Báo cáo khoa học: Identification of mitogen-activated protein⁄extracellular signal-responsive kinase kinase 2 as a novel partner of the scaffolding protein human homolog of disc-large docx

Identification of mitogen-activated protein
⁄
extracellular
signal-responsive kinase kinase 2 as a novel partner of the
scaffolding protein human homolog of disc-large
Oumou Maı
¨
ga
1
, Monique Philippe
1
, Larissa Kotelevets
2
, Eric Chastre
2
, Samira Benadda
3
,
Dominique Pidard
1
, Roger Vranckx
1
and Laurence Walch
1
1 INSERM U698, Universite
´
Paris 7, France
2 INSERM U773, Centre de Recherche Biome
´
dicale Bichat Beaujon, Paris, France
3 Plateau de Microscopie Confocale ICB-IFR 02, Paris, France

Keywords
human disc-large homolog; human vascular
smooth muscle cells; MAPK ERK kinase 2;
scaffold protein; synapse-associated
protein 97
Correspondence
L. Walch, INSERM U698, Cardiovascular
Haematology, Bio-Engineering and
Remodelling, Bichat-Claude Bernard
Hospital, 46 rue Henri Huchard, F-75877,
Paris, Cedex 18, France
Fax: +33 1 40 25 86 02
Tel: +33 1 40 25 75 22
E-mail:
(Received 11 January 2011, revised 29 April
2011, accepted 20 May 2011)
doi:10.1111/j.1742-4658.2011.08192.x
Human disc-large homolog (hDlg), also known as synapse-associated
protein 97, is a scaffold protein, a member of the membrane-associated
guanylate kinase family, implicated in neuronal synapses and epithelial–
epithelial cell junctions whose expression and function remains poorly char-
acterized in most tissues, particularly in the vasculature. In human vascular
tissues, hDlg is highly expressed in smooth muscle cells (VSMCs). Using
the yeast two-hybrid system to screen a human aorta cDNA library, we
identified mitogen-activated protein ⁄ extracellular signal-responsive kinase
(ERK) kinase (MEK)2, a member of the ERK cascade, as an hDlg binding
partner. Site-directed mutagenesis showed a major involvement of the
PSD-95, disc-large, ZO-1 domain-2 of hDlg and the C-terminal sequence
RTAV of MEK2 in this interaction. Coimmunoprecipitation assays in both
human VSMCs and human embryonic kidney 293 cells, demonstrated that

endogenous hDlg physically interacts with MEK2 but not with MEK1.
Confocal microscopy suggested a colocalization of the two proteins at the
inner layer of the plasma membrane of confluent human embryonic kidney
293 cells, and in a perinuclear area in human VSMCs. Additionally, hDlg
also associates with the endoplasmic reticulum and microtubules in these
latter cells. Taken together, these findings allow us to hypothesize that
hDlg acts as a MEK2-specific scaffold protein for the ERK signaling path-
way, and may improve our understanding of how scaffold proteins, such
as hDlg, differentially tune MEK1 ⁄ MEK2 signaling and cell responses.
Structured digital abstract
l
hDlg and MEK2 colocalize by fluorescence microscopy (View Interaction 1, 2, 3)
l
hDlg physically interacts with MEK2 by two hybrid (View Interaction 1, 2, 3)
l
hDlg physically interacts with MEK2 by anti bait coimmunoprecipitation (View Interac-
tion
1, 2)
l
MEK2 physically interacts with hDlg by anti bait coimmunoprecipitation (View Interac-
tion
1, 2)
Abbreviations
CHO, Chinese hamster ovary; ERK, extracellular signal-responsive kinase; GK, guanylate kinase; hDlg, human disc-large homolog; HEK-293,
human embryonic kidney 293; hVSMC, human vascular smooth muscle cell; MAGUK, membrane-associated guanylate kinase; MAPK,
mitogen-activated protein kinase; MEK1 ⁄ 2, MAPK ERK kinase 1 ⁄ 2; PDZ, PSD-95, disc-large, ZO-1.
FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2655
Introduction
The mitogen-activated protein kinases (MAPKs) are a
family of S ⁄ T-protein kinases, including p38, c-Jun

N-terminal kinase and extracellular signal-responsive
kinase (ERK)1 ⁄ 2, which control several biological
processes such as proliferation, differentiation, survival
and apoptosis. The ERK signaling pathway includes
three major components that are activated in cascade
by phosphorylation. Raf phosphorylates two serine
residues in the activation loop of mitogen-activated
protein ⁄ ERK kinase (MEK)1 ⁄ 2. MEK 1 ⁄ 2 phosphory-
lates ERK1 ⁄ 2 on both the threonine and tyrosine resi-
dues in the conserved TEY sequence [1] and activated
ERK phosphorylates the serine or threonine residues
on the S ⁄ T-P consensus site in more than 100 nuclear,
cytosolic or membrane substrates with diverse func-
tions [2]. The outcomes of ERK activation are as vari-
ous as the ERK substrates, and so an accurate
regulation of the ERK signaling pathway is necessary.
This pathway is under the control of different regula-
tory elements such as phosphatases, docking domains
and scaffold proteins [2–4]. Docking domains are
consensus sequences that MAPK recognize both on
their substrates, as well as on relevant down-regulating
phosphatases and scaffold proteins [4]. The latter can
be divided into two categories [2]. Upstream scaffold
proteins interact with at least one MAPK implicated
in ERK activation to facilitate a functional interaction
and regulate the localization and the duration of the
signal. For example, the MEK partner 1 directs the
ERK cascade to the surface of the late endosomes [5].
Downstream scaffold proteins bind ERK and direct it
to specific substrates. For example, the phosphoprotein

