Báo cáo khoa học: Mixed lineage kinase LZK and antioxidant protein-1 activate NF-jB synergistically docx

Mixed lineage kinase LZK and antioxidant protein-1 activate
NF-jB synergistically
Megumi Masaki, Atsushi Ikeda, Eriko Shiraki, Shogo Oka and Toshisuke Kawasaki
Department of Biological Chemistry and CREST (Core Research for Educational Science and Technology) Project,
Japan Science and Technology Corporation, Graduate School of Pharmaceutical Sciences, Kyoto University, Kyoto, Japan
Leucine zipper-bearing kinase (LZK) is a novel member of
the mixed lineage kinase (MLK) family [Sakuma, H., Ikeda,
A.,Oka,S.,Kozutsumi,Y.,Zanetta,J.P.,andKawasaki,T.
(1997) J. Biol. Chem. 272, 28622–28629]. We have previously
shown that LZK activates the c-Jun-NH
2
terminal kinase
(JNK) pathway, but not the extracellular signal-related
kinase (ERK) pathway, by acting as a mitogen-activated
protein kinase kinase kinase (MAPKKK) [Ikeda, A.,
Hasegawa, K., Masaki, M., Moriguchi, T., Nishida, E.,
Kozutsumi, Y., Oka, S., and Kawasaki, T. (2001) J. Bio-
chem. 130, 773–781]. However, the mode of activation of
LZK remains largely unknown. By means of a yeast
two-hybrid screening system, we have identified a molecule
localized to mitochondria, antioxidant protein-1 (AOP-1),
that binds to LZK and which acts as a modulator of LZK
activity. Recently, several MAPKKKs involved in the JNK
pathway, such as MEKK1, TAK1 and MLK3, were shown,
using over-expression assay systems, to activate a tran-
scription factor, NF-jB, through activation of the IKK
complex. Using similar assay systems, we demonstrated that
LZK activated NF-jB-dependent transcription through
IKK activation only weakly, but this was reproducible, and
that AOP-1 enhanced the LZK-induced NF-jB activation.
We also provided evidence that LZK was associated directly

with the IKK complex through the kinase domain, and that
AOP-1 was recruited to the IKK complex through the
binding to LZK.
Keywords: antioxidant protein; JNK/SAPK pathway;
MLK; NF-jB; yeast two-hybrid system.
The JNK/SAPK pathway is one of the major signal
transduction pathways activated when cells are exposed to
inflammatory cytokines or stress [1–5]. Similar to other
MAP kinase (MAPK) pathways, the JNK pathway
involves at least three types of protein kinases, MAPK,
MAPK kinase (MAPKK) and MAPKK kinase (MAP
KKK). Upon activation, MAPKKK is first activated by an
extracellular stimulus, and then phosphorylates and acti-
vates MAPKK. The activated MAPKK phosphorylates
MAPK at the conserved threonine and tyrosine residues
within the kinase catalytic domain. The phosphorylated
MAPK is then translocated to the nucleus, where it
phosphorylates various target molecules, such as transcrip-
tion factors, leading to regulation of gene expression. A
number of MAPKKK in the JNK pathway, such as
MEKK1 [6]; TGF-b activated kinase 1 (TAK1) [7];
apoptosis signal-regulated kinase 1 (ASK1) [8] and MLK
family proteins [9–14], have been cloned and characterized
from mammalian cells, but the physiological significance of
these remains to be determined. We reported previously the
molecular cloning and characterization of a novel MLK,
leucine zipper-bearing kinase (LZK), from human brains
[15]. Like other MLK family proteins, LZK contains a
kinase catalytic domain, which is a hybrid between those of
serine/threonine kinases and tyrosine kinases, followed by

two short leucine zipper-like motifs called the Ôdual leucine
zipper-like motifsÕ. LZK directly phosphorylates and acti-
vates MKK7 (and SEK1/MKK4 to a lesser extent), leading
to activation of JNK, indicating that LZK is a MAPKKK
in the JNK pathway. LZK forms a dimer or oligomer in
cells through its dual leucine zipper-like motif, and this
dimerization/oligomerization is essential for LZK to acti-
vate the JNK pathway [16].
Most MAPKKK molecules are thought to be in an
inactive state when expressed in cells and to be activated
when stimulated. However, MLKs, including LZK, readily
activate the JNK pathway when expressed in cells and do
not require any exogenous activators. Recently, the activity
of MUK, one of the MLKs, which exhibits the highest
sequence similarity to LZK, was shown to be regulated via
binding to its inhibitor, MBIP1 [17]. This suggests that LZK
might be regulated through association with other modu-
lator(s) in cells. To identify these modulators for LZK, we
performed yeast two-hybrid screening, and isolated a cDNA
that encodes a thioredoxin peroxidase, AOP-1.
Some MAPKKK are known to trigger NF-jB dependent
transcription via phosphorylation and activation of the
Correspondence to T. Kawasaki, Department of Biological Chemistry,
Graduate School of Pharmaceutical Sciences,
Kyoto University, Kyoto, Japan.
Fax: + 81 75 753 4605, Tel.: + 81 75 753 4572,
E-mail:
Abbreviations: LZK, leucine zipper-bearing kinase; AOP-1,
antioxidant protein-1; MLK, mixed lineage kinase; JNK, c-Jun NH
2

