Báo cáo khoa học: Two CCAAT/enhancer binding protein sites in the cytochrome P4503A1 locus Potencial role in the glucocorticoid response ppt

Two CCAAT/enhancer binding protein sites in the cytochrome
P4503A1 locus
Potencial role in the glucocorticoid response
Elsa Rodrigues
1
, Marie-Jose
´
Vilarem
2
, Vera Ribeiro
1,
*, Patrick Maurel
2
and Maria C. Lechner
1
1
Molecular Biology Unit, Faculty of Pharmacy, University of Lisbon, Portugal;
2
Unite
´
128 INSERM, Montpellier, France
Induction of CYP3A genes by the ligand-activated preg-
nane-X-receptor (PXR) involves the interaction of other as
yet unidentified liver transcription factors. Here we show
that the CYP3A1 promoter contains two active sites con-
trolled by the CCAAT/enhancer-binding protein a (C/
EBPa), previously shown to regulate a number of liver stress
response genes. We have identified two functional C/EBP
binding sites at the CYP3A1 promoter that confer luciferase
activity to C/EBPa cotransfected CHO cells. When inserted
upstream of a thymidine kinase promoter, oligonucleotides

corresponding to these elements ()350/)311 and )628/
)608), increase reporter gene expression when cotransfected
with a C/EBPa expression vector. Point mutations in the
most conserved nucleotides in either element prevent binding
of C/EBPa and abolish transactivation of the CYP3A1
promoter. Moreover, we demonstrate that C/EBPa accu-
mulates in the rat liver nuclei in response to dexamethasone,
and that under these conditions C/EBPa binds to the
CYP3A1 promoter elements. Our results suggest a correla-
tion between transcription of C/EBPa, nuclear protein
function and induction of CYP3A1 by dexamethasone in the
liver. They also support the notion that C/EBPa participates
in the up-regulation of the CYP3A1 gene in response to
synthetic glucocorticoids.
Keywords: cytochrome P450; CYP3A1 locus; C/EBP; regu-
latory elements; glucocorticoid induction.
Mammalian hepatic phenotypes are controlled through the
concerted action of a number of liver-enriched transcription
factors that act in cooperation with a number of ubiquitous
and ligand-activated factors to direct the selective expression
of liver-specific genes. The activity of each target gene is
modulated by dynamic arrays of counterpart transcription
factors that act upon liver differentiation and that are
stimulated by endogenous as well as by exogenous ligands [1].
Cytochrome P450 genes, members of the CYP1–4 fami-
lies, are abundantly expressed in the liver and are subjected
to complex regulatory networks that depend markedly on
the ontological development, and on the hormonal and
nutritional status of the animals [2]. Moreover, P450 mono-
oxygenases, as major body interfaces, are adaptive enzymes

highly responsive to induction and repression by environ-
mental and xenobiotic agents in general.
Recently, important advances have been made in under-
standing the mechanism of action of prototype inducers that
control the expression of hepatic P450 enzymes, namely
those mediated by the nuclear receptors AhR, CAR, PPAR
and PXR (reviewed, [3]). However, the role of these ligand-
activated receptors can be enhanced, reduced or inhibited by
the availability of other transcription factors that participate
in the organization of the transcription initiation complexes
in the native DNA context of each CYP locus. Such func-
tional interactions have not been fully defined, but their elu-
cidation is essential to understand the molecular basis of the
marked physiological variations often observed in the in vivo
response of each CYP gene to common inducing agents.
CYP3A1 has been widely investigated as a model of a
xenobiotic up-regulated liver expressed gene. Transcription
of CYP3A1 is virtually undetected in the adult rat liver, but
markedly induced by structurally diverse agents, including
the synthetic glucocorticoid agonist dexamethasone [4] and
the antagonist pregnenolone 16a-carbonitrile [5]. Such
paradoxical behaviour of the rat CYP3A1, and of other
orthologous genes, was shown to involve the pregnane X
receptor (PXR) [6–8], a member of the steroid hormone
receptor family. The mechanism of the glucocorticoid-
mediated activation of CYP3A1 relies on a dexamethasone
responsive unit in the promoter region of this gene [9,10].
This unit comprises elements that are targeted by the
activated PXR, as well as by COUP-TFs and HNF4 [11,12].
However, in vitro experiments have shown that mouse [6],

Correspondence to M. C. Lechner, Molecular Biology Unit,
Faculty of Pharmacy, University of Lisbon,
Av. Prof Gama Pinto, 1649–003 Lisbon, Portugal.
Fax: + 351 21 7946491, Tel.: + 351 21 7946490,
E-mail: clechner@ff.ul.pt
Abbreviations: C/EBP, CCAAT/enhancer binding protein; C/EBP
cons, C/EBP consensus oligonucleotide; CYP, cytochrome P450;
PXR, pregnane-X-receptor; AhR, aryl hydrocarbon receptor; CAR,
constitutive androstane receptor; PPAR, peroxisome proliferator-
activated receptor; RXR, retinoid-X-receptor; COUP-TF, chicken
ovalbumin upstream promoter transcription factor; HNF4, hepato-
cyte nuclear factor 4; TK, thymidine kinase; EMSA, electrophoretic
mobility-shift assay.
*Present address: Biochemistry Laboratory, Chemistry Departmental
Area, Faculty of Sciences and Technology, University of Algarve,
Campus de Gambelas 8000-117 Faro, Portugal.
(Received 30 September 2002, revised 14 November 2002,
accepted 5 December 2002)
Eur. J. Biochem. 270, 556–564 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03413.x
rat [13] and human [8,14] PXR receptors are moderately
activated by dexamethasone. This result is in contrast with
the strong in vivo transcriptional induction by this gluco-
corticoid [5,15–17], and suggests that PXR does not fully
explain the pattern of CYP3A1 induction. The importance
of other transcription factors for the positive regulation by
dexamethasone is also suggested by the observation that full
CYP3A1 induction can not be achieved in CV1 cells, that
lack liver-enriched transcription factors presumably needed
to elicit the response [18].
Other factors structurally unrelated to PXR have been

demonstrated to activate transcription of liver-expressed
genes, namely as potentiators of glucocorticoid responses.
CCAAT/enhancer-binding proteins (C/EBP) were shown to
play a role in adipocyte differentiation, as well as in the liver
acute-phase response (review, [19]). These factors create
multiple possibilities of combinatorial gene regulation in the
liver, by strategies that involve heterodimerization with
other b-zip proteins, and cross talk interactions with other
factors, such as the glucocorticoid receptor [20]. P450 genes,
namely Cyp2D5 [21,22], CYP2B [23–25], CYP2C12 [26] and
human CYP3A4 [27], have been shown to be the targets of
C/EBP factors in liver cells.
In the present work we investigated the presence of cis-
acting elements in the CYP3A1 promoter. Dynamic trans-
fection–transactivation assays were performed to evaluate
the potential activity of recombinant C/EBPa on the previ-
ously cloned CYP3A1 promoter region [28]. Two C/EBP
binding sites were identified by proteinÆDNA gel mobility-
shift assays. To assess the biological significance of these
regulatory elements in the response to glucocorticoids, the
concurrence of the CYP3A1 and the C/EBP responsiveness
was investigated in the rat liver upon synthetic glucocorticoid
administration. The hypothesis of a cause–effect relationship
is suggested by the time-course analysis of C/EBPa and
CYP3A1 mRNA and protein accumulation in the liver.
Our in vitro and the in vivo results indicate that C/EBPa is
an activator of the CYP3A1 gene promoter and suggest a role
for this liver enriched transcription factor in the transcrip-
tional activation of CYP3A1 by synthetic glucocorticoids.
Materials and methods

Animals and treatments
Male adult Wistar rats, bred at the Gulbenkian Institute
animal house, Ociras, Portugal, were used in this investiga-
tion. Rats were maintained with standard chow and water
ad libitum, until 24 h before hormone treatment. Dexameth-
asone 21-phosphate (Sigma) was given intragastrically, in
aqueous solution, in a dose of 40 mg per kg body mass, and
the animals were sacrificed at different time points after drug
administration. Groups of three rats were used for each
sample. The livers were excised immediately after decapi-
tation and pooled for cell fractionation or RNA extrac-
tion. All procedures were carried out in accordance with
European regulations concerning animal experimentation.
Plasmids
Several different fragments derived from the 5¢ flanking
region of the CYP3A1 gene (GenBank accession no.
X62086) [28], were previously subcloned upstream of the
thymidine kinase gene [29] in the luciferase expression vector
pT81Luc [30], and analysed in transient transfection
experiments. Constructs bearing multiple element copies
were made using oligonucleotides encompassing the two
distinct CYP3A1 5¢ sites 3A1-300 ()350/)331, 5¢-
GTCCTTCTGTAATGGTGTG-3¢), or 3A1-600 ()629/
)608, 5¢-TGCAGGATTGCAGAAGTCTATT-3¢).These
were ligated with the SmaI-digested pT81Luc vector and
analysed in transient transfection experiments. All con-
structs were verified by DNA sequencing. The pMSV/EBPa
and pMSV/EBPb expression vectors were kindly provided
by S. L. McKnight (University of Texas South-Western
Medical School, TX, USA).

Cell culture
CHO cell line (hamster ovary epithelial) was maintained in
Ham’s F12 medium and the COS-7 cell cultures were
maintained in high glucose Dulbecco’s modified Eagle’s
medium (DMEM) supplemented with 10% (w/v) heat
inactivated fetal bovine serum and maintained at 37 °Cin
humidified 5% (v/v) CO
2
.
Transactivation assays
To minimize variations in transfection efficiency, replicates
were transfected in single batch suspension with FuGENE
(Roche Molecular Biochemicals), according to the manu-
facturer’s instructions. Plates containing 150 000 cells were
cotransfected with 0.5 lg of CYP3A1T81Luc plasmid and
different amounts of each expression vector. Cells were
inoculated in 24-well plates and maintained for 48 h. These
cells were harvested and lysed in reporter lysis buffer
(Promega, Madison, WI, USA). Cell extracts were assayed
for luciferase activity and protein content (BCA reagent,
Pierce, Rockfort, IL, USA). The cell extracts were normal-
ized for the total amount of protein prior to performing the
luciferase assay, as C/EBP expression vector was shown to
severely repress the expression of b-galactosidase in the
transfected CHO cell line.
Site-directed mutagenesis
The plasmid 0.8T81Luc served as the template for site-
directed mutagenesis using the QuickChange Site Directed
Mutagenesis Kit (Stratagene, CA, USA). All reactions were
performed according to the protocol provided by the

manufacturer. The oligonucleotides used for site-directed
mutagenesis of the C/EBP binding sites were as follows
(mutated bases underlined): site 3A1-300: 5¢-GGAGA
AAGTCC
GTCTATGGTGGTGTGCAGATGACACAG
TTTTGGC-3¢; site 3A1-600: 5¢-GCCTCTGCTCTGTA
AGTGCAGGA
CCGTAGAGGTCTATTACTTATG-3¢.
mRNA analysis
Total liver RNA was extracted by a modification of the LiCl/
urea method [31], and samples (20 lg) eletrophoresed on
formaldehyde-agarose gels for Northern blot analysis. The
subsequently generated Northern blot nylon membranes
were incubated with the specific oligonucleotide probes
Ó FEBS 2003 Two C/EBP sites in the CYP3A1 locus (Eur. J. Biochem. 270) 557
CYP3A1 (5¢-TGTGCGGGTCCCAAATCCGT-3¢) and
C/EBPa (5¢-GCACGAGACGTCTATAGACA-3¢) end-
labelled with [c-
32
P] dATP using T4 polynucleotide kinase.
Nuclear extracts
Isolation of liver nuclei both from control and dexameth-
asone-treated rats was carried out [32] and nuclear extracts
were prepared as described previously [33].
Recombinant C/EBPa used in the gel mobility-shift assays
were obtained by transfecting 3.0 · 10
6
COS-7 cells with
30 lgofpMSV/EBPa. Cells were seeded in 100-mm plates
and maintained for 48 h for nuclear extract preparation [33].

