Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt

S
-Decyl-glutathione nonspecifically stimulates the ATPase activity
of the nucleotide-binding domains of the human multidrug
resistance-associated protein, MRP1 (ABCC1)
Robbert H. Cool
1
, Marloes K. Veenstra
1
, Wim van Klompenburg
1
, Rene
´
I. R. Heyne
1
, Michael Mu¨ ller
2,
*,
Elisabeth G. E. de Vries
3
, Hendrik W. van Veen
1,†
, and Wil N. Konings
1
1
Department of Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen,
Haren, the Netherlands;
2
Department of Gasteroenterology and Hepatology, University Hospital Groningen, the Netherlands;
3
Department of Medical Oncology, University Hospital Groningen, the Netherlands
The human multidrug resistance-associated protein (MRP1)

is an ATP-dependent efflux pump that transports anionic
conjugates, and hydrophobic compounds in a glutathione
dependent manner. Similar to the other, well-character-
ized multidrug transporter P-gp, MRP1 comprises two
nucleotide-binding domains (NBDs) in addition to
transmembrane domains. However, whereas the NBDs of
P-gp have been shown to be functionally equivalent,
those of MRP1 differ significantly. The isolated NBDs of
MRP1 have been characterized in Escherichia coli as
fusions with either the glutathione-S-transferase (GST) or
the maltose-binding domain (MBP). The nonfused NBD1
was obtained by cleavage of the fusion protein with
thrombin. The GST-fused forms of NBD1 and NBD2
hydrolyzed ATP with an apparent K
m
of 340 l
M
and a
V
max
of 6.0 nmol P
I
Æmg
)1
Æmin
)1
,andaK
m
of 910 l
M

ATP and a V
max
of 7.5 nmol P
I
Æmg
)1
Æmin
)1
, respectively.
Remarkably, S-decyl-glutathione, a conjugate specifically
transported by MRP1 and MRP2, was able to stimulate
the ATPase activities of the isolated NBDs more than
2-fold in a concentration-dependent manner. However, the
stimulation of the ATPase activity was found to coincide
with the formation of micelles by S-decyl-glutathione.
Equivalent stimulation of ATPase activity could be
obtained by surfactants with similar critical micelle con-
centrations.
Keywords: ABC; MRP; multidrug resistance; ATPase;
nucleotide-binding domain.
Multidrug resistance of human tumour cells is an impedi-
ment to successful cancer treatment and is frequently
associated with the overexpression of certain members of
the ATP-binding cassette (ABC) transporter superfamily
such as the MDR1 P-glycoprotein (P-gp; ABCB1) and the
human multidrug resistance-associated protein (MRP1;
ABCC1) [1–3]. As other ABC transporters, MRP1 is a
membrane-bound transport protein that mediates the
extrusion of its substrates at the expense of ATP. Studies
on MRP1-expressing cells and membrane vesicles derived

thereof have demonstrated that MRP1 has a broad
specificity for glutathione S-conjugates, most notably
cysteinyl leukotrienes, and for anionic conjugates of bile
salts and steroid hormones [2,4]. In addition, MRP1 is able
to extrude natural product drugs that are used in chemo-
therapeutic strategies, such as daunorubicin and vincristine,
in cotransport with reduced glutathione [5–7].
MRP and P-gp proteins may share a mechanism by
which ATP hydrolysis is coupled to drug transport [8,9].
Indeed, the basal ATPase activity of P-gp and MRP
proteins can be stimulated by some of their transported
substrates or allocrites [10–18]. However, two aspects blur
a clear view on the coupling mechanism. Firstly, whereas
some allocrites do not stimulate, and other allocrites show
only a weak stimulation of the ATPase activity, modu-
lators of transport activity that are not transported can
also affect ATPase activity. Secondly, the concentration-
dependency of the allocrite-stimulated ATPase activity
often is represented by a bell-shaped curve, and most
allocrites even inhibit the ATPase activity at high
concentrations [12,13,19,20]. This can be explained by
assuming the presence of one high-affinity stimulatory
binding site, and one low-affinity inhibitory binding site.
These sites may be identical to the on and off sites, which
are distinct allocrite-binding sites involved in transmem-
brane transport [11].
A typical, but complicating, characteristic of multidrug
transporters is their capability to efficiently expel struc-
turally unrelated compounds from the cell. It was shown
Correspondence to R. H. Cool, Pharmaceutical Biology, Groningen

University, A. Deusinglaan 1, 9713 AV Groningen, the Netherlands,
Fax: + 31 50 3633000, Tel.: + 31 50 3638154
E-mail:
Abbreviations: ABC, ATP-binding cassette; GST, glutathione-
S-transferase; MBP, maltose-binding protein; MRP, multidrug
resistance-associated protein; NBD, nucleotide-binding domain.
Note: We prefer to use the term allocrite to describe transported
compounds as proposed previously [8] in order to distinguish these
compounds from the substrate, which by definition is ATP, and
nontransported modulators.
*Present address: Division of Nutrition, Metabolism and Genomics,
University Wageningen, the Netherlands.
Present address: Department of Pharmacology, University of
Cambridge, UK.
(Received 14 January 2002, revised 8 May 2002,
accepted 30 May 2002)
Eur. J. Biochem. 269, 3470–3478 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03028.x
that different allocrites bind to different regions of the
transporter, as revealed by kinetic measurements and
mutational studies [21]. Although these drug-binding sites
are still ill defined, there is ample evidence that most, if
not all, of the residues involved in allocrite binding and
transport are located within the transmembrane domains
in P-gp and MRP [22–30]. Interestingly, however, two
studies point to the binding of an allocrite by the ATP-
binding domain of an ABC transporter. The oleando-
mycin transporter OleB from Streptomyces antibioticus
was suggested to have an allocrite-binding site located on
the ATP-binding domain [31], and KpsT, the ATP-
binding component of the Escherichia coli ABC trans-

porter KspTM involved in the transport of polysialic
acid, was shown to co-immunoprecipitate with polysialic
acid [32].
In order to reveal the characteristics of the individual
nucleotide-binding domains (NBDs) of MRP1, and in
search of a putative interaction of these NBDs with
allocrites, we have overproduced these domains as gluta-
thione-S-transferase or maltose binding domain fusion
proteins in E. coli. Both NBDs were found to be able to
hydrolyse ATP with comparable activity. Remarkably, the
MRP1- and MRP2-specific allocrite S-decyl-glutathione
significantly stimulates the ATPase activity of these do-
mains, quite similar to its effect on the ATPase activity of
reconstituted MRP2. However, this stimulation was found
to relate to micelle formation by this compound.
MATERIALS AND METHODS
Cloning of the nucleotide-binding domains of MRP
DNA coding for the first nucleotide-binding domain
(NBD1) of human MRP1 (residues Lys614–Lys959) was
amplified by PCR from plasmid pJ3W (kindly donated by
P. Borst, Netherlands Cancer Institute, Amsterdam) using
the forward primer 5¢-GGCG
GGATCCGATATCA
AACGCCTGAGGATCTTTC-3¢ and the reverse primer
5¢-TACTAGCGGCGCCGTTA
GAATTCCTTGACCTG
CCCTGTCTGCGC-3¢ (the introduced BamHI and EcoRI
sites, respectively, are underlined). To obtain a translational
fusion between glutathione S-transferase (GST) of Schisto-
soma japonicum and NBD1, the PCR product was cloned

as a BamHI–EcoRI fragment into pGEX4T-1 (Pharma-
cia), giving pGST-NBD1. The fusion of the NBD1 with
the maltose-binding domain (MBP) was accomplished
through subcloning of the BamHI–SalI fragment from
pGST-NBD1 into the pMalc2 expression vector (New
England Biolabs).
DNA coding for NBD2 of MRP1 (residues Glu1294–
Val1531) was directly cloned as an EcoRI–NotIfragmentin
pGEX4T-1 to create pGST-NBD2. A slightly larger
fragment of NBD2 (residues Gly1291–Val1531) was pro-
duced by PCR (forward primer 5¢-CCC
GGATCCGGC
CGAGTGGAGTTCCGGAAC-3¢ and reverse primer
5¢-GCCAG
GTCGACTTATCACACCAAGCCGGCGT
CTTTGG-3¢) and subcloned into the expression vector
pMBPT [33]. This vector, kindly provided by G. Altenberg
(University of Texas Medical Branch, Galveston, USA),
comprises a factor Xa and a thrombin cleavage site between
the MBP and the fusion partner, so that the nonfused
protein can be obtained by incubation with either protease.
Protein overproduction and purification
Overproduction of the fusion proteins was performed
principally according to standard procedures, even though
several deviations were tested. A low incubation tempera-
ture after induction of gene expression was essential to
increase solubility of NBD2-fusion proteins. Escherichia coli
strains DH5a and the protease-poor
AD
202 were both used

for expression and did not result in large differences.
In short, an overnight preculture in Luria–Bertani
medium containing 50–100 lgÆmL
)1
ampicillin and 0.2–
0.5% glucose was used to inoculate a larger volume of the
same medium. After incubation at 37 °CuptoD
660
 0.6,
0.05–0.1 m
M
of isopropyl thio-b-
D
-galactoside (Boehringer
Mannheim, Germany) was added. NBD1 fusion protein-
producing cultures were further incubated at 30 °Cfor5h,
whereas NBD2-fusion protein producing cultures were
cooled to 25 or 18 °C and incubated for an additional 5 or
16 h, respectively. Cells were harvested by centrifugation
and resuspended in buffer A (20–50 m
M
Tris/HCl, pH 7.5,
50–100 m
M
NaCl, 5–10 m
M
dithiothreithol, 10% glycerol)
in the ratio of 3 mL of buffer per g of wet cells. The
resuspended cells were lyzed by ultra-sonication or by
passage through a French pressure cell at 16 000 p.s.i., and

centrifuged for 30–45 min at 40 000 g and 4 °Ctoremove
cell debris. The supernatant was used for purification
according to the protocols of the supplier of the column
material: glutathione–Sepharose 4B (Pharmacia Biotech)
for the purification of GST-fusion proteins, or amylose resin
(New England Biolabs) for the purification of MBP-fusion
proteins. Column material with bound proteins was washed
extensively with buffer A, after which fusion proteins were
eluted with buffer A plus 10 m
M
glutathione or maltose.
Protein containing fractions were determined by SDS/
PAGE and pooled fractions were concentrated using
Vivaspin
TM
centrifugation vials (Vivascience Inc.).
To purify NBD1 as a separate domain in the absence of
GST, the specific thrombin cleavage site located between
GST and NBD1 was employed. A 20-mL column contain-
ing glutathione–Sepharose 4B with GST–NBD1 was pre-
pared as described above, after which 20 units of thrombin
(Sigma) were added to the column. After an incubation of
16 h at 4 °C, the nonfused NBD1 was eluted from the
column with buffer A and concentrated using Vivaspin
centrifugation vials (Vivascience Inc.).
Purified protein was rapidly frozen in liquid nitrogen and
stored at )80 °C. Protein concentrations were determined
by the Bradford assay using BSA as the standard.
The following purified proteins were kindly provided by
colleagues: the MBP fusion protein of the NBD of the

lactococcal half-transporter LmrA (residues Glu328-
Lys590) by M. Pasmooij (Groningen University, the
Netherlands); E. coli MalK by H. Landmesser (Humboldt
University, Berlin, Germany); and GlcV, the ATP-binding
subunit of a glucose uptake system from the thermoacido-
philic Sulfolobus solfataricus, by S. Albers (Groningen
University, the Netherlands).
ATPase activity
The ATPase activity of NBDs was measured by a colori-
metric assay [34]. Protein was incubated in buffer, supple-
mented with ATP (from a 100-m
M
stock of Na-ATP,
Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3471
brought to pH 7.5 with NaOH; Sigma), and allocrites or
inhibitors, as described in the legends. Substrates and
inhibitors were added to the reaction mixtures or inorganic
phosphate standards prior to the addition of ATP. The
transfer of the mixture from ice to a water bath of 30 °C
started the reaction. At this temperature, the reaction was
linear over the 30 min-incubation interval. Samples of
30 lL were added to wells of a 24-well plate precooled on
ice, where after 150 lL of colour reagent [0.034% (w/v)
malachite green base (Sigma), 1.05% (w/v) ammonium
molybdate and 0.1% (v/v) Triton X-100] was added. After
5 min on ice, 75 lL of 34% (w/v) citric acid was added, and
the plate was incubated for 30 min at room temperature.
Subsequently, the D
650
wasmeasuredinanELISAplate

reader. As a control, samples were incubated for 30 min on
ice and treated in the same way. A calibration was
performed using 0–160 l
M
of inorganic phosphate.
For clarity, in Table 1 ATPase activities are presented
relative to the activity measured at 2 m
M
Mg
2+
,andin
Figs 2,3,4 and 6 relative to the activity measured in absence
of surfactant. The absolute ATPase activities of the proteins
in these experiments were, depending on protein prepar-
ation, in the range of 0.3–0.5 (pmol P
i
)Æ(pmol pro-
tein)
)1
Æmin
)1
for the GST- and MBP-fused versions of
NBD, NBD2, and LmrA-NBD, and approximately
0.02 (pmol P
i
)Æ(pmol protein)
)1
Æmin
)1
for the nonfused

version of NBD1.
Micelle formation
Micelle formation was followed by measurement of the
fluorescence of 1,6-diphenyl-1,2,3-hexatriene (Fluka), using
excitation wavelength 355 and emission wavelength
428 nm. 1,6-diphenyl-1,2,3-hexatriene was dissolved to
2.5 m
M
in dimethylsulfoxide, and used at a final concen-
tration of 5 l
M
. 1,6-Diphenyl-1,2,3-hexatriene was incu-
bated with surfactants for at least 1 h at room
temperature, as time-dependent measurements demonstra-
ted that an equilibrium was reached after 30 min.
Although micelle formation is usually determined with
1,6-dihydro-1,2,3-hexatriene using fluorescence anisotropy
[35], standard fluorescence measurements give a reason-
ably good indication of the critical micelle formation value
of a surfactant. This was checked by determining the
critical micelle formation value of dodecylmaltoside, which
corresponded to the critical micelle formation value given
by the manufacturer.
RESULTS
Production and purification of the NBDs of MRP1
The amplified PCR products for the first and second NBD
of MRP1 were cloned into the pGEX-2T expression vector
in frame with GST domain. The overexpression at 30 °Cof
the gene encoding the GST–NBD1 fusion protein under
control of the isopropyl thio-b-

D
-galactoside-inducible tac
promoter was evident as shown in Fig. 1. For the overpro-
duction of GST–NBD2 at 30 °C, most fusion protein was
found in inclusion bodies. However, when the protein
overproduction was performed at lower temperature, most
GST–NBD2 was present in the soluble fraction. A yield of
approximately 15 mg GST–NBD1 and 3 mg GST–NBD2
per litre of culture was achieved. The resultant proteins
appear more than 95% pure as judged by SDS/PAGE
analysis.
Comparable results were obtained with the MBP-fused
versions of NBD1 and NBD2. However, thrombin cleavage
appeared less efficient for the MBP-fusion proteins as
compared to the GST-fusion proteins.
Basal ATPase activity
In order to study the role of NBD1 and NBD2 in MRP1-
mediated drug transport, the ATPase activity of the fusion
proteins was determined. Kinetic analysis revealed for
GST-NBD1 an apparent K
m
of 340 l
M
ATP and a V
max
of 6.0 nmol P
i
Æmg
)1
min

)1
, and for GST-NBD2 an
Table 1. Dependence of the ATPase activity of GST–NBD1 and GST–
NBD2 on divalent cations. ATPase activity was measured as described
in Materials and methods in the presence of 2 m
M
ATP and 2 m
M
divalent cations or EDTA. For comparison, the ATPase activity of
each NBD are presented as percentages of its activity in the presence of
magnesium.
Addition GST–NBD1 (%) GST–NBD2 (%)
Mg
2+
100 ± 9 100 ± 5
Ca
2+
86 ± 12 22 ± 3
Mn
2+
37 ± 4 38 ± 2
Co
2+
39 ± 4 30 ± 6
EDTA 0 0
Fig. 1. Overproduction and purification of MRP1 NBDs in Escherichia
coli. Fractions obtained for overproduction and purification of NBDs
were analyzed by 10% SDS/polyacrylamide gel electrophoresis and
stained by colloidal Coomassie staining. Lane 1–3, total bacterial
proteins of cell cultures producing GST–NBD1: lane 1, overnight

without IPTG; lane 2, before addition of isopropyl thio-b-
D
-galacto-
side (t ¼ 0); lane 3, harvested cells after induction. The arrow indicates
the position of GST–NBD1. Lane 4–6, overloaded samples of (semi)-
purified fractions: lane 4, GST–NBD1 purified by glutathione-Seph-
arose 4B affinity chromatography; lane 5, MBP–NBD2 purified by
amylose/agarose; lane 6, NBD1 purified by glutathione-Sepharose 4B
affinity chromatography followed by thrombin cleavage. The positions
of molecular mass markers (in kDa) are indicated.
3472 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002
apparent K
m
of 910 l
M
ATP and a V
max
of 7.5 nmol
P
i
Æmg
)1
Æmin
)1
(data not shown). Similar V
max
values (5–
10 nmol P
i
Æmg

)1
Æmin
)1
), but higher K
m
values (1.5–1.8 m
M
)
were obtained recently with His-tagged NBDs of MRP1
[36]. When compared to the full length MRP1, the obtained
K
m
values are somewhat higher than the apparent K
m
of
100 l
M
ATP for MRP1-mediated leukotriene C
4
transport
[37], and than the apparent K
m
of 104 l
M
found for purified
MRP1 after reconstitution in proteoliposomes [38]. Signi-
ficantly different values were obtained with the purified
MRP1 in presence of phospholipids: K
m
¼ 3m

M
and
V
max
¼ 460 nmol P
i
Æmg
)1
Æmin
)1
[14].
The MBP-fused versions of NBD1 and NBD2 have
similar ATPase activities as the GST-fused proteins. In
contrast, the ATPase activity of the nonfused NBD1
(without GST- or MBP-moiety) was one order of magni-
tude lower than that of the fused protein. As yet, we have no
evident explanation for this. The nonfused version of NBD2
could not be isolated by thrombin cleavage of the GST–
NBD2 protein due to proteolytic degradation.
GTP was hydrolyzed by both GST–NBDs (data not
shown), in agreement with the finding that reconstituted
MRP1 does not show nucleotide specificity [38]. The
ATPase activity of GST–NBD1 and -NBD2 was dependent
on the presence of divalent cations. The highest ATPase
activity was obtained with magnesium ions but the hydro-
lysis of ATP was also observed in the presence of
manganese, cobalt and calcium ions (Table 1).
To further characterize the ATPase activity of both
GST-NBDs, the effect of ATPase inhibitors was tested.
The cysteinyl-reactive N-ethylmaleimide did not signifi-

cantly inhibit the ATPase activities at concentrations of
up to 2 m
M
. However, the ATPase activity of GST–NBD1
and GST–NBD2 was inhibited more than 70% by
2m
M
sodium azide and approximately 40% by 2 m
M
ortho-vanadate. In comparison, the ATPase activity of
reconstituted MRP1 was efficiently inhibited by ortho-
vanadate (IC
50
¼ 10 l
M
), less efficiently by N-ethylmalei-
mide (IC
50
¼ 0.5 m
M
), and hardly by sodium azide
(IC
50
>6m
M
) [38]. Surprisingly, the ATPase activities of
the His-tagged NBDs were inhibited by N-ethylmaleimide
[36].
In an attempt to obtain information about interdomain
interactions, the basal ATPase activities were measured at

different NBD concentrations. No significant deviations
from a linear concentration-dependence were observed in
the tested concentration range up to 4 l
M
for the separate
domains and up to 1 l
M
for the mixture of the MBP-NBDs.
Allocrite-mediated effects on the ATPase activity
The capability was tested of a number of allocrites to
stimulate the ATPase activity of the NBDs of MRP1. The
following compounds (tested at the indicated concentra-
tions) had no significant effect on the basal ATPase activity:
vincristine (46 l
M
); vincristine (46 l
M
) plus reduced gluta-
thione (500 l
M
); reduced glutathione (500 l
M
); oxidized
glutathione (500 l
M
); probenecid (1 m
M
); sulfinpyranoside
(1 m
M

); N-ethyl-maleimide-glutathione (0.1–4 m
M
;pre-
pared as described previously; [18]); LTC4 (0.1–1.6 l
M
);
17b-estradiol 17-(b-
D
-glucuronide) (10–75 l
M
).
Strikingly, the ATPase activity of GST- and MBP-NBD1
was stimulated by S-decyl glutathione: approximately
twofold at 250 l
M
of S-decyl-glutathione (Fig. 2). Up to
250 l
M
of S-decyl-glutathione, the stimulatory action
increased, whereas the stimulation decreased at higher
concentrations. At 1 m
M
of S-decyl-glutathione, the meas-
ured ATPase activity represented approximately the basal
ATPase activity. This type of behaviour was also observed
for the stimulatory effect of S-decyl-glutathione on the
ATPase activity of reconstituted MRP2 [17]. The effect was
Fig. 2. ATPase activity of GST–NBD1 and MBP–NBD1 is stimulated
by S-decyl-glutathione. GST–NBD1 (upward diagonally hatched bars)
orMBP–NBD1(blackbars)at2.5 l

M
was incubated with 7 m
M
ATP
and different concentrations of S-decyl-glutathione (A), decyl-malto-
side (B) or decanol (C) in 50 m
M
Tris/HCl, pH 7.5, 50 m
M
NaCl, and
50 m
M
MgCl
2
,for30minat37°C.TheATPaseactivitywasdeter-
mined as described in Materials and methods and calculated relative to
the activity measured in absence of surfactant. Error bars indicate
standard deviations. Each determination was performed at least twice.
Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3473
specific for S-decyl-glutathione as alkyl-glutathione conju-
gates of shorter chain length (ethyl-, propyl-, butyl-, hexyl-,
and octyl-glutathione) did not show a significant effect on
the ATPase activity at concentrations up to 1 m
M
.Asa
control, the effects of two molecules with a similar alkyl
chain were compared: decyl-maltoside and decanol
(Fig. 2B,C). Decyl-maltoside did not stimulate the ATPase
activity at lower concentrations, but induced a concentra-
tion-dependent stimulation at concentrations above

500 l
M
,atleastupto1m
M
(we did not measure at higher
concentrations). In contrast, decanol did not show any
stimulation, and caused a small, but significant and
concentration-dependent inhibition of the ATPase activity.
The ATPase activity of MBP–NBD2 was stimulated in
the same manner as MBP–NBD1, indicating that in this
respect there is no difference between the two NBDs.
Surprisingly, the MBP-fusion protein of the isolated NBD
of the bacterial multidrug transporter LmrA [39] also
showed a similar stimulation pattern (Fig. 3). LmrA is the
bacterial homologue of P-gp, and is not expected to bind or
transport glutathione-conjugates. In comparison, we have
measured the effect of S-decyl-glutathione on the ATPase
activity of MalK [40] and of GlcV, the ATP-binding subunit
of a glucose uptake system from the thermoacidophilic
Sulfolobus solfataricus [41]. In both cases, the ATPase
activity was slightly inhibited in a near-linear concentration-
dependent manner over the concentration range 0–0.5 m
M
of S-decyl-glutathione (data not shown). Thus, the ATPase
activity of these proteins is differently affected when
compared to the NBDs of MRP and LmrA.
In further analysis, the concentration of S-decyl-glutathi-
one, which optimally stimulates the ATPase activity of
MBP-NBD1 appeared to depend on the concentration
of MBP–NBD1. The optimum increases with increasing

MBP–NBD1 concentration: whereas at 1 l
M
of MBP–
NBD1 optimal stimulation is observed at 0.2 m
M
S-decyl-
glutathione, at 4 l
M
of MBP–NBD1, the optimal
stimulation is achieved at 0.3–0.4 m
M
of S-decyl-glutathi-
one (Fig. 4A). A similar concentration-dependence was
found for MBP–NBD2 and NBD1 (Fig. 4), even though
the optimal concentrations are shifted.
These results clearly demonstrate that we are not dealing
with a simple enzyme-substrate system. As the presence of
two allocrite-binding sites (a stimulatory high-affinity, and
an inhibitory low-affinity site) on a NBD is unlikely, we
reasoned that it could be a nonspecific, detergent-related
effect. As we were unable to find in the literature any
indications at which concentration S-decyl-glutathione
forms detergent micelles, this critical micelle concentration
was determined by taking advantage of the fact that the
fluorescence of 1,6-dihydro-1,2,3-hexatriene is greatly
Fig. 3. ATPase activity of MBP-LmrA-NBD is stimulated by S-decyl-
glutathione. MBP–LmrA–NBD at 2 l
M
was incubated with 5 m
M

ATP and different concentrations of S-decyl-glutathione in 50 m
M
Tris/HCl, pH 7.5, 50 m
M
NaCl, 10 m
M
MgCl
2
,and10m
M
dithio-
threitol, for 30 min at room temperature. The ATPase activity was
determined as described in Materials and methods and calculated
relative to the activity measured in absence of surfactant. Error bars
indicate standard deviations. Each determination was performed at
least twice.
Fig. 4. Concentration profile of the S-decyl-glutathione-stimulated
ATPase activity depends on the concentration of the nucleotide-binding
domain. Four different concentrations of (A) MBP–NBD1 (1, 2, 3,
4 l
M
), (B) MBP–NBD2 (1, 2, 3, 4 l
M
)or(C)NBD1(5,10,15,20l
M
)
in 50 m
M
Tris/HCl, pH 7.5, 50 m
M

NaCl, 10 m
M
MgCl
2
,and10m
M
dithiothreitol, were incubated with 1 m
M
ATP for 30 min at room
temperature. The ATPase activities were determined in presence of
S-decyl-glutathione as described in Materials and methods and
normalized to the activity found in absence of surfactant (100%). The
relative ATPase activities at the indicated concentrations of surfactant
are represented by columns with upward diagonally hatched, black,
horizontally hatched or downward diagonally hatched surface for
the activities at the lowest to highest concentration of the NBDs,
respectively. Each activity was measured at least twice. The bar
represents the standard deviation.
3474 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002
enhanced in hydrophobic environment, e.g. upon formation
of micelles. In Fig. 5, the fluorescence of 1,6-dihydro-1,2,3-
hexatriene in presence of different concentrations of
S-decyl-glutathione, decyl-maltoside and dodecyl-maltoside
are depicted. The increase of fluorescence starting at
approximately 0.15 m
M
of dodecyl-maltoside and the slight
increase starting at 1 m
M
of decyl-maltoside corresponds

with the critical micelle concentrations of these compounds,
respectively, 0.17 m
M
and 1.8 m
M
(values manufacturer).
The 1,6-dihydro-1,2,3-hexatriene-mediated fluorescence in
the presence of S-decyl-glutathione suggests that this
compound forms micelles already at low concentrations.
At the moment we cannot explain why the S-decyl-
glutathione-induced fluorescence shows a relative minimum
at approximately 0.8 m
M
of S-decyl-glutathione (Fig. 5B).
As micelle formation could affect the ATPase activity of
the NBD, we tested the effects of surfactants with different
critical micelle concentrations. The three surfactants un-
decyl-, dodecyl- and tridecyl-maltoside could stimulate the
ATPase activity of GST–NBD1 to a similar extent as
S-decyl-glutathione, butwith different concentration optima:
0.1–0.5, 0.05–0.2 and 0–0.1 m
M
, respectively (Fig. 6). These
values correspond reasonably well to the critical micelle con-
centrations of these compounds: 0.6, 0.12 and 0.024 m
M
,
respectively (values manufacturer). Similarly, Triton-X100
(critical micelle concentration value: 0.23 m
M

)stimulated
the ATPase activity of MBP-NBD2 in a similar fashion as
dodecyl-maltoside and S-decyl-glutathione (not shown).
Thus, the stimulatory effect of S-decyl-glutathione or other
surfactants on the ATPase activity of the MRP–NBDs
seems to be related to micelle formation and not to be a
specific, allocrite-mediated effect.
DISCUSSION
In this study, we show that the isolated nucleotide-binding
domains of human MRP1 display comparable ATPase
activities. The Michaelis–Menten constants K
m
and V
max
for the GST-fusion proteins of NBD1 and NBD2 are
340 l
M
and 6.0 nmol P
i
Æmg
)1
Æmin
)1
,and910l
M
and
7.5 nmol P
i
Æmg
)1

Æmin
)1
, respectively. These kinetic param-
eters are in the same range of those observed for the isolated
NBDs of the human MDR1 P-glycoprotein [42], the cystic
fibrosis transmembrane conductance regulator [43] and
prokaryotic ABC transporters [44]. Furthermore, these
results are in reasonable agreement with the results obtained
with the isolated NBDs of MRP1 comprising an N-terminal
His-tag [36], and to the values obtained with the reconsti-
tuted MRP1, isolated from insect cells [37] or human
tumour cells [38]. The similarity of the basal ATPase
activities of the two isolated domains does not seem to
correlate to the differences found in photo-affinity labelling
experiments with MRP1 using 8-azido-adenosine nucleo-
tides [45–47]. ATP labelling occurred preferentially at
NBD1, while ortho-vanadate-induced trapping of ADP
occurred predominantly at NBD2. However, such different
Fig. 6. Stimulation of the ATPase activity of GST–NBD1 by undecyl-,
dodecyl-, and tridecyl-maltoside. In a buffer of 50 m
M
Tris/HCl,
pH 7.5, 50 m
M
NaCl, 10 m
M
MgCl
2
,and10m
M

dithiothreitol, 1 l
M
of GST-NBD1 was incubated with 1 m
M
ATP in presence of different
concentrations of n-undecyl-b-
D
-maltoside (A; upward diagonally
hatched bars), n-dodecyl-b-
D
-maltoside (B; black bars) or n-tridecyl-
b-
D
-maltoside (C; downward diagonally hatched bars) for 30 min at
room temperature. ATPase activities were measured as described in
Materials and methods and represented as activities relative to the
activity measured in absence of the surfactants. Experiments were
performed at least in duplicate. Error bars indicate the standard
deviations.
Fig. 5. Detection of micelle formation by dodecyl-maltoside (A), decyl-
maltoside and S-decyl-glutathione (B). Different concentrations of
dodecyl-maltoside (A, d), decyl-maltoside (B; r)andS-decyl-gluta-
thione (B; j) were incubated with 5 l
M
1,6-dihydro-1,2,3-hexatriene
in 50 m
M
Tris/HCl,pH7.5,50m
M
NaCl, 10 m

M
MgCl
2
,and10m
M
dithiothreitol, for 3 h at room temperature. Thereafter, the fluores-
cence was determined using a 355-nm excitation wavelength and a
428-nm emission wavelength. For every measurement, the fluorescence
was followed for at least 5 min in order to assure a stable value.
Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3475
behaviour may result from different contacts within the full
length MRP1 of the NBD(s) with other domains and/or the
lipidic bilayer.
The hydrolysis of ATP by both NBDs of MRP1 was
dependent on divalent cations and was inhibited by ATPase
inhibitors, such as ortho-vanadate and azide. Our data
indicate that both NBDs of MRP1 are also able to
hydrolyze GTP. This result is consistent with previous
studies on full length MRP1 protein, which demonstrated
the hydrolysis of ATP and GTP by purified MRP1 [15], and
the dependence on these nucleotides of MRP1-mediated
drug transport in plasma membrane vesicles [5].
Frequently MBP-fusion proteins are more stable than
GST-fusion proteins, in line with the postulation that the
MBP-moiety functions as an intramolecular chaperone [48].
We could observe a similar effect for the NBDs of MRP1,
although the differences in solubility for the two types
of fusion proteins were not very large. The MBP-fusion
proteins however, appeared to be cleaved by thrombin less
efficiently than the GST-fusion proteins, most likely due to a

shielding effect of the MBP moiety. The nonfused NBD1
appeared to be stable, but to have an ATPase activity that is
one order of magnitude lower than that of the fused forms
of this domain. As yet, we have no satisfactory explanation
for this. A similar effect was observed for the NBD of P-gp,
which appeared to express a 100–1000-fold lower ATPase
activity as compared to P-gp full length. It was suggested
that NBDs may need to interact with the membrane-bound
domains (i.e. intracellular loops) to fold properly [23]. In
addition, differences in the N- and C-terminal boundaries of
subcloned NBDs seem to affect the solubility of the isolated
domains and may also influence the ATPase activity.
Indeed, preliminary data show significant differences in
basal ATPase activities of MBP-fused constructs of NBD1
of different length (not shown).
An important aspect of the mechanism, by which ABC
transporter proteins expel the allocrites from the cell, is how
the ATP hydrolysis is coupled to transport. Stimulation of
ATPase activity by allocrites has been used as an important
assay for the elucidation of this coupling. However, even
though the ATPase activity can be stimulated by some
allocrites, this stimulation is modest and not observed for all
allocrites. In addition, the many studies that have been
performed to reveal the drug-binding sites of MDR
transporters suggest that these binding sites are located in
the transmembrane segments. Indeed, whereas modulators
of transport activity, e.g. flavonoids, were shown to interact
with the NBDs P-gp or MRP proteins [49,50], no interac-
tions between allocrites and the NBDs of these transporters
were reported. In contrast, the oleandomycin ABC trans-

porter OleB from Streptomyces antibioticus was suggested to
have an allocrite-binding site located on the ATP-binding
domain [31]. Furthermore, the ATP-binding component of
the Escherichia coli ABC transporter KspTM involved in
the transport of polysialic acid, KpsT, was shown to co-
immunoprecipitate with the allocrite polysialic acid [32].
The latter examples encouraged us to measure the effects of
MRP-specific allocrites on the ATPase activity of the
isolated NBDs.
We have tested several MRP-specific allocrites in their
ability to stimulate the ATPase activity of NBD1. Most of
the tested compounds did not induce a significant stimula-
tion of the basal activity. Remarkably, however, the high
affinity-allocrite S-decyl-glutathione showed a stimulatory
effect, which was concentration dependent. An optimal
concentration was found around 100–300 l
M
, above which
concentration the stimulatory effect decreased to zero
(Fig. 2). This effect is very similar to that observed with
reconstituted MRP2: a 2.5-fold stimulation of the ATPase
activity was observed at 100 l
M
S-decyl-glutathione,
whereasnostimulationcouldbemeasuredat1m
M
[17].
However, additional experiments cautioned us to interpret
the observed effect as a demonstration of the presence of an
allocrite-binding site on NBD1. First, we could obtain a

similar stimulatory effect with NBD2, and with the NBD of
the bacterial transporter LmrA (Fig. 3) that is not supposed
to transport glutathione-conjugates. Secondly, we noticed
that the optimal stimulatory concentration of allocrite was
dependent on the concentration of NBD (Fig. 4). Taken
together, these results pointed at a possibly nonspecific
effect of S-decyl-glutathione.
As S-decyl-glutathione comprises an alkyl chain, it may
act as a surfactant. After having already determined that
S-decyl-glutathione is capable of forming micelles at low
concentrations (Fig. 5) we measured the effects of surfac-
tants with different critical micelle concentration values on
the ATPase activity of the NBDs (Fig. 6). It was found that
the stimulation of these compounds, which are not known
to be allocrites of MRP1, coincides with micelle formation.
Thus, the observed effect appears to be more surfactant-
related than allocrite-related.
The shift in optimal stimulatory concentration of allocrite
related to the NBD concentration can be rationalized by
assuming a direct interaction between surfactant molecules
and the protein, which would cause a decrease in free
concentration of surfactant and thereby a shift to a higher
critical micelle concentration value. Such an interaction was
suggested between P-gp and detergents [20].
It is tempting to speculate that the surfactant-dependent
stimulation may mimick the interaction between the NBD
and lipid bilayer. Indeed, the phospholipidic content of
biomembranes affects the basal and the drug-stimulated
ATPase activity of MRP1 [51] and P-gp [52], similar to the
effects on the ATPase activity of ABCR [53]. This is

supported by the close proximity of the NBDs of P-gp to the
membrane surface observed by spectroscopic measurements
[54,55] and electron microscopy [56], and by the recently
published crystal structure of the Escherichia coli ABC
transporter MsbA [57]. At this point we cannot explain the
decrease in stimulatory effect at higher concentrations of
surfactant. Further work is required to elucidate these
effects.
In conclusion, the NBDs of MRP1 show comparable
basal ATPase activities that can be stimulated by the
allocrite S-decyl-glutathione. We could show, however, that
this stimulation results not from an allocrite-specific effect,
but from surfactant-mediated micelle formation. Our results
strongly suggest that the stimulatory action of S-decyl-
glutathione on the ATPase activity should not be used as a
signal for specific interaction between MRP and allocrite.
ACKNOWLEDGEMENTS
This investigation was supported by grant RuG 96–1218 from the
Dutch Cancer Society and part of a joint GUIDE-GBB research
programme at the Groningen University. We would like to thank
3476 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Sarina van der Zee, Patrycja Golon and Sylwia Chocholska for
technical assistance. Furthermore we thank Piet Borst for the kind gift
of plasmid pJ3W, and Marjon Pasmooij, Sonja Albers and Heidi
Landmesser for purified LmrA-NBD, GlcV, and MalK, respectively.
H. W. v. V was a fellow of the Netherlands Academy of Art and
Sciences.
REFERENCES
1. Borst, P., Evers, R., Kool, M. & Wijnholds, J. (2000) A family of
drug transporters: the multidrug resistance-associated proteins.

J. Natl Cancer Inst. 92, 1295–1302.
2. Cole, S.P. & Deeley, R.G. (1998) Multidrug resistance mediated
by the ATP-binding cassette transporter protein MRP. Bioessays
20, 931–940.
3. Renes,J.,deVries,E.G.,Jansen,P.L.&Mu
¨
ller, M. (2000) The
(patho) physiological functions of the MRP family. Drug Resist.
Update 3, 289–302.
4. Keppler, D., Cui, Y., Ko
¨
nig,J.,Leier,I.&Nies,A.(1999)Export
pumps for anionic conjugates encoded by MRP genes. Adv.
Enzyme Regul. 39, 237–246.
5. Loe, D.W., Almquist, K.C., Deeley, R.G. & Cole, S.P. (1996)
Multidrug resistance protein (MRP)-mediated transport of leuko-
triene C4 and chemotherapeutic agents in membrane vesicles.
Demonstration of glutathione-dependent vincristine transport.
J. Biol. Chem. 271, 9675–9682.
6. Loe, D.W., Deeley, R.G. & Cole, S.P. (1998) Characterization of
vincristine transport by the M(r) 190 000 multidrug resistance
protein (MRP): evidence for cotransport with reduced gluta-
thione. Cancer Res. 58, 5130–5136.
7. Renes, J., de Vries, E.G., Nienhuis, E.F., Jansen, P.L. & Mu
¨
ller,
M. (1999) ATP- and glutathione-dependent transport of che-
motherapeutic drugs by the multidrug resistance protein MRP1.
Br. J. Pharmacol. 126, 681–688.
8.Holland,I.B.&Blight,M.A.(1999)ABC-ATPases,adaptable

energy generators fuelling transmembrane movement of a variety
of molecules in organisms from bacteria to humans. J. Mol. Biol.
293, 381–399.
9. Jones, P.M. & George, A.M. (1999) Subunit interactions in ABC
transporters: towards a functional architecture. FEMS Microbiol.
Lett. 179, 187–202.
10. Gottesman, M.M. & Pastan, I. (1993) Biochemistry of multidrug
resistance mediated by the multidrug transporter. Annu. Rev.
Biochem. 62, 385–427.
11. Ambudkar, S.V., Dey, S., Hrycyna, C.A., Ramachandra, M.,
Pastan, I. & Gottesman, M.M. (1999) Biochemical, cellular, and
pharmacological aspects of the multidrug transporter. Annu. Rev.
Pharmacol. Toxicol. 39, 361–398.
12. Urbatsch, I.L., al-Shawi, M.K. & Senior, A.E. (1994) Character-
ization of the ATPase activity of purified Chinese hamster
P-glycoprotein. Biochemistry 33, 7069–7076.
13. Litman, T., Zeuthen, T., Skovsgaard, T. & Stein, W.D. (1997)
Competitive, non-competitive and cooperative interactions
between substrates of P-glycoprotein as measured by its ATPase
activity. Biochim. Biophys. Acta 1361, 169–176.
14. Chang, X.B., Hou, Y.X. & Riordan, J.R. (1997) ATPase activity
of purified multidrug resistance-associated protein. J. Biol. Chem.
272, 30962–30968.
15. Chang, X.B., Hou, Y.X. & Riordan, J.R. (1998) Stimulation of
ATPase activity of purified multidrug resistance-associated pro-
tein by nucleoside diphosphates. J. Biol. Chem. 273, 23844–23848.
16.Pascaud,C.,Garrigos,M.&Orlowski,S.(1998)Multidrug
resistance transporter P-glycoprotein has distinct but interacting
binding sites for cytotoxic drugs and reversing agents. Biochem. J.
333, 351–358.

17. Hagmann,W.,Nies,A.T.,Konig,J.,Frey,M.,Zentgraf,H.&
Keppler, D. (1999) Purification of the human apical conjugate
export pump MRP2 reconstitution and functional characteriza-
tion as substrate-stimulated ATPase. Eur. J. Biochem. 265,
281–289.
18. Bakos,E.,Evers,R.,Sinko,E.,Varadi,A.,Borst,P.&Sarkadi,B.
(2000) Interactions of the human multidrug resistance proteins
MRP1 and MRP2 with organic anions. Mol. Pharmacol. 57,
760–768.
19. Ambudkar, S.V., Lelong, I.H., Zhang, J., Cardarelli, C.O.,
Gottesman, M.M. & Pastan, I. (1992) Partial purification and
reconstitution of the human multidrug-resistance pump: char-
acterization of the drug-stimulatable ATP hydrolysis. Proc. Natl
Acad.Sci.USA89, 8472–8476.
20. Orlowski, S., Mir, L.M., Belehradek, J. Jr & Garrigos, M. (1996)
Effects of steroids and verapamil on P-glycoprotein ATPase
activity: progesterone, deoxycorticosterone, corticosterone and
verapamil are mutually non-exclusive modulators. Biochem. J.
317, 515–522.
21.Martin,C.,Berridge,G.,Mistry,P.,Higgins,C.,Charlton,P.
& Callaghan, R. (2000) Drug binding sites on P-glycoprotein
are altered by ATP binding prior to nucleotide hydrolysis.
Biochemistry 39, 11901–11906.
22. Loo, T.W. & Clarke, D.M. (1999) Identification of residues in the
drug-binding domain of human P-glycoprotein. Analysis of
transmembrane segment 11 by cysteine-scanning mutagenesis and
inhibition by dibromobimane. J. Biol. Chem. 274, 35388–35392.
23. Sharom, F.J., Yu, X., Lu, P., Liu, R., Chu, J.W., Szabo, K.,
Mu
¨

ller, M., Hose, C.D., Monks, A., Varadi, A., Seprodi, J. &
Sarkadi, B. (1999) Interaction of the P-glycoprotein multidrug
transporter (MDR1) with high affinity peptide chemosensitizers in
isolated membranes, reconstituted systems, and intact cells.
Biochem. Pharmacol. 58, 571–586.
24. Stride, B.D., Cole, S.P. & Deeley, R.G. (1999) Localization of a
substrate specificity domain in the multidrug resistance protein.
J. Biol. Chem. 274, 22877–22883.
25. Ryu, S., Kawabe, T., Nada, S. & Yamaguchi, A. (2000) Identifi-
cation of basic residues involved in drug export function of human
multidrug resistance-associated protein 2. J. Biol. Chem. 275,
39617–39624.
26. Zhang, D.W., Cole, S.P. & Deeley, R.G. (2001) Identification of a
nonconserved amino acid residue in multidrug resistance protein 1
important for determining substrate specificity: evidence for
functional interaction between transmembrane helices 14 and 17.
J. Biol. Chem. 276, 34966–34974.
27. Zhang, D.W., Cole, S.P. & Deeley, R.G. (2001) Identification of
an amino acid residue in multidrug resistance protein 1 critical for
conferring resistance to anthracyclines. J. Biol. Chem. 276, 13231–
13239.
28. Loo, T.W. & Clarke, D.M. (2001) Defining the drug-binding site
in the human multidrug resistance P-glycoprotein using a methane-
thiosulfonate analog of verapamil, MTS-verapamil. J. Biol. Chem.
276, 14972–14979.
29. Ito, K., Suzuki, H. & Sugiyama, Y. (2001) Charged amino acids in
the transmembrane domains are involved in the determination of
the substrate specificity of rat Mrp2. Mol. Pharmacol. 59, 1077–
1085.
30. Ito, K., Olsen, S.L., Qiu, W., Deeley, R.G. & Cole, S.P. (2001)

Mutation of a single conserved tryptophan in multidrug resistance
protein 1 (MRP1/ABCC1) results in loss of drug resistance and
selective loss of organic anion transport. J. Biol. Chem. 276,
15616–15624.
31. Buche, A., Mendez, C. & Salas, J.A. (1997) Interaction between
ATP, oleandomycin and the OleB ATP-binding cassette trans-
porter of Streptomyces antibioticus involved in oleandomycin
secretion. Biochem. J. 321, 139–144.
32. Bliss, J.M. & Silver, R.P. (1997) Evidence that KpsT, the ATP-
binding component of an ATP-binding cassette transporter, is
exposed to the periplasm and associates with polymer during
Ó FEBS 2002 Nucleotide-binding domains of MRP1 (Eur. J. Biochem. 269) 3477
translocation of the polysialic acid capsule of Escherichia coli K1.
J. Bacteriol. 179, 1400–1403.
33. Wang, C., Castro, A.F., Wilkes, D.M. & Altenberg, G.A. (1999)
Expression and purification of the first nucleotide-binding domain
and linker region of human multidrug resistance gene product:
comparison of fusions to glutathione S-transferase, thioredoxin
and maltose-binding protein. Biochem. J. 338, 77–81.
34. Driessen, A.J., Brundage, L., Hendrick, J.P., Schiebel, E. &
Wickner, W. (1991) Preprotein translocase of Escherichia coli:
solubilization, purification, and reconstitution of the integral
membrane subunits SecY/E. Methods Cell. Biol. 34, 147–165.
35. Zhang, X., Jackson, J.K. & Burt, H.M. (1996) Determination of
surfactant critical micelle concentration by a novel fluorescence
depolarization technique. J. Biochem. Biophys. Meth. 31, 145–150.
36. Kern, A., Felfoldi, F., Sarkadi, B. & Varadi, A. (2000)
Expression and characterization of the N- and C-terminal
ATP-binding domains of MRP1. Biochem. Biophys. Res.
Commun. 273, 913–919.