terminal kinase; MAPK, mitogen-activated protein kinase;
MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MUK,
MAPK-upstream kinase; DLK, dual leucine zipper-bearing kinase;
IjB, inhibitor of NF-jB; MBIP1, MUK-binding inhibitory protein 1;
IKK, IjB kinase; HA, hemagglutinin; GST, glutathione S-transferase;
NaCl/P
i
, phosphate-buffered saline.
(Received 1 July 2002, revised 23 October 2002,
accepted 12 November 2002)
Eur. J. Biochem. 270, 76–83 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03363.x
IKK complex directly [18,19], or indirectly through another
type of protein kinase such as NF-jB inducing kinase
(NIK) [20]. Recently, MLK3 was shown to associate with
the IKK complex, and to phosphorylate IKKa and IKKb
directly [21]. In the present study, we demonstrate that LZK
also associates with IKKb and the activated IKK complex.
Interestingly, AOP-1 was recruited to the IKK complex via
binding to LZK and enhanced the LZK-induced NF-jB
activation.
Experimental procedures
Plasmids, antibodies and reagents
The expression constructs of pcDNA His-LZK, a series of
His-tagged LZK deletion mutants, were described previ-
ously [16, 22]. To construct an expression vector for AOP-1,
the full-length cDNA for the AOP-1 coding region was
amplified by PCR, and then subcloned into the pEF Flag
vector [22] with XbaIandBamHI restriction sites. The
oligonucleotides used for PCR were; 5¢-CCCTCTAGAA
TGGCGGCTGCTGTAGGACG-3¢ and 5¢-CCCGGATC

CCTACTGATTTACCTTCTGAAAGTAC-3¢,assense
and antisense primers, respectively. Expression construct
pcDNA Myc/His-AOP-1, the full-length cDNA for the
AOP-1 coding region, was amplified by PCR and subcloned
into the pcDNA Myc/His vector (Invitrogene). The oligo-
nucleotides used for PCR were: 5¢-TCCGAATTCATG
GCGGCTGCTGTAGGAC-3¢ and 5¢-TCCAAGCTTCT
GATTTACCTTCTGAAAGTAC-3¢,assenseandanti-
sense primers, respectively. The expression vectors for
antioxidation-negative AOP-1 point mutants were con-
structed by PCR-based site-directed mutagenesis [23], TGT
(C178) being converted into AGT (Ser) in the C178S
mutant, and TGC (C229) into AGC (Ser) in the C229S
mutant. The sequences of the oligonucleotides used for
C178S and C229S were: 5¢-ATTTCACCTTTGTG
AG
TCCTACAGAAATTG-3¢ and 5¢-CACATGGAGAA
GTC
AGCCCAGCGAACTGGA-3¢, respectively. The
mismatched nucleotides for mutagenesis are underlined.
To construct pcDNA3.1 Flag-IKKb, the full-length cDNA
for the IKKb coding region was amplified by PCR and then
subcloned into the pcDNA 3.1vector (Invitrogene). Expres-
sion construct pSRa HA-JNK was provided generously by
E. Nishida [7,24,25]. pGEX-6P1 IjBa(1–54) was provided
generously by K. Shimotohno [26]. Anti-His and Anti-HA
Ig were purchased from Qiagen and Santa Cruz Biotech-
nologies, respectively. Anti-Flag and anti-(phosphorylated
JNK) Igs were from Sigma and Promega, respectively. A
Matchmaker Yeast Two-Hybrid System 2 kit and a human

pancreas cDNA library for two-hybrid screening were
purchased from Clontech.
Yeast two-hybrid assay
Yeast two-hybrid screening was performed with yeast strain
Y190 using the Matchmaker Two-Hybrid System 2 kit
according to manufacturer’s protocol (Clontech). Briefly,
the cDNA fragment coding the N-terminal half of LZK
[LZK(1–558)] was fused to the pAS2-1 vector and then used
as a bait construct to screen the human pancreas cDNA
library. A total of 2.54 · 10
6
clones were analyzed, and
positive clones were recovered and re-screened until a single
colony was isolated.
Cell culture and transfection
COS7 cells were cultured and transfected as described
previously [16]. HeLa cells were cultured in minimum
essential medium (MEM) supplemented with 10% heat-
inactivated fetal bovine serum and nonessential amino acids
(Gibco BRL). For transfection, cells were subcultured and
grown overnight, and then transfected transiently with
various expression constructs using LipofectAMINE
PLUS
TM
reagent (Gibco BRL) according to the manufac-
turer’s protocol. After 24 h, the cells were subjected to either
immunoprecipitation or Western blotting as described
previously [16].
Reporter assay
A reporter plasmid containing a synthetic NF-jB binding

site was constructed as below. A double stranded DNA
containing two NF-jB binding motifs was prepared by
annealing the following oligonucleotides, and then sub-
cloned into a luciferase reporter plasmid, Enhancer vector 2
(Promega) using HindIII and KpnI restriction sites. The
sequences of the oligonucleotides used were: 5¢-C
GGGGA
ATCTCCGGATCCGGGGAATCTCCA-3¢ and 5¢-AGC
TTGGAGATTCCCCGGATCCGGAGATTCCCCGGT
AC-3¢.TheNF-jB binding sites are underlined. HeLa cells
were transfected transiently with various expression plas-
mids, the reporter plasmid and pRL-TK (which contains
the Renilla reniformis luciferase gene under the control of
the HSV-thymidine kinase promoter) as an internal control.
After 30 h, the cells were washed with phosphate-buffered
saline, followed by a dual-luciferase assay according to the
manufacturer’s instructions (Promega). To measure luci-
ferase activity, the fluorescence was measured for 30 s using
a Luminometer (Lumat LB9501; Berthod Systems,
Aliquippa, PA, USA).
Preparation of GST-IjBa
GST-IjBa(1–54) was produced in E. coli using a pGEX
expression system (Amersham Pharmacia). GST-IjBa(1–
54) was purified with glutathione–sepharose beads. GST-
IjBa(1–54) bound to the beads was eluted with a buffer
comprising 20 m
M
glutathione, 50 m
M
Tris/HCl, pH 8.0,

2m
M
EDTA and 0.15
M
NaCl. The eluted protein was
dialyzed against a buffer comprising 20 m
M
Tris/HCl,
pH 7.5, 1 m
M
EGTA and 1 m
M
dithiothreitol and stored at
)20 °C until used.
IKK kinase assay
To measure the activity of IKK, an in vitro kinase assay was
carried out as described previously [16]. Briefly, HeLa cells
were transfected with pcDNA-IKKb, pEF-AOP-1 and
pcDNA-LZK or pcDNA-LZK K195A and then lysed after
24 h. To equalize the amount of IKKb protein in the
samples, aliquots of cell lysates were first subjected to West-
ern blotting, followed by estimation of the amount of IKKb
expressed in each sample by quantitative densitometry.
Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)77
The kinase reaction was carried out in kinase reaction buffer
containing 0.5 lCi of [c-
32
P] and 5 lgofGST-IjBa(1–54)
for 10 min at 30 °C. The phosphorylated GST-IjBa(1–54)
protein was visualized with a Fuji BAS2000 scanner

(Tokyo, Japan) after SDS/PAGE.
Results
Identification of AOP-1 as a molecule binding to LZK
To determine the function of LZK, we employed a yeast
two)hybrid system to search for proteins that bind to LZK.
As a bait construct, the N-terminal half of LZK including the
kinase catalytic domain (residues 1–558) was fused to the
pAS2-1 vector, and then the fused vector was transfected into
yeast strain Y 190. The transformant yeast was then
transformed with a human pancreas cDNA library because
LZK mRNA is expressed in the pancreas at the highest level
[15]. Positive clones were selected by means of a colony-lift
b-galactosidase filter assay. Sequence analysis of positive
clones revealed that one clone contains an open reading
frame encoding the C-terminal 35 amino acids of AOP-1 [23].
To confirm the binding of AOP-1 to LZK in mammalian
cells, COS7 cells were transfected transiently with
His-tagged LZK and Flag-tagged AOP-1, followed by
immunoprecipitation with anti-His Ig. As shown in Fig. 1A,
Flag-tagged AOP-1 was coimmunoprecipitaed with His-
LZK, indicating that AOP-1 binds to full-length LZK in
mammalian cells. Next we investigated the region of LZK
responsible for the binding with AOP-1. The bait protein
used for the yeast two-hybrid screening consisted of the 558
amino acids comprising the N-terminal region of LZK. We
focused on the kinase domain and the leucine zipper-like
motif as functional motifs in this region. A series of deletion
His-tagged LZK mutants (Fig. 1B) was examined with
regard to the ability to bind to AOP-1. As shown in Fig. 1C,
the full-length LZK (LZK FL) and LZKDZip, a mutant

that lacks the dual leucine zipper-like motif, were coimmu-
noprecipitated with AOP-1 to similar extents. LZKDKD
Zip, which lacks both the dual leucine zipper-like motif and
the kinase domain, was also coimmunoprecipitated with
AOP-1, but the amount of LZKDKD Zip coimmunopre-
cipitated with AOP-1 was lower than those of LZK FL and
LZKDZip. These results suggest that the N-terminal 167
amino acids in addition to the kinase domain are important
for the interaction with AOP-1. We also constructed an
expression vector of a LZK deletion mutant, which lacks the
N-terminal region of LZK. However, the mutant LZK
protein could not be detected in COS7 cells because of its
instability (data not shown). Therefore, we concluded that
the kinase domain and/or the N-terminal region of LZK are
responsible for the interaction with AOP-1.
Antioxidant activity of AOP-1 is not essential
for its association with LZK
The AOP-1 gene product was first identified as a molecule
that exhibited a high sequence similarity to the mouse
MER5 gene one, which belongs to a family of thioredoxin-
dependent antioxidant proteins [23]. AOP-1 has two
cysteine residues (C178 and C229) that are conserved in
thioredoxin-dependent peroxidases and are essential for the
antioxidant activity [27]. AOP-1 is believed to form a dimer
within cells. When AOP-1 reduces reactive oxygen species,
an intermolecular disulfide bond is formed between the two
conserved cysteine residues of AOP-1 dimers [28]. To
Fig. 1. AOP-1 associates with LZK in COS7 cells. (A) His-tagged LZK and/or Flag-tagged AOP-1 were coexpressed in COS7 cells. At 24 h post-
transfection, the cells were lysed with lysis buffer. LZK was immunoprecipitated from the cell lysate with anti-His Ig and protein G-sepharose beads.
The presence of Flag-AOP-1 in the immunoprecipitate was examined by Western blotting with anti-Flag Ig. Similarly, AOP-1 was immunopre-

cipitated from the cell lysate using anti-Flag Ig. The presence of His-LZK in the immunoprecipitate was detected by Western blotting with anti-His
Ig. The asterisk indicates the immunoglobulin light chain used for immunoprecipitation. The presence of Flag-AOP-1 and His-LZK in the cell
lysate were examined by Western blotting with anti-Flag and anti-His Ig, respectively. (B) The deletion mutants used in this study are represented
schematically. (C) Deletion mutants were coexpressed in COS7 cells with AOP-1 as indicated. After immunoprecipitation of AOP-1, the presence of
His-LZK or a deletion mutantation in the immunoprecipitate was examined by Western blotting with anti-His Ig. The presence of His-LZK or a
deletion mutantation and Flag-AOP-1 in each cell lysate was examined by Western blotting with anti-His and anti-Flag Ig.
78 M. Masaki et al. (Eur. J. Biochem. 270) Ó FEBS 2003
determine whether these conserved cysteine residues are
necessary for AOP-1 to bind to LZK, we constructed point
mutants in which one of the two conserved cysteine residues
was mutated to a serine residue (AOP-1 C178S and C229S,
respectively).AsshowninFig.2,bothAOP-1C178Sand
C229S were effectively coimmunoprecipitated with LZK as
well as wild-type AOP-1, indicating that these conserved
cysteines are not essential for the binding of AOP-1 to LZK.
AOP-1 has no effect on LZK-induced JNK activation
As LZK is known to activate the JNK-1 pathway, we next
examined whether AOP-1 modulates LZK-induced activa-
tion of the JNK pathway. COS7 cells were cotransfected
with HA-JNK and His-LZK, with or without Flag-AOP-1.
The level of JNK activation in each transfectant was
measured by Western blotting with anti-(phosphorylated
JNK) Ig. As shown in Fig. 3, phosphorylation of JNK was
observed in the presence of LZK, and coexpression of AOP-
1 did not have an apparent effect on the LZK-induced JNK
activation (top panel). Note that the quantity of JNK
expressed in each sample was almost identical (Fig. 3,
second panel from the top). The increase in the amount of
the AOP-1 expression plasmid relative to those of LZK and
JNK was similar (data not shown). These results indicated

that AOP-1 has essentially no effect on the activity of LZK
as a MAPKKK in the JNK pathway.
AOP-1 enhances LZK-induced NF-jB activation
Recently, it was reported that several MAPKKKs, such as
TAK1, MEKK1 and MLK3, activate signal transduction
pathways leading to NF-jB activation as well as the JNK
pathway [18–21]. Thus, we examined whether or not LZK
activates endogenous NF-jB-dependent transcription by
means of a luciferase reporter assay. HeLa cells were
cotransfected with a reporter construct, which expresses
Photinus pysralis luciferase under the control of NF-jB, and
either wild type or kinase negative mutant LZK, and then
the luciferase activity was measured as described under
Experimental procedures. As shown in Fig. 4 (lanes 1–3),
NF-jB dependent transcription was triggered reproducibly
by the expression of wild-type LZK (1.4-fold increase), in
contrast, the expression of inactive kinase LZK (LZK
K195A) failed to trigger NF-jB dependent transcription.
This indicates that the LZK-induced NF-jB activation is
dependent on the kinase activity of LZK. We also examined
the effect of AOP-1 expression on the LZK induced NF-jB
activation. As shown in Fig. 4 (lanes 4–6), the expression of
AOP-1hadaverylittleeffectontheNF-jB-dependent
transcription (1.2-fold). Interestingly, when coexpressed
with wild type LZK, AOP-1 significantly enhanced the
LZK-induced NF-jB-dependent transcription (2.4-fold).
The enhanced activation by AOP-1 was not detected on
Fig. 2. Antioxidant activity of AOP-1 is not essential for binding to
LZK. His-LZK was coexpressed in COS7 cells with wild type or point
mutant AOP-1. After immunoprecipitation of LZK with anti-His Ig,

the presence of AOP-1 in the immunoprecipitate was examined by
Western blotting with anti-Flag Ig (top panel). The amounts of LZK
(middle panel) and AOP-1 (bottom panel) in each cell lysate were
determined by Western blotting with anti-His and anti-Flag Ig,
respectively.
Fig. 3. Co-expression of AOP-1 has no effect on LZK-induced JNK
activation. His-LZK and HA-JNK were coexpressed, with or without
Flag-AOP-1. At 24 h post-transfection, the cells were lysed by the
addition of the SDS/PAGE sample buffer, and then the amount of
dually phosphorylated JNK was determined by Western blotting with
anti-(phosphorylated JNK) Ig (top panel). To determine the total
amount of JNK expressed in each transfection, the same samples were
analyzed by Western blotting with anti-HA Ig (second panel). The
amounts of LZK and AOP-1 in each lysate were determined by
Western blotting with anti-His and anti-Flag Ig, respectively (third and
bottom panels).
Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)79
coexpression with inactve kinase LZK. These results, taken
together, suggest that LZK activates NF-jB, and that AOP-
1 enhances this signal transduction pathway synergistically.
To determine whether this effect is specific for AOP-1, we
examined the effect of another thioredoxine-dependent
peroxidase, AOE372, which exhibits high sequence similar-
ity to AOP-1 [29]. AOE372 had no effect on the LZK-
induced NF-jB activation, although AOE372 was
coimmunoprecipitated with LZK when coexpressed in
COS7 cells (data not shown). Therefore, we concluded that
AOP-1 has a specific function as an enhancer of LZK-
induced NF-jB activation.
LZK activates the IjB kinase complex

It is well known that NF-jBiskeptinactiveinthe
cytoplasm through the formation of a complex with its
inhibitor, IjB. Upon activation, IjB is first phosphorylated
by a protein kinase complex called the IjB kinase (IKK)
complex and then degraded. The degradation of IjBresults
in the translocation of NF-jB to the nucleus and the
transcriptional activation of target genes [30,31]. As LZK
triggered the transcriptional activity of NF-jB, as described
above, we examined whether LZK could activate the IKK
complex or not. HeLa cells were transfected transiently with
His-tagged LZK, Myc-tagged AOP-1 and Flag-tagged
IKKb, one component of the IKK complex. At 24 h
post-transfection, the cells were lysed and IKKb activity was
determined as described under Experimental procedures. As
expected, IKKb activity was increased in the cells transfect-
ed with wild-type LZK (Fig. 5). In contrast, the LZK
inactive kinase mutant, K195A, failed to activate the IKK
complex. These results indicated that LZK activates the
IKK complex and that this activation is dependent on the
kinase activity of LZK. We further examined the effect of
AOP-1 on the LZK-induced IKK activation. In cells
cotransfected with AOP-1 and LZK, IKK activity was
almost the same as that in cells transfected with LZK alone
(Fig. 5), indicating that AOP-1 has no significant effect on
the LZK-induced IKK activation under the experimental
conditions used.
LZK associates with the IjB kinase complex
As LZK triggered the transcription activity of NF-jB
through activation of the IKK complex, we then examined
whether or not LZK physically associated with IKKb.

COS7 cells were transfected with His-tagged LZK, Myc-
tagged AOP-1 and Flag-tagged IKKb, followed by immu-
noprecipitation with anti-Flag Ig to pull down the IKKb.
Coimmunoprecipitated proteins were detected by Western
blotting with antibodies against epitope tags (Fig. 6A).
LZK was coimmunoprecipitated with IKKb regardless of
Fig. 5. LZK activates NF-jB through the IjB kinase complex. HeLa
cells were cotransfected with pcDNA-IKKb, pEF-AOP-1 and
pcDNA-LZK or pcDNA-LZK K195A, as indicated. At 24 h post-
transfection, the cells were lysed and the amount of IKKb was deter-
mined as described under Experimental procedures. An equal amount
of IKKb was subjected to in vitro kinase assaying in the presence of
[c-
32
P]ATP and GST-IjBa(1–54). A representive autoragiogram is
shown (top panel). The amount of GST- IjBa(1–54) included in each
reaction mixture as a substrate is indicated (second panel from the
top). The amounts of LZK (third panel from the top) and AOP-1
(bottom panel) expressed in the cells were determined by Western
blotting with anti-His and anti-Myc Ig, respectively.
0
0.5
1
1.5
2
2.5
3
3.5
1
1.4 2.4 1.4 3.30.9 1

.2
A
OP-1
L
ZK
L
ZKK195A
+
++
+
+
+
TPA
+
Fig. 4. AOP-1 enhances LZK-induced NF-jB activation. HeLa cells
were cotransfected with 2 · NF-jB-Luc reporter plasmid (0.8 lg),
pRL TK (0.2 lg), pEF Flag AOP-1 (0.5 lg) and pcDNA His-LZK or
pcDNAHis-LZK K195A (0.5 lg),asindicated.After30h,luciferase
activity was assayed as described under Experimental procedures. The
luciferase activity of each transfection is expressed as fold activation.
Bars show the means + SD of three independent experiments,
expressed in arbitrary units adjusted to the mean of a negative control
(lane 1) as one unit. As a positive control, cells were treated with
25 ngÆmL
)1
12-O-tetradecanoylphorbol 13-acetate for 8 h. Note that
coexpression of AOP-1 enhanced significantly LZK-induced NF-jB
activation under the experimental condition used.
80 M. Masaki et al. (Eur. J. Biochem. 270) Ó FEBS 2003
the presence or absence of AOP-1 (lanes 1 and 2). AOP-1

was coimmunoprecipitated with IKKb only in the presence
of LZK (lane 2, second panel from the top). Thus, LZK is
associated directly with the IKK complex but AOP-1 can be
included in the IKK complex in the presence of LZK. The
region of LZK necessary for the association with IKKb was
examined by means of an immunoprecipitation assay with a
series of His-tagged LZK mutants (Fig. 1B). As shown in
Fig. 6B, LZKDZip, was coimmunoprecipitated with IKKb,
but LZKDKD Zip was not coimmunoprecipitated with it,
suggesting that LZK associates with IKKb through its
kinase domain.
Discussion
In this study, we identified AOP-1 as a modulator of LZK
activity by means of a yeast two-hybrid system. We
demonstrated that LZK can trigger NF-jB dependent
transcription by increasing IKK activity. AOP-1 enhanced
LZK-induced NF-jB activation but did not affect LZK-
induced JNK activation. This is the first evidence that a
MAPKKK in the JNK signaling pathway, LZK, and an
antioxidant protein, AOP-1, synergistically enhance the NF-
jB signaling pathway. Thus, AOP-1 may have the ability to
regulate the flow of intracellular signaling of LZK to the
NF-jB signaling pathway rather than to the JNK pathway.
AOP-1 was first identified as a molecule that exhibits
sequence similarity to mouse MER5, which is localized in
mitochondria. AOP-1 has also been shown to be localize
in mitochondria [27]. While LZK is known to be localized in
the cytoplasm. Recently, however, the association of AOP-1
with a cytosolic protein that inhibits AOP-1 activity was
reported[27].Thus,LZKmightalsointeractwithAOP-1

under physiological conditions. On the other hand, it is well
known that mitochondrial proteins are present in the
cytoplasm under apoptotic conditions. Therefore, it is
possible that LZK associates with AOP-1 under some
pathogenic conditions, such as apoptosis, and activates the
NF-jB pathway to prevent apoptosis.
It has been reported that several MAPKKKs, such as
TAK1, MEKK1 and MLK3, activate the NF-jB pathway
as well as the JNK pathway [18–21]. MLK3 has been shown
to associate with the IKK complex, and to phosphorylate
directly, IKKa and IKKb. In contrast, TAK1 and MEKK1
are known to trigger NF-jB dependent transcription via
phosphorylation and activation of the IKK complex
indirectly through other protein kinases, such as NF-jB
inducing kinase (NIK) [20]. As LZK also interacted with
IKKb and the interaction resulted in increases in IKKb
activity and NF-jB transcription, we examined the possi-
bility that LZK phosphorylates directly, IKKb.However,
we could not detect kinase activity of LZK towards IKKb
(data not shown), suggesting that LZK activates the IKK
complex through other protein kinase(s), such as NIK.
AOP-1 triggered NF-jB dependent transcription and
enhanced LZK-induced NF-jB activation (Fig. 4), while
AOP-1 had no apparent effect on IKK activation, as judged
by an in vitro kinase assay (Fig. 5). At present we have no
experimental data that explain this apparent discrepancy.
However, AOP-1 is an antioxidant protein and functions as
a thioredoxin-dependent peroxidase, which scavenges
reactive oxygen species such as H
2

O
2
in the presence of
thioredoxine. It has been reported that H
2
O
2
reduces
cytokine-induced NF-jB activation through oxidative
inactivation of IKK [40]. AOP-1 recruited to the IKK
Fig. 6. LZK is associated with the IjB kinase complex. (A) His-tagged
LZK, Myc-tagged AOP-1 and Flag-tagged IKKb were coexpressed in
COS7 cells. After 24 h post-transfection, the cells were lysed with lysis
buffer, and IKKb was immunoprecipitated from the cell lysate with
anti-Flag Ig and protein G Sepharose beads. The presence of His-LZK
and Myc-AOP-1 in the IKKb immunoprecipitate was examined by
Western blotting with anti-His and anti-Myc Ig, respectively. The
asterisk indicates the immunoglobulin light chain used for immuno-
precipitation. The amounts of both Myc-AOP-1 and His-LZK
expressed in the cells were also determined by Western blotting. (B)
Various deletion mutations were coexpressed in COS7 cells with
IKKb, as indicated. After immunoprecipitation of IKKb, the presence
of His-LZK or a deletion mutation in the immunoprecipitate was
examined by Western blotting with anti-His Ig. The presence of His-
LZK or a deletion mutation and Flag-IKKb in each cell lysate were
examined by Western blotting with anti-His or anti-Flag Ig.
Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)81
complex through LZK might protect the IKK complex
from oxidative inactivation by the removal of H
2

O
2
in cells
resulting in the triggering of NF-jB dependent transcription
(Fig. 4). Thus, AOP-1 may prevent the inactivation of IKK
by H
2
O
2
, but not activate IKK itself. From this point of
view, the in vitro kinase assay conditions used might have
cancelled out the effect of AOP-1 on IKK activity because
the assay was performed under reducing conditions (i.e. in
the presence of dithiothreitol). However, another thio-
redoxine-dependent peroxidase, AOE372, exhibiting high
sequence similarity to AOP-1 [29], had no effect on LZK-
induced NF-jB activation, even though AOE372 was
coimmunoprecipitated with LZK. These results suggest
that we can not exclude the possibility that AOP-1 may have
unidentified new functions in addition to that of a thiore-
doxin-dependent peroxidase.
In some types of cells such as neurons, it is known that
activation of the JNK pathway leads to apoptotic cell death
[34–36]. In fact, MLK family kinases including LZK are
expressed in neuronal cells [15, 37–39], and MLK2 and
MLK3 play important roles in activation of the JNK
pathway leading to neuronal apoptosis in response to
kainate [36]. In contrast, the activation of NF-jBcan
protect cells from death by triggering the gene expression of
Bcl2 family proteins and inhibitors of the JNK/SAPK

pathway [32,33]. As described above, LZK triggered NF-
jB-dependent transcription (as well as the JNK pathway)
and AOP-1 enhanced the LZK-induced NF-jB activation.
These results suggest that the association of LZK with
AOP-1 might be important for preventing LZK-induced
apoptotic cell death and for ensuring activation of the JNK
pathway by LZK without cell death.
We demonstrated previously that LZK binds to a
scaffold protein, JIP-1, which is also associated with
downstream effectors, MKK7 and JNK, in the JNK
pathway. Owing to the physical proximity of LZK and its
effectors (MKK7 and JNK) on JIP-1, LZK is able to
activate JNK with higher efficiency [22]. Thus, JIP-1
positively modulates LZK activity as a MAPKKK in the
JNK pathway. On the other hand, AOP-1 has no effect on
the JNK pathway but enhances LZK-induced NF-jB,
suggesting that the signal transduction pathway from LZK
could be dependent on the binding partner, such as JIP-1
and AOP-1.
Acknowledgements
We wish to thank Drs E. Nishida and K. Shimotohno for the generous
gifts of the plasmids used in this study. This work was supported in part
by a Grant-in-Aid for Scientific Research from the Japan Society for
the Promotion of Sciences. A. I. was the recipient of a Research
Fellowship from the Japan Society for the Promotion of Science for
Young Scientists.
References
1. Kyriakis, J.M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E.A.,
Ahmad, R.F., Avruch, J. & Woodgett, J.R. (1994) The stress-
activated protein kinase subfamily of c-Jun kinases. Nature 369,