enriched in astrocyte-15 binds ERK1 ⁄ 2 and ribosomal
protein S6 kinase 2, a direct substrate of ERK, thereby
enhancing the activation of this latter kinase [6].
Human disc-large homolog (hDlg) is a member of
the membrane-associated guanylate kinase (MAGUK)
scaffold protein family [7]. Interaction with MAGUK
permits the formation of multiprotein complexes, sta-
ble subcellular localizations of interacting partners and
the coordination of their activities. MAGUK contain a
number of protein–protein interaction domains, such
as PSD-95, disc-large, ZO-1 (PDZ), Src-homology 3
and guanylate kinase (GK) domains. In particular,
PDZ domains contain a specific GLGF sequence that
constitutes a hydrophobic cavity where the X-S ⁄ T-X-
V ⁄ L C-terminal motif of their target proteins binds [8].
hDlg expression has been established in a variety of
cells, including neurons, astrocytes, epithelial cells and
T lymphocytes, where hDlg interacts with cytoskeleton
proteins, ion channels, receptors or signaling proteins,
such as kinases. The association of hDlg with kinases
allows the orchestration of cell-specific signaling path-
ways. For example, hDlg ⁄ p38 association coordinates
T cell receptor signaling in T lymphocytes, whereas
hDlg recruits phosphatidylinositol 3-kinase to E-cadh-
erin complexes, allowing integrity of the adherent junc-
tion in epithelial cells [9,10]. It should be noted that
there has been no demonstration to date showing that
MAGUK are implicated in the ERK cascade.
Little is known about the role of hDlg in the cardio-
vascular system. Previous studies have shown that

hDlg is expressed in the myocardium where it can form
complexes with K
+
channels such as the inwardly-rec-
tifying K
+
channel 2.2 or the voltage-gated K
+
chan-
nel, allowing functional channel clustering and an
enhancement of the K
+
current [11–13]. However, the
putative expression and functions of hDlg remain to be
established in vascular tissues. To gain insight into
hDlg expression and specific functions in human vascu-
lar tissues, we examined hDlg expression in human
arteries and, more particularly, in human vascular
smooth muscle cells (hVSMCs), and searched for PDZ
domain-dependent binding partners. A screening of a
human aorta cDNA library by the yeast two-hybrid
assay allowed us to identify MEK2 as a new potential
binding partner for hDlg. This interaction was then
validated by biochemical procedures, including coim-
munoprecipitation and confocal immunomicroscopy
colabeling using cultured hVSMCs, as well as Chinese
hamster ovary (CHO) and human embryonic kidney
293 (HEK-293) cells as models.
Results
hDlg protein is present in hVSMCs

As shown in Fig. 1A, immunohistochemical labeling of
hDlg carried out on sections of nonpathological
human mammary arteries revealed that, among the
arterial tissue layers, the media specifically exhibited a
strong staining. Because VSMCs are the only cell type
found in the healthy arterial media, hDlg expression
and subcellular localization were then investigated in
cultured primary hVSMCs. Immunoblot analysis of
total or subcellular protein extracts prepared from con-
fluent hVSMCs identified the presence of two molecu-
lar immunoreactive species both in the total extract
and in the membrane fraction (Fig. 1B), whereas they
were absent in the cytosolic fraction. Taken together,
these data suggest that hDlg is associated with
membrane components. By immunofluorescent labeling
hDlg in ERK cascade O. Maı
¨
ga et al.
2656 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS
coupled with confocal microscopy, hDlg was observed
to be widely distributed within the cytoplasm of
hVSMCs (Fig. 1C–E). Costaining with various orga-
nelle markers showed that hDlg partially colocalized
with endoplasmic reticulum-associated calreticulin
(Fig. 1C), with Golgi-associated GM130 (Fig. 1D) and
with tubulin at the cell periphery, as well as in the
cytoplasm (Fig. 1E), and locally with cortical F-actin
(Fig. 1F). Taken together, these data suggest that hDlg
is mainly associated with internal membrane structures
and with the cytoskeleton in hVSMCs.

Two hDlg isoforms are expressed in human
arteries
hDlg mRNAs are known to contain three regions that
encompass alternatively spliced exons (Fig. 2A), lead-
ing to several hDlg isoforms [14,15]. To further charac-
terize hDlg isoforms expressed in hVSMCs, primer
pairs were chosen within the exons that surround the
region of alternative splicing (Fig. 2A) and RT-PCR
experiments were carried out on human de-endothelial-
ized pulmonary arterial RNA extracts (Fig. 2B–D),
latoT
lo
s
oty
C
senarb
m
e
M
Ct
200 µm
hDlg
BA
C
D
E
F
hDlg
N-cadherin
RSK

Fig. 1. Detection of hDlg in hVSMCs. (A)
Serial frozen sections of human mammary
artery were stained with monoclonal hDlg
antibody or an irrelevant mouse IgG
1
(Ct).
(B) Total hVSMC lysate, