3877.
85. Subramanian, A.R. & Davis, B.D. (1970) Activity of initiation
factor F3 in dissociating Escherichia coli ribosomes. Nature 228,
1273–1275.
86. Tan, X., Varughese, M. & Widger, W.R. (1994) A light-repressed
transcript found in Synechococcus PCC 7002 is similar to a
chloroplast-specific small subunit ribosomal protein and to a
transcription modulator protein associated with sigma 54. J. Biol.
Chem. 269, 20905–20912.
87. Das, A., Ghosh, B., Barik, S. & Wolska, K. (1985) Evidence that
ribosomal protein S10 itself is a cellular component necessary for
transcription antiterminationby phage lambda N protein. Proc.
NatlAcad.Sci.USA82, 4070–4074.
88. Torres, M., Condon, C., Balada, J.M., Squires, C. & Squires, C.L.
(2001) Ribosomal protein S4 is a transcription factor with prop-
erties remarkably similar to NusA, a protein involved in both non-
ribosomal and ribosomal RNA antitermination. EMBO J. 20,
3811–3820.
89. Wool, I.G. (1996) Extraribosomal functions of ribosomal pro-
teins. Trends Biochem. Sci. 21, 164–165.
90. Bruick, R.K. & Mayfield, S.P. (1998) Processing of the psbA 5¢
untranslated region in Chlamydomonas reinhardtii depends upon
factors mediating ribosome association. J. Cell Biol. 143, 1145–
1153.

91. Kozak, M. (1986) Point mutations define a sequence flanking the
AUG initiator codon that modulates translation by eukaryotic
ribosomes. Cell 44, 283–292.
92. Bisanz-Seyer, C. & Mache, R. (1992) Organization and expression
of the nuclear gene coding for the plastid-specific S22 ribosomal
protein from spinach. Plant Mol. Biol. 18, 337–341.
93. Wada, A., Koyama, K., Maki, Y., Shimoi, Y., Tanaka, A. &
Tsuji, H. (1993) A 5 kDa protein (SCS23) from the 30 S subunit of
the spinach chloroplast ribosome. FEBS Lett. 319, 115–118.
94. Carol, P., Li, Y.F. & Mache, R. (1991) Conservation and evolu-
tion of the nucleus-encoded and chloroplast-specific ribosomal
proteins in pea and spinach. Gene 103, 139–145.
Ó FEBS 2003 Chloroplast-specific ribosomal proteins (Eur. J. Biochem. 270) 205