156–160.
2. Derijard,B.,Hibi,M.,Wu,I H.,Barrett,T.,Su,B.,Deng,T.,
Karin, M. & Davis, R.J. (1994) JNK1: a protein kinase stimulated
by UV light and Ha-Ras that binds and phosphorylates the c-Jun
activation domain. Cell 76, 1025–1037.
3. Han, J., Lee, J.D., Bibbs, L. & Ulevitch, R.J. (1994) A MAP
kinase targeted by endotoxin and hyperosmolarity in mammalian
cells. Science 265, 808–811.
4. Lee, J.C., Laydon, J.T., McDonnell, P.C., Gallagher, T.F., Kumar,
S., Green, D., McNulty, D., Blumenthal, M.J., Heys, J.R., Land-
vatter, S.W. et al. (1994) A protein kinase involved in the regulation
of inflammatory cytokine biosynthesis. Nature 372, 739–746.
5. Ip, Y.T. & Davis, R.J. (1998) Signal transduction by the c-Jun
N-terminal kinase (JNK) – from inflammation to development.
Curr. Opin. Cell Biol. 10, 205–219.
6. Minden, A., Lin, A., McMahon, M., Lange-Carter, C.D., Derij-
ard, B., Davis, R.J., Johnson, G.L. & Karin, M. (1994) Differ-
ential activation of ERK and JNK mitogen-activated protein
kinases by Raf-1 and MEKK. Science 266, 1719–1723.
7. Yamaguchi, K., Shirakabe, K., Shibuya, H., Irie, K., Oishi, I.,
Ueno, N., Taniguchi, T., Nishida, E. & Matsumoto, K. (1995)
Identification of a member of the MAPKKK family as a potential
mediator of TGF-beta signal transduction. Science 270, 2008–
2011.
8. Ichijo, H., Nishida, E., Irie, K., ten Dijke, P., Saitoh, M.,
Moriguchi, T., Takagi, M., Matsumoto, K., Miyazono, K. &
Gotoh, Y. (1997) Induction of apoptosis by ASK1, a mammalian
MAPKKK that activates SAPK/JNK and p38 signaling path-
ways. Science 275, 90–94.
9. Hirai, S., Izawa, M., Osada, S., Spyrou, G. & Ohno, S. (1996)

Activation of the JNK pathway by distantly related protein
kinases, MEKK and MUK. Oncogene 12, 641–650.
10. Fan, G., Merritt, S.E., Kortenjann, M., Shaw, P.E. & Holzman,
L.B. (1996) Dual leucine zipper-bearing kinase (DLK) activates
p46SAPK and p38mapk but not ERK2. J. Biol. Chem. 271,
24788–24793.
11. Hirai, S., Katoh, M., Terada, M., Kyriakis, J.M., Zon, L.I., Rana,
A., Avruch, J. & Ohno, S. (1997) MST/MLK2, a member of the
mixed lineage kinase family, directly phosphorylates and activates
SEK1, an activator of c-Jun N-terminal kinase/stress-activated
protein kinase. J. Biol. Chem. 272, 15167–15173.
12. Rana, A., Gallo, K., Godowski, P., Hirai, S., Ohno, S., Zon, L.,
Kyriakis, J.M. & Avruch, J. (1996) The mixed lineage kinase
SPRK phosphorylates and activates the stress-activated protein
kinase activator, SEK-1. J. Biol. Chem. 271, 19025–19028.
13. Tibbles, L.A., Ing, Y.L., Kiefer, F., Chan, J., Iscove, N.,
Woodgett, J.R. & Lassam, N.J. (1996) MLK-3 activates the
SAPK/JNK and p38/RK pathways via SEK1 and MKK3/6.
EMBO J. 15, 7026–7035.
14. Teramoto, H., Coso, O.A., Miyata, H., Igishi, T., Miki, T. &
Gutkind, J.S. (1996) Signaling from the small GTP-binding pro-
teins Rac1 and Cdc42 to the c-Jun N-terminal kinase/stress-acti-
vated protein kinase pathway. A role for mixed lineage kinase
3/protein-tyrosine kinase 1, a novel member of the mixed lineage
kinase family. J. Biol. Chem. 271, 27225–27228.
15. Sakuma, H., Ikeda, A., Oka, S., Kozutsumi, Y., Zanetta, J.P. &
Kawasaki, T. (1997) Molecular cloning and functional expression
of a cDNA encoding a new member of mixed lineage protein
kinase from human brain. J. Biol. Chem. 272, 28622–28629.
16. Ikeda, A., Masaki, M., Kozutsumi, Y., Oka, S. & Kawasaki, T.

(2001) Identification and characterization of functional domains in
mixed lineage kinase LZK. FEBS Lett. 488, 190–195.
17. Fukuyama, K., Yoshida, M., Yamashita, A., Deyama, T.,
Baba,M.,Suzuki,A.,Mohri,H.,Nakajima,H.,Hirai,S.&
Ohno, S. (2000) MAPK upstream kinase (MUK)-binding
inhibitor protein, a negative regulator of MUK/dual leucine zip-
per-bearing kinase/leucine zipper protein kinase. J. Biol. Chem.
275, 21247–21254.
82 M. Masaki et al. (Eur. J. Biochem. 270) Ó FEBS 2003
18. Nakano, H., Shindo, M., Sakon, S., Nishinaka, S., Mihara, M.,
Yagita, H. & Okumura, K. (1998) Differential regulation of IjB
kinase a and b by two upstream kinases, NFjB-inducing kinase
and mitogen-activated protein kinase/ERK kinase kinase-1. Proc.
NatlAcad.Sci.USA95, 3537–3542.
19. Lee, F.S., Peters, R.T., Dang, L.C. & Maniatis, T. (1998) MEKK1
activates both IjBkinasea and b. Proc. Natl Acad. Sci. USA 95,
9319–9324.
20. Ninomiya-Tsuji, J., Kishimoto, K., Hiyama, A., Inoue, J., Cao, Z.
& Matsumoto, K. (1999) The kinase TAK1 can activate the NIK-
IjB as well as the MAP kinase cascade in the IL-1 signaling
pathway. Nature 398, 252–256.
21. Hehner, S.P., Hofmann, T.G., Ushmorov, A., Dienz, O., Leung,
I.W., Lassam, N., Scheidereit, C., Droge, W. & Schmitz, M.L.
(2000) Mixed-lineage kinase 3 delivers CD3/CD28-derived signals
into the IjB kinase complex. Mol. Cell Biol. 20, 2556–2568.
22. Ikeda, A., Hasegawa, K., Masaki, M., Moriguchi, T., Nishida, E.,
Kozutsumi,Y.,Oka,S.&Kawasaki,T.(2001)Mixedlineage
kinase LZK forms a functional signaling complex with JIP-1, a
scaffold protein of the c-Jun NH
2

-terminal kinase pathway.
J. Biochem. 130, 773–781.
23. Tsuji, K., Copeland, N.G., Jenkins, N.A. & Obinata, M. (1995)
Mammalian antioxidant protein complements alkylhydroper-
oxide reductase (ahpC) mutation in Escherichia coli. Biochem. J.
307, 377–381.
24. Moriguchi, T., Toyoshima, F., Masuyama, N., Hanafusa, H.,
Gotoh, Y. & Nishida, E. (1997) A novel SAPK/JNK kinase,
MKK7, stimulated by TNFalpha and cellular stresses. EMBO J.
16, 7045–7053.
25. Toyoshima, F., Moriguchi, T. & Nishida, E. (1997) Fas induces
cytoplasmic apoptotic responses and activation of the MKK7-
JNK/SAPK and MKK6-p38 pathways independent of CPP32-
like proteases. J. Cell Biol. 139, 1005–1015.
26. Watashi, K., Hijikata, M., Marusawa, H., Doi, T. & Shimotono,
K. (2001) Cytoplasmic localization is important for transcription
factor nuclear factor-jB activation by hepatitis C virus core pro-
tein through its amino terminal region. Virology 286, 391–402.
27. Shih, S.F., Wu, Y.H., Hung, C.H., Yang, H.Y. & Lin, J.Y. (2001)
Abrin triggers cell death by inactivating a thiol-specific antioxidant
protein. J. Biol. Chem. 276, 21870–21877.
28. Kang, S.W., Baines, I.C. & Rhee, S.O. (1998) Characterization of
a mammalian peroxiredoxine that contains one conserved
cysteine. J. Biol. Chem. 273, 6303–6311.
29. Jin, D.Y., Chae, H.Z., Rhee, S.G. & Jeang, K.T. (1997) Reg-
ulatory role for a novel human thioredoxin peroxidase in NF-jB
activation. J. Biol. Chem. 272, 30952–30961.
30. Didonato,J.A.,Hayakawa,M.,Rothwarf,D.M.,Zandai,E.&
Karin, M. (1997) A cytokine-responsive IkappaB kinase
that activates the transcription factor NF-kappaB. Nature 388,

548–554.
31. Zandai, E., Rothwarf, D.M., Delhase, M., Hayakawa, M. &
Karin, M. (1997) The IkappaB kinase complex contains two
kinase subunits, IKKalpha and IKKb, necessary for IkappaB
phosphorylation and NF-kappaB activation. Cell 91, 243–252.
32. Smaele, E.D., Zazzeroni, F., Papa, S., Nguyen, D.U., Rongguan,
J., Jones, J., Cong, R. & Franzoso, G. (2001) Induction of
gadd45b by NF-jB downregulates pro-apoptotic JNK signaling.
Nature 414, 308–313.
33. Tang,G.,Minemoto,Y.,Dibling,B.,Purcell,N.H.,Karin,M.&
Lin, M. (2001) Inhibition of JNK activation through NF-jB
target genes. Nature 414, 313–317.
34. Yang, D.D., Kuan, C.Y., Whitmarsh, A.J., Rincon, M., Zheng,
T.S., Davis, R.J., Pakic, P. & Falvell, R.A. (1997) Absence of
excitotoxicity-induced apoptosis in the hippocampus of mice
lacking the Jnk3 gene. Nature 389, 865–870.
35. Tournier, C., Hess, P., Yang, D.D., Xu, J., Turner, T.K.,
Nimnual, A., Bar-Sagi, D., Jones, S.N., Flavell, R.A. & Davis,
R.J. (2000) Requirement of JNK for stress-induced activation
of the cytochrome c-mediated death pathway. Science 288,
870–874.
36. Savinainen, A., Garcia, E.P., Dorow, D., Marshall, J. & Liu, Y.F.
(2001) Kainate receptor activation induces mixed lineage kinase-
mediated cellular signaling cascades via post-synaptic density
protein 95. J. Biol. Chem. 276, 11382–11386.
37. Holzman, L.B., Merritt, S.E. & Fan, G. (1994) Identification,
molecular cloning, and characterization of dual leucine zipper
bearing kinase. A novel serine/threonine protein kinase that def-
ienes a second subfamily of mixed lineage kinases. J. Biol. Chem.
269, 30808–30817.

38. Ing, Y.L., Leung, I.W.L., Heng, H.H.Q., Tsuji, L.C. & Lassam,
N.J. (1994) MLK-3: identification of a widely-expressed protein
kinase bearing an SH3 domain and a leucine zipper-basic region
domain. Oncogene 9, 1745–1750.
39. Mata, M., Merritt, S.E. & Fan, G., Yu, G.G. & Holzman, L.B.
(1996) Characterization of dual leucine zipper-bearing kinase, a
mixed lineage kinase present in synaptic terminals whose phos-
phorylation state is regulated by membrane depolarization via
calcineurin. J. Biol. Chem. 271, 16888–16896.
40.Korn,S.H.,Wouters,E.F.M.,Vos,N.&Jassen-Heininger,
Y.M.W. (2001) Cytokine-induced activation of nuclear factor-jB
is inhibited by hydrogen peroxide through oxidative inactivation
of IjBkinase.J. Biol. Chem. 276, 35693–35700.
Ó FEBS 2003 Synergistic activation of NF-jB by LZK and AOP-1 (Eur. J. Biochem. 270)83