37. Gao, M., Loe, D.W., Grant, C.E., Cole, S.P.C. & Deeley,
R.G. (1996) Reconstitution of ATP-dependent leukotriene C4
transport by co-expression of both half-molecules of human
multidrug resistance protein in insect cells. J. Biol. Chem. 271,
27782–27787.
38. Mao, Q., Leslie, E.M., Deeley, R.G. & Cole, S.P. (1999) ATPase
activity of purified and reconstituted multidrug resistance protein
MRP1 from drug-selected H69AR cells. Biochim. Biophys. Acta
1461, 69–82.
39. van Veen, H.W., Venema, K., Bolhuis, H., Oussenko, I., Kok, J.,
Poolman, B., Driessen, A.J. & Konings, W.N. (1996) Multidrug
resistance mediated by a bacterial homolog of the human multi-
drug transporter MDR1. Proc.NatlAcad.Sci.USA93, 10668–
10672.
40. Schmees, G., Stein, A., Hunke, S., Landmesser, H. & Schneider,
E. (1999) Functional consequences of mutations in the conserved
Ôsignature sequenceÕ of the ATP-binding-cassette protein MalK.
Eur. J. Biochem. 266, 420–430.
41. Albers, S.V., Elferink, M.G., Charlebois, R.L., Sensen, C.W.,
Driessen, A.J. & Konings, W.N. (1999) Glucose transport in the
extremely thermoacidophilic Sulfolobus solfataricus involves a
high-affinity membrane-integrated binding protein. J. Bacteriol.
181, 4285–4291.
42. Baubichon-Cortay,H.,Baggetto,L.G.,Dayan,G.&DiPietro,A.
(1994) Overexpression and purification of the carboxyl-terminal
nucleotide-binding domain from mouse P-glycoprotein. Strategic
location of a tryptophan residue. J. Biol. Chem. 269, 22983–22989.
43. Ko, Y.H., Thomas, P.J., Delannoy, M.R. & Pedersen, P.L. (1993)
The cystic fibrosis transmembrane conductance regulator. Over-
expression, purification, and characterization of wild type and

delta F508 mutant forms of the first nucleotide binding fold in
fusion with the maltose-binding protein. J. Biol. Chem. 268,
24330–24338.
44. Koronakis, V., Hughes, C. & Koronakis, E. (1993) ATPase ac-
tivity and ATP/ADP-induced conformational change in the sol-
uble domain of the bacterial protein translocator HlyB. Mol.
Microbiol. 8, 1163–1175.
45. Gao,M.,Cui,H.R.,Loe,D.W.,Grant,C.E.,Almquist,K.C.,
Cole, S.P. & Deeley, R.G. (2000) Comparison of the functional
characteristics of the nucleotide binding domains of multidrug
resistance protein 1. J. Biol. Chem. 275, 13098–13108.
46. Hou, Y., Cui, L., Riordan, J.R. & Chang, X. (2000) Allosteric
interactions between the two non-equivalent nucleotide binding
domains of multidrug resistance protein MRP1. J. Biol. Chem.
275, 20280–20287.
47. Nagata, K., Nishitani, M., Matsuo, M., Kioka, N., Amachi, T. &
Ueda, K. (2000) Nonequivalent nucleotide trapping in the two
nucleotide binding folds of the human multidrug resistance pro-
tein MRP1. J. Biol. Chem. 275, 17626–17630.
48. Kapust, R.B. & Waugh, D.S. (1999) Escherichia coli maltose-
binding protein is uncommonly effective at promoting the
solubility of polypeptides to which it is fused. Protein Sci. 8,
1668–1674.
49. Conseil, G., Baubichon-Cortay, H., Dayan, G., Jault, J.M.,
Barron, D. & Di Pietro, A. (1998) Flavonoids: a class of
modulators with bifunctional interactions at vicinal ATP- and
steroid-binding sites on mouse P-glycoprotein. Proc. Natl Acad.
Sci. USA 95, 9831–9836.
50. Perez-Victoria, J.M., Chiquero, M.J., Conseil, G., Dayan, G.,
Di Pietro, A., Barron, D., Castanys, S. & Gamarro, F. (1999)

Correlation between the affinity of flavonoids binding to the
cytosolic site of Leishmania tropica multidrug transporter and
their efficiency to revert parasite resistance to daunomycin.
Biochemistry 38, 1736–1743.
51. Hooijberg, J.H., Pinedo, H.M., Vrasdonk, C., Priebe, W.,
Lankelma, J. & Broxterman, H.J. (2000) The effect of glutathione
on the ATPase activity of MRP1 in its natural membranes. FEBS
Lett. 469, 47–51.
52. Di Pietro, A., Dayan, G., Conseil, G., Steinfels, E., Krell, T.,
Trompier, D., Baubichon-Cortay, H. & Jault, J. (1999) P-glyco-
protein-mediated resistance to chemotherapy in cancer cells: using
recombinant cytosolic domains to establish structure-function
relationships. Braz.J.Med.Biol.Res.32, 925–939.
53. Ahn, J., Wong, J.T. & Molday, R.S. (2000) The effect of lipid
environment and retinoids on the ATPase activity of ABCR, the
photoreceptor ABC transporter responsible for Stargardt macular
dystrophy. J. Biol. Chem. 275, 20399–20405.
54. Liu, R. & Sharom, F.J. (1998) Proximity of the nucleotide bind-
ing domains of the P-glycoprotein multidrug transporter to
the membrane surface: a resonance energy transfer study.
Biochemistry 37, 6503–6512.
55. Liu, R., Siemiarczuk, A. & Sharom, F.J. (2000) Intrinsic fluores-
cence of the P-glycoprotein multidrug transporter: sensitivity
of tryptophan residues to binding of drugs and nucleotides.
Biochemistry 39, 14927–14938.
56. Rosenberg, M.F., Callaghan, R., Ford, R.C. & Higgins, C.F.
(1997) Structure of the multidrug resistance P-glycoprotein to 2.5
nm resolution determined by electron microscopy and image
analysis. J. Biol. Chem. 272, 10685–10694.
57. Chang, G. & Roth, C.B. (2001) Structure of MsbA from E. coli:a

homolog of the multidrug resistance ATP binding cassette (ABC)
transporters. Science 293, 1793–1800.
3478 R. H. Cool et al.(Eur. J. Biochem. 269) Ó FEBS 2002