Western blot analysis
Five micrograms of liver nuclear protein were electrophore-
sed on 10% SDS/polyacrylamide gels and electroblotted onto
Imobilon P (Millipore, Bedford, MA, USA). After visua-
lization of the transferred proteins by amido black staining,
the membranes were incubated with an anti-C/EBPa Ig
(14AA, Santa Cruz Biotechnology). Results were quantified
using the
EAGLE
-
EYE
software package (Stratagene).
Electrophoretic mobility-shift assay (EMSA)
Double-stranded DNA probes and competitors were gen-
erated by annealing from the following complementary
single-stranded oligonucleotides: C/EBP consensus oligo-
nucleotide (C/EBPcons), 5¢-TGCAGATTCCGCAATCTG
CA-3¢ [34]; 3A1–300, 5¢-AGTCCTTCTGTAATGGTG
TG-3¢; 3A1–600, 5¢-TGCAGGATTGCAGAAGTCTA
TT-3¢; 3A1-700, 5¢-AATTTTGGTGGATAGATAT
AG-3¢; m3A1-300, 5¢-AGTCC
GTCTATGGTGGTGTG-3¢;
m3 A1-600, 5¢-TGCAGGA
CCGTAGAGGTCTATT-3¢
(mutated bases are underlined). The oligonucleotides 3A1-
300 (position )350 to )331), 3A1-600 (position )629 to
)608) and 3A1-700 (position )766 to )746) encompass
distinct CYP3A1 promoter regions. DNA (6 pmol) was end-
labelled with [c-
32

P] dATP using T4 polynucleotide kinase,
and unincorporated nucleotides were removed by Sephadex
G50 filtration. The binding reactions were performed in a
total volume of 20 lL and contained 2–5 lg of nuclear
extract, 10 m
M
Hepes buffer, pH 8.0, 0.1 m
M
EDTA, 2 m
M
dithiothreitol, 17.5% (v/v) glycerol, 40 m
M
spermidine,
40 m
M
MgCl
2
,0.5lgofdIdC,1lg salmon sperm DNA
and 0.5–2 ng of oligonucleotide probe. In competition assays
excess unlabeled oligonucleotide was preincubated (30 min)
at 4 °C, prior to incubation with each probe for additional
20 min. Supershift reactions were performed with 1 lLof
anti-C/EBP (14AA, Santa Cruz Biotechnology) which was
added to the reaction media, that were kept on ice for 30 min
before addition of the probe. ProteinÆDNA complexes were
resolved on 5% (w/v) nondenaturing polyacrylamide gels
(acrylamide/bisacrylamide 29 : 1, v/v) in 0.5· Tris/borate/
ECTA buffer (45 m
M
Tris/borate, 1 m

M
EDTA). The gels
were eletrophoresed for 2.5 h, at 30 mA.
Statistical analysis
Statistical analyses were performed using the Student’s t-test
and the
ANOVA
one-way test with the Tukey HSD posthoc
test for unequal N (Spjotvoll/Stoline test). All analysis were
performed using the StatSoft Inc. (1995)
STATISTICA FOR
WINDOWS
software.
Results
Identification of C/EBP-responsive sequences
in the CYP3A1 gene promoter
CYP3A1T81Luc recombinants containing the 5¢ upstream
region of the CYP3A1 gene were constructed and cotrans-
fected into CHO cells together with the C/EBP expression
vectors pMSV/EBPa or pMSV/EBPb.TheCHOcellline,
which is devoid of hepato-specific transcription factors, has
been used previously to characterize C/EBP-dependent gene
expression [26,35]. We found that C/EBPa significantly
Fig. 1. Transactivation of CYP3AT81Luc constructs with vectors
pMSV/EBPa or pMSV/EBPb in the CHO cell line. Cotransfections
were carried out using 0.5 lg of CYP3AT81Luc and increasing con-
centrations (0.025–0.2 lg) of C/EBP expression vectors, or empty
vector. (A) Diagramatic representation of the luciferase constructs
containing CYP3A1 5¢-flanking DNA sequences, upstream of luci-
ferase cDNA. Tk, thymidine kinase promoter; lucif, luciferase cDNA.

(B) Cotransfection of CYP3AT81Luc with 0.15 lgofpMSV/EBPa.
(C) Cotransfection of p0.8T81Luc with increasing concentrations of
pMSV/EBPa or pMSV/EBPb. The normalized luciferase activities are
expressed as mean values ± SD of duplicates for a minimum of three
experiments. *P < 0.05, **P <0.01,***P < 0.001 significant dif-
ferences between cells cotransfected with pMSV and pMSV/EBPa
(Student’s t-test).
558 E. Rodrigues et al.(Eur. J. Biochem. 270) Ó FEBS 2003
increases the luciferase reporter gene activity of the
CYP3A1T81Luc (Fig. 1B). The strongest transactivation
level (approximately sevenfold) was observed in the pre-
sence of the p0.8T81-Luc construct (Student’s t-test,
P < 0.001), which contains approximately 800 bp of the
5¢ upstream region of the CYP3A1 locus (Fig. 1B). Deletion
of the DNA segment )166 to )811 severely reduced
transactivation by C/EBPa. Moreover, transactivation of
the p0.8T81Luc is shown to be dose-dependent with the
C/EBPa expression vector (Fig. 1C).
C/EBP-binding activity in rat liver has been described as
involving both C/EBPa and C/EBPb. However, when
pMSV/EBPb was assayed in cotransfection experiments
with the CYP3A1 recombinant p0.8T81Luc no transacti-
vation was observed (Fig. 1C). Moreover, C/EBPb inhibits
the C/EBPa -stimulated expression of the p0.8T81Luc (data
not shown).
Characterization of the C/EBP binding sequences
in the CYP3A1 promoter region
We used gel mobility-shift assays, with the goal of identi-
fying active C/EBPa binding sites within the CYP3A1 locus.
First, oligonucleotides encompassing the putative C/EBP

responsive elements in p0.8T81Luc were synthesized. These
were named 3A1-300, 3A1-600 and 3A1-700 (Fig. 2A).
C/EBP proteins were then over-produced in COS-7 cells,
and the nuclear extracts used to characterize their binding
activities to 3A1-300, 3A1-600 or 3A1-700 by EMSA. The
specificity of the complex(es) formed when a C/EBP
consensus oligonucleotide (C/EBPcons) was used, was
verified by means of a supershift assay using an anti-C/
EBPa Ig (Fig. 2B; arrowhead). Both 3A1-300 and 3A1-600
oligonucleotides competed efficiently for C/EBPa binding
to the C/EBPcons preventing the formation of the complex
at a 50-fold molar excess (Fig. 2B). The C/EBPconsÆ
C/EBPa complex was not competed by 3A1-700 or by an
unrelated DNA sequence (Fig. 2B).
Supershift assays, with an anti-C/EBPa Ig and radio-
labelled oligonucleotides 3A1-600 and 3A1-300 (data not
shown) confirmed the specificity of C/EBPa protein binding
(Fig. 2C; arrowhead). We note that the 3A1-600ÆC/EBPa
complex was competed by C/EBPcons and by cold self,
while a mutant form of this oligonucleotide, differing in
Fig. 2. Characterization of the binding activities to sites 3A1-300, 3A1-
600 and 3A1-700 in C/EBPa over-expressed COS-7 cell nuclear
extracts. (A) DNA sequence of the CYP3A1 5¢-flanking region cor-
responding to construct p0.8T81Luc. The oligonucleotides containing
the putative C/EBP responsive elements used in the gel mobility-shift
assays are underlined. The oligonucleotide 3A1-300 corresponds to the
)350/)331 sequence of the CYP3A1 cDNA, the 3A1-600 to the )629/
)608 sequence and the 3A1-700 to nucleotides )767/)747. (B) EMSA
was performed using a radiolabeled double-stranded oligonucleotide
corresponding to the C/EBP consensus (C/EBPcons) as a probe.

Competition experiments were performed by adding a five- or 50-fold
excess of unlabelled double-stranded oligonucleotides corresponding
to cold-self, a nonspecific tubulin sequence, and 3A1-300, 3A1-600 or
3A1-700. (C) EMSA was performed using a radiolabeled double-
stranded oligonucleotide corresponding to site 3A1-600 as a probe.
Competition experiments were performed by adding a five- or 50-fold
excess of unlabelled double-stranded oligonucleotides corresponding
to C/EBPcons, cold self, mutant 3A1-600 (m3A1-600), and a non-
specific tubulin sequence. Supershift experiments were performed using
an anti-C/EBPa Ig. Symbol ÔsÕ in panel B and C denotes the position of
the C/EBP containing complex and the arrowhead ÔssÕ the position of
the DNAÆprotein complex shifted by the specific antibody.
Ó FEBS 2003 Two C/EBP sites in the CYP3A1 locus (Eur. J. Biochem. 270) 559
3 bp, did not. The results suggest the presence of two
C/EBPa binding sites at positions )300 and )600 within the
CYP3A1 locus.
Activation of multimerized CYP3A1-C/EBP responsive
elements by C/EBPa in transfection assays
To determine whether C/EBPa binding to either site 3A1-
300 or 3A1-600 resulted in transcriptional activation, we
analysed the ability of each specific site to confer C/EBP
responsiveness to the thymidine kinase promoter of the
pT81Luc recombinant. We performed the cotransfection of
CHO cells with pMSV/EBPa and single recombinants
containing two or three synthetic copies of 3A1-300 or 3A1-
600 oligonucleotides. As shown in Fig. 3, the C/EBP
elements found in the CYP3A promoter are functional
and autonomous units that confer C/EBP responsiveness to
a heterologous promoter.
Functional analysis of C/EBP binding sites in CYP3A1

promoter by site directed mutagenesis
The functional relevance of sites 3A1-300 and 3A1-600 for
CYP3A1 induction by C/EBPa was investigated by
individual or combined mutagenesis of the two sites in
p0.8T81Luc, followed by cotransfection of C/EBPa
expression vector into CHO cells. As shown in Fig. 4,
mutation of site 3A1-300 (m300) and/or 3A1-600 (m600)
significantly reduced activation of the p0.8T81Luc by
C/EBPa to approximately 50% of the wild-type level (wt)
(
ANOVA
one-way test: F ¼ 12.29, d.f. ¼ 9, P < 0001).
The posthoc comparisons revealed that significant differ-
ences were found between the wt and each mutant (Tukey
HSD for unequal N: m300, P < 0.05; m600, P <0.01;
dm300/600, P < 0.01). Western blot analysis of the
42 kDa C/EBPa protein in the cotransfection experiments
proved that the decrease in CYP3A1 activation is not due
to a reduction in C/EBPa expression (Fig. 4B). Taken
together, these results strongly indicate that both sites 3A1-
300 and 3A1-600 are functional elements of the CYP3A1
promoter.
Time-course analysis of the
in vivo
expression
of C/EBPa upon glucocorticoid administration
The time-course variation of the relative concentrations of
C/EBPa mRNAandproteinwasmonitoredintheratliver.
In parallel we also followed the accumulation of the
CYP3A1 mRNA, upon addition of dexamethasone

(Fig. 5).
C/EBPa mRNA concentration increases approximately
fivefold over the control value between 0.5 and 4 h after
treatment, and decreases to about fourfold of the control
value by 21 h after dexamethasone administration. Such an
increase clearly precedes the marked induction of hepatic
CYP3A1 mRNA found to occur between 4 and 21 h after
treatment (Fig. 5A).
We found the accumulation of both isoforms of C/EBPa
(p42, of 42 kDa and p30, of 30 kDa) to occur concomit-
antly with the increase in the relative abundance of the
corresponding mRNA. However, the two isoforms accu-
mulate with different kinetic profiles (Fig. 5B). Maximal
induction (an increase of about 2.5-fold over the basal level)
is observed for p30 between 2 and 4 h upon dexamethasone
administration, with a gradual decrease to the control value
21 h after treatment. In contrast the levels of the p42
isoform increases from hour 2 onwards, reaching constant
Fig. 3. Ability of multimerized CYP3A1-C/EBP responsive elements to
confer activation by C/EBPa in the CHO cell line. Cotransfections were
carried out with 0.5 lgof3A1-C/EBP-RE-T81Luc and 0.15 lgof
pMSV/EBPa expression vector, or empty vector. The normalized
luciferase activities are expressed as mean values ± SD of duplicates
for a minimum of three experiments.
Fig. 4. Functional analysis of the C/EBP binding sites in the CYP3A1
promoter by cotransfection studies using the p0.8T81Luc reporter plas-
mid altered by site-directed mutagenesis. (A) Cotransfections were
carried out using 0.5 lg of wild-type (wt) or the different mutated
promoter reporter plasmids (mut300, mut600 and dm300/600) and
0.15 lg of pMSV/EBPa expression vector, or empty vector. As no

significant differences in the basal activity of the different mutated
reporter plasmids were found, normalize luciferase activities are
expressed as mean values ± S.D. of fold induction of duplicates for a
minimum of three experiments. *P < 0.05, **P < 0.01 significant
differences in transactivation due to mutation of 3A1-300 or/and 3A1-
600 sites (
ANOVA
one-way test: F ¼ 12.29, d.f. ¼ 9, p < 0001; posthoc
Tukey HSD test for unequal N: m300, P < 0.05; m600, P <0.01;
dm300/600, P < 0.01). (B) Result of a representative Western blot
analysis of the 42 kDa C/EBPa protein in the cotransfection experi-
ments: lanes (–) with empty vector and (+) with 0.15 lgofpMSV/
EBPa. Fifty lL of total protein extract were analysed by SDS/PAGE
(10%, w/v), the resolved proteins transferred to poly(vinylidene
difluoride) membranes, and the membranes incubated with a specific
anti-C/EBPa Ig.
560 E. Rodrigues et al.(Eur. J. Biochem. 270) Ó FEBS 2003
levels of about twice the control value, which persisted 21 h
after treatment.
The relative differences observed for the increase in
C/EBPa mRNA (approximately fivefold) or protein levels
(approximately twofold) is consistent with the previous
demonstration of a post-transcriptional regulation of
C/EBP protein expression. Actually, a previous report has
shown that the stimulatory effect of cAMP on C/EBPb
mRNA levels does not result in the alteration of protein
levels [36], while others have reported a discrepancy between
C/EBPb protein and mRNA levels in various tissues [37].
Our results demonstrate that dexamethasone is an
inducer of C/EBPa, exerting a positive effect on the

steady-state levels of both the mRNA and protein levels
in the liver. The increase in the levels of both hepatic C/
EBPa isoforms clearly precedes induction of the CYP3A1
mRNA, suggesting that these factors may play an active
role in the transcriptional activation of the CYP3A1 gene by
dexamethasone.
In vivo
CYP3A1-C/EBPa binding activity
We investigated the presence and relative concentration of
active C/EBP proteins in the hepatic cell nuclei as a function
of the animal treatment. The results of the binding activities
of nuclear proteins extracted from control and from
dexamethasone treated rats to site 3A1-300 are shown in
Fig. 6. A significant increase in the cellular C/EBP protein
capable of binding to site 3A1-300 was systematically
observed in the living hepatic cell nuclei 2 h after treatment
with dexamethasone. The anti-C/EBPa Ig displaces the
majority of the complex (Fig. 6; arrowhead) confirming
the ability of this regulatory factor to participate in the
transcriptional activation of CYP3A1 in vivo. Similar results
were obtained for the 3A1-600 site (data not shown). These
results strongly suggest the requirement of C/EBPa for the
dexamethasone induced transcriptional activation of the
CYP3A1 gene.
Discussion
It has long been recognized that induction of hepatic
CYP3A genes by synthetic glucocorticoids differs from the
physiological responses that are mediated by the glucocor-
ticoid receptor [38]. More recently, the identification of PXR
as the transducer of the CYP3A1 adaptive responses to

xenobiotics, ligands of this novel receptor, has defined an
alternative steroid regulatory pathway [39].
However, other critical transcription factors are likely to
participate in the organization of the transcription initiation
complex in the de novo activation of the CYP3A1 locus. For
instance, the observation that the full induction of CYP3A1
by glucocorticoid cannot be achieved in CV1 cells, which
lack a number of hepatic transcription factors [18],
illustrates the need for other partner proteins in the synthetic
glucocorticoid-induced CYP3A activation in the liver.
We have identified two C/EBP sites in the CYP3A1
promoter that are specifically recognized by the C/EBPa
transcription factor. These two cis-elements, 3A1-300 and
3A1-600, share 50% and 60% identity with the C/EBP
consensus sequence. Moreover, point mutations of the most
conserved nucleotides in the cis-element completely preven-
ted binding of C/EBPa, thereby abolishing transactivation
of the CYP3A1 promoter. Accordingly, the dynamic study
of the C/EBP elements performed by transfection-transac-
tivation assays, clearly demonstrated the presence of active
C/EBP regulatory elements in the 5¢ upstream region of the
CYP3A1 gene.
Fig. 5. Time-course variation of rat liver CYP3A1 and C/EBPa levels
in response to dexamethasone. Total RNA and nuclear extracts were
isolated from pools of control or dexamethasone-treated adult rat liver
(40 mg per kg body mass) killed at various times after dexamethasone
administration. The blots shown are representative of results obtained
in three independent experiments. (A) Total RNA (20 lg) was ana-
lysed by Northern blotting for CYP3A1 and C/EBPa mRNA. Pho-
tographs of the ethidium bromide-stained total RNA, including the

18S and 28S ribosomal RNA bands, used to generate the Northern
blots are shown. (B) Western blot analysis of C/EBPa. Liver nuclear
proteins (5 lg) were analysed by SDS/PAGE (10%, w/v), transferred
to poly(vinylidene difluoride) membranes, and the membranes incu-
bated with a specific anti-C/EBPa Ig. Protein loading control using
Amido Black staining of the membrane is shown in the bottom panel.
Results were quantified using the
EAGLE
-
EYE
software package
(Stratagene).
Ó FEBS 2003 Two C/EBP sites in the CYP3A1 locus (Eur. J. Biochem. 270) 561
While all C/EBP proteins can interact with the same
DNA target sequences, C/EBPa but not C/EBPb specifi-
cally transactivates the CYP3A1 promoter by binding to the
3A1-300 and 3A1-600 promoter elements. Replacement of
one C/EBP factor by another has been proposed as a
modulation mechanism of particular genes at different
stages of proliferation and differentiation [40,41]. Multiple
homodimeric or heterodimeric combinations can occur
in vivo to control the biogenesis of a variety of proteins
displaying distinct physiological properties. The differential
occupancy of the C/EBP promoter element in a particular
gene may be dictated by the relative abundance and affinity
of the different homo- or heterodimers, as well as by
interactions of the different C/EBP proteins with other
factors binding to neighbouring regulatory sites. The in vivo
observations of the induction of C/EBPa mRNA and
protein preceding the accumulation of CYP3A1 mRNA in

rat liver suggest the importance of the characterized
C/EBPa promoter elements in the up-regulation of this
gene. This is consistent with the previously described
threefold increase of the C/EBPa mRNA concentration in
rat hepatoma cells H4IIE within 4 h of dexamethasone
treatment [36]. Transcriptional induction of C/EBP genes by
dexamethasone has also been shown in the rat intestinal
epithelial crypt cell line IEC-6, in which a rapid (30 min)
increase of C/EBPa and C/EBPb mRNA was observed [42].
Others have shown that induction of C/EBPb mRNA by
dexamethasone begins 30 min after treatment [43,44].
Dexamethasone transiently reduces the levels of C/EBPa
in 3T3L1 adipocytes, as well as in the white adipose tissue
[45], while it does not affect the C/EBPa levels in the rat
intestinal epithelium crypt IEC-6 cell line [42], indicating
that the effect of glucocorticoids on C/EBPa expression may
be cell type-specific.
Liver differentiation and development is under the
physiological control of glucocorticoid hormones that
induce the expression of several transcription factors in
the hepatocyte. C/EBP concentration was recently shown to
vary as a function of the differentiation of long-term human
primary hepatocytes in culture [46]. The requirement of
C/EBP isoforms for the mediation of hormone-induced
expression as been reported for hepatic genes [25], namely
P450 genes [47,48]. Synergy in glucocorticoid responsiveness
has been well characterized in the case of the phosphoenol-
pyruvate carboxykinase gene promoter [49]. Several other
hormone responses have also been demonstrated to depend
on C/EBP proteins, particularly the a-isoform [50]. The

presence of glucocorticoid responsive elements that require
C/EBPa for maximal hormone activation has been des-
cribed for the gene encoding carbamoylphosphate synthe-
tase I as well as other liver expressed genes [35].
The role of C/EBPa in regulating CYP3A gene expres-
sion has been previously investigated. C/EBPa, along with
D-element binding protein, was shown to increase expres-
sion of a construct containing the )169 bp to +11 bp
fragment of the CYP3A4 promoter [27]. The present results
first point to the importance of C/EBPa for the CYP3A1
induction by dexamethasone and suggest a cause–effect
relationship between the variation of C/EBPa and CYP3A1
mRNA in rat liver. This casual link is further supported by
the net increase of the functional C/EBPa proteins found in
the liver nuclei of the dexamethasone pretreated animals
that display the characteristic induction of CYP3A1.
Actually, the C/EBPa protein that accumulates in the liver
nuclei is capable of recognizing the two cis-acting elements
3A1-300 and 3A1-600 of the CYP3A1 gene promoter as
shown here using DNAÆprotein binding assays.
The link between dexamethasone treatment, C/EBP
induction and CYP3A1 transcriptional activation should
nevertheless be unequivocally demonstrated not to be
merely a phenomena association. The in vivo and in vitro
evidences here described are consistent with two alternative
hypotheses for an active role of C/EBPa in the CYP3A1
dexamethasone-responsiveness. Induction of the CYP3A1
could be driven by functional cross-talk interactions of the
Fig. 6. In vivo CYP3A1-C/EBP binding activity. EMSA of 5 lg liver
nuclear extract proteins from dexamethasone-treated rats using as a

probe a radiolabeled double-stranded oligonucleotide corresponding
to site 3A1-300. Supershift experiments were performed with a specific
anti-C/EBPa Ig. The (s) symbol denotes the position of the C/EBP
containing complex and the arrowhead (ss) the position of the DNA-
protein shifted by the specific antibody.
562 E. Rodrigues et al.(Eur. J. Biochem. 270) Ó FEBS 2003
activated PXR with C/EBPa, necessary for the CYP3A1
locus full response. Similarly, the glucocorticoid-induced
activation of the CYP3A1 promoter has already been
shown to primarily reflect the increase in the levels of other
transcription factors, namely RXRa [18,51].
An alternative pathway operating for the positive
modulation of CYP3A1 expression by glucocorticoids can
also be considered based on our results. Such a pathway
has been recently proposed by other authors based on the
effect of a mutation within the promoter region of the
Human CYP3A4, which interrupts a putative complex
binding site for both C/EBPa and HNF-3 [48]. The
described mutation interferes with the ability of the
CYP3A4 promoter to respond to glucocorticoids but does
not affect the response to the potent CYP3A4 inducer and
PXR-ligand, rifampicin.
The nature of a C/EBP mediated response or the putative
interactions between PXR and C/EBPa should be further
investigated at a molecular level, namely through dynamic
transfection–transactivation assay as well as by in vivo
footprinting analysis. These studies are necessary for a more
complete definition of the transduction pathway triggered
by the synthethic glucocorticoids in the hepatic cell that
directly modulate the expression of the CYP3A genes.

Acknowledgements
Supported by Fundac¸ a
˜
oparaaCieˆ ncia e Tecnologia – grant PRAXIS
4/4.1/BD/2999 (E.R); project PRAXIS XXI 2/2.1/BIA/234/94 – and by
the Franco-Portuguese Scientific Cooperation Program INSERM/
ICCTI.
References
1. Zaret, K.S. (1996) Molecular genetics of early liver development.
Annu. Rev. Physiol. 58, 231–251.
2. Gonzalez, F.J. & Lee, Y.H. (1996) Constitutive expression of
hepatic cytochrome P450 genes. Faseb J. 10, 1112–1117.
3. Waxman, D.J. (1999) P450 gene induction by structurally diverse
xenochemicals: central role of nuclear receptors CAR, PXR,
PPAR. Arch. Biochem. Biophys. 369, 11–23.
4. Pereira, T.M. & Lechner, M.C. (1995) Differential regulation
of the cytochrome P450 3A1 gene transcription by dexa-
methasone in immature and adult rat liver. Eur J. Biochem. 229,
171–177.
5. Gonzalez,F.J.,Song,B.J.&Hardwick,J.P.(1986)Pregnenolone
16a-carbonitrile-inducible P-450 gene family: gene conversion and
differential regulation. Mol. Cell Biol. 6, 2969–2976.
6. Kliewer, S.A., Moore, J.T., Wade, L., Staudinger, J.L., Watson,
M.A., Jones, S.A., McKee, D.D., Oliver, B.B., Willson, T.M.,
Zetterstrom, R.H., Perlmann, T. & Lehmann, J.M. (1998) An
orphan nuclear receptor activated by pregnanes defines a novel
steroid signaling pathway. Cell 92, 73–82.
7. Lehmann, J.M., McKee, D.D., Watson, M.A., Willson, T.M.,
Moore, J.T. & Kliewer, S.A. (1998) The human orphan nuclear
receptor PXR is activated by compounds that regulate CYP3A4

gene expression and cause drug interactions. J. Clin. Invest 102,
1016–1023.
8. Blumberg, B., Sabbagh, W. Jr., Juguilon, H., Bolado, J. Jr., van
Meter,C.M.,Ong,E.S.&Evans,R.M.(1998)SXR,anovel
steroid and xenobiotic-sensing nuclear receptor. Genes Dev 12,
3195–3205.
9. Huss, J.M., Wang, S.I., Astrom, A., McQuiddy, P. & Kasper,
C.B. (1996) Dexamethasone responsiveness of a major gluco-
corticoid-inducible CYP3A gene is mediated by elements
unrelated to a glucocorticoid receptor binding motif. Proc. Natl
Acad. Sci. U S A 93, 4666–4670.
10. Quattrochi, L.C., Mills, A.S., Barwick, J.L., Yockey, C.B. &
Guzelian, P.S. (1995) A novel cis-acting element in a liver
cytochrome P450, 3A gene confers synergistic induction by
glucocorticoids plus antiglucocorticoids. J. Biol. Chem 270,
28917–28923.
11. Huss, J.M. & Kasper, C.B. (1998) Nuclear receptor involvement in
the regulation of rat cytochrome P450 3A23 expression. J. Biol.
Chem 273, 16155–16162.
12. Ogino, M., Nagata, K., Miyata, M. & Yamazoe, Y. (1999)
Hepatocyte nuclear factor 4-mediated activation of rat CYP3A1
gene and its modes of modulation by apolipoprotein AI regulatory
protein I and v-ErbA-related protein 3. Arch. Biochem. Biophys.
362, 32–37.
13. Jones, S.A., Moore, L.B., Shenk, J.L., Wisely, G.B., Hamilton,
G.A., McKee, D.D., Tomkinson, N.C., LeCluyse, E.L., Lambert,
M.H., Willson, T.M., Kliewer, S.A. & Moore, J.T. (2000) The
pregnane X receptor: a promiscuous xenobiotic receptor that has
diverged during evolution. Mol Endocrinol. 14, 27–39.
14. Bertilsson, G., Heidrich, J., Svensson, K., Asman, M., Jendeberg,

L., Sydow-Backman, M., Ohlsson, R., Postlind, H., Blomquist, P.
& Berkenstam, A. (1998) Identification of a human nuclear
receptor defines a new signaling pathway for CYP3A induction.
Proc.NatlAcad.Sci.USA95, 12208–12213.
15. Yanagimoto,T.,Itoh,S.,Sawada,M.&Kamataki,T.(1997)
Mouse cytochrome P450 (Cyp3a11): predominant expression in
liver and capacity to activate aflatoxin. B1, Arch. Biochem.
Biophys. 340, 215–218.
16. Wrighton, S.A., Schuetz, E.G., Watkins, P.B., Maurel, P.,
Barwick,J.,Bailey,B.S.,Hartle,H.T.,Young,B.&Guzelian,P.
(1985) Demonstration in multiple species of inducible hepatic
cytochromes P-450 and their mRNAs related to the glucocorti-
coid-inducible cytochrome P-450 of the rat. Mol Pharmacol. 28,
312–321.
17. Watkins, P.B., Murray, S.A., Winkelman, L.G., Heuman, D.M.,
Wrighton, S.A. & Guzelian, P.S. (1989) Erythromycin breath test
as an assay of glucocorticoid-inducible liver cytochromes P-450.
Studies in rats and patients. J. Clin. Invest 83, 688–697.
18. Huss, J.M. & Kasper, C.B. (2000) Two-stage glucocorticoid
induction of CYP3A23 through both the glucocorticoid and
pregnane X receptors. Mol Pharmacol. 58, 48–57.
19. Lekstrom-Himes, J. & Xanthopoulos, K.G. (1998) Biological role
of the CCAAT/enhancer-binding protein family of transcription
factors. J. Biol. Chem 273, 28545–28548.
20. Nishio, Y., Isshiki, H., Kishimoto, T. & Akira, S. (1993) A nuclear
factor for interleukin-6 expression (NF-IL6) and the glucocorti-
coid receptor synergistically activate transcription of the rat
a1-acid glycoprotein gene via direct protein–protein interaction.
MolCellBiol.13, 1854–1862.
21. Lee,Y.H.,Yano,M.,Liu,S.Y.,Matsunaga,E.,Johnson,P.F.&

Gonzalez, F.J. (1994) A novel cis-acting element controlling the
rat CYP2D5 gene and requiring cooperativity between C/EBPb
andanSp1factor.MolCellBiol.14, 1383–1394.
22. Lee, Y.H., Williams, S.C., Baer, M., Sterneck, E., Gonzalez,
F.J. & Johnson, P.F. (1997) The ability of C/EBP beta but not
C/EBP alpha to synergize with an Sp1 protein is specified by the
leucine zipper and activation domain. MolCellBiol.17,
2038–2047.
23. Luc, P.V., Adesnik, M., Ganguly, S. & Shaw, P.M. (1996) Tran-
scriptional regulation of the CYP2B1 and CYP2B2 genes by
C/EBP-related proteins. Biochem. Pharmacol. 51, 345–356.
24. Park, Y. & Kemper, B. (1996) The CYP2B1 proximal promoter
contains a functional C/EBP regulatory element. DNA Cell Biol.
15, 693–701.
Ó FEBS 2003 Two C/EBP sites in the CYP3A1 locus (Eur. J. Biochem. 270) 563
25. Cassel, T.N., Gustafsson, J.A. & Nord, M. (2000) CYP2B1 is
regulated by C/EBPa and C/EBPd inlung epithelial cells. Mol Cell
Biol.Res.Commun3, 42–47.
26. Tollet, P., Lahuna, O., Ahlgren, R., Mode, A. & Gustafsson, J.A.
(1995) CCAAT/enhancer-binding protein-alpha-dependent trans-
activation of CYP2C12 in rat hepatocytes. Mol Endocrinol. 9,
1771–1781.
27. Ourlin, J.C., Jounaidi, Y., Maurel, P. & Vilarem, M.J. (1997) Role
of the liver-enriched transcription factors C/EBPa and DBP in
the expression of human CYP3A4 and CYP3A7. J. Hepatol. 26,
54–62.
28. Telhada, M.B., Pereira, T.M. & Lechner, M.C. (1992) Effect of
dexamethasone and phenobarbital on run-on transcription rate
and CYP3A mRNA concentration in rat liver: changes during
development. Arch. Biochem. Biophys. 298, 715–725.

29. Pereira, T.M., Carlstedt-Duke, J., Lechner, M.C. & Gustafsson,
J.A. (1998) Identification of a functional glucocorticoid response
element in the CYP3A1/IGC2 gene. DNA Cell Biol. 17, 39–49.
30. Nordeen, S.K. (1988) Luciferase reporter gene vectors for analysis
of promoters and enhancers. Biotechniques 6, 454–458.
31. Auffray, C. & Rougeon, F. (1980) Purification of mouse
immunoglobulin heavy-chain messenger RNAs from total
myeloma tumor RNA. Eur J. Biochem. 107, 303–314.
32. Hattori, M., Tugores, A., Veloz, L., Karin, M. & Brenner, D.A.
(1990) A simplified method for the preparation of transcriptionally
active liver nuclear extracts. DNA Cell Biol. 9, 777–781.
33. Schreiber, E., Matthias, P., Muller, M.M. & Schaffner, W. (1989)
Rapid detection of octamer binding proteins with Ômini-extractsÕ,
prepared from a small number of cells. Nucleic Acids Res. 17, 6419.
34. Johnson, P.F. (1993) Identification of C/EBP basic region residues
involved in DNA sequence recognition and half-site spacing
preference. MolCellBiol.13, 6919–6930.
35. Christoffels, V.M., Grange, T., Kaestner, K.H., Cole, T.J.,
Darlington, G.J., Croniger, C.M. & Lamers, W.H. (1998) Gluco-
corticoid receptor, C/EBP, HNF3, and protein kinase A coordi-
nately activate the glucocorticoid response unit of the
carbamoylphosphate synthetase. I Gene, Mol Cell Biol. 18, 6305–
6315.
36. Crosson, S.M., Davies, G.F. & Roesler, W.J. (1997) Hepatic
expression of CCAAT/enhancer binding protein a: hormonal and
metabolic regulation in rats. Diabetologia 40, 1117–1124.
37. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E. & Schi-
bler, U. (1990) LAP, a novel member of the C/EBP gene family,
encodes a liver-enriched transcriptional activator protein, Genes
Dev 4, 1541–1551.

38. Schuetz, E.G., Wrighton, S.A., Barwick, J.L. & Guzelian, P.S.
(1984) Induction of cytochrome P-450 by glucocorticoids in rat
liver. I. Evidence that glucocorticoids and pregnenolone 16a-car-
bonitrile regulate de novo synthesis of a common form of cyto-
chrome P-450 in cultures of adult rat hepatocytes and in the liver
in vivo. J. Biol. Chem 259, 1999–2006.
39. Kliewer, S.A., Lehmann, J.M. & Willson, T.M. (1999) Orphan
nuclear receptors: shifting endocrinology into reverse. Science 284,
757–760.
40. Cao, Z., Umek, R.M. & McKnight, S.L. (1991) Regulated
expression of three C/EBP isoforms during adipose conversion of
3T3-L1 cells. Genes Dev. 5, 1538–1552.
41. Poli, V., Mancini, F.P. & Cortese, R. (1990) IL-6DBP, a nuclear
protein involved in interleukin-6 signal transduction, defines a new
family of leucine zipper proteins related to C/EBP. Cell 63, 643–
653.
42. Boudreau, F., Blais, S. & Asselin, C. (1996) Regulation of
CCAAT/enhancer binding protein isoforms by serum and gluco-
corticoids in the rat intestinal epithelial crypt cell line IEC-6. Exp
Cell Res. 222, 1–9.
43. Matsuno, F., Chowdhury, S., Gotoh, T., Iwase, K., Matsuzaki,
H., Takatsuki, K., Mori, M. & Takiguchi, M. (1996) Induction of
the C/EBPb gene by dexamethasone and glucagon in primary-
cultured rat hepatocytes. J. Biochem. (Tokyo) 119, 524–532.
44. Gotoh, T., Chowdhury, S., Takiguchi, M. & Mori, M. (1997) The
glucocorticoid-responsive gene cascade. Activation of the rat
arginase gene through induction of C/EBPb. J. Biol. Chem 272,
3694–3698.
45. MacDougald,O.A.,Cornelius,P.,Lin,F.T.,Chen,S.S.&Lane,
M.D. (1994) Glucocorticoids reciprocally regulate expression of

the CCAAT/enhancer- binding protein a and d genes in 3T3-L1
adipocytes and white adipose tissue. J. Biol. Chem 269, 19041–
19047.
46. Ferrini, J.B., Rodrigues, E., Dulic, V., Pichard-Garcia, L., Fabr,
J.M.,Blanc,P.&Maurel,P.(2001)ExpressionandDNA-binding
activity of C/EBPa and C/EBPb in human liver and differentiated
primary hepatocytes. J. Hepatol. 35, 170–177.
47. Yamada, K., Duong, D.T., Scott, D.K., Wang, J.C. & Granner,
D.K. (1999) CCAAT/enhancer-binding protein beta is an acces-
sory factor for the glucocorticoid response from the cAMP
response element in the rat phosphoenolpyruvate carboxykinase
gene promoter. J. Biol. Chem 274, 5880–5887.
48. El-Sankary, W., Bombail, V., Gibson, G.G. & Plant, N. (2002)
Glucocorticoid-mediated induction of CYP3A4 is decreased by
disruption of a protein:DNA interaction distinct from the preg-
nane X receptor response element. Drug Metab Dispos 30, 1029–
1034.
49. Croniger, C., Leahy, P., Reshef, L. & Hanson, R.W. (1998)
C/EBP and the control of phosphoenolpyruvate carboxykinase
gene transcription in the liver. J. Biol. Chem 273, 31629–31632.
50. Crosson, S.M. & Roesler, W.J. (2000) Hormonal regulation of
the phosphoenolpyruvate carboxykinase gene. Role specific
CCAAT/enhancer-binding protein isoforms. J. Biol. Chem 275,
5804–5809.
51. Pascussi, J.M., Drocourt, L., Fabre, J.M., Maurel, P. & Vilarem,
M.J. (2000) Dexamethasone induces pregnane X receptor and
retinoid X receptor-a expression in human hepatocytes: synergistic
increase of CYP3A4 induction by pregnane X receptor activators.
Mol. Pharmacol. 58, 361–372.
564 E. Rodrigues et al.(Eur. J. Biochem. 270) Ó FEBS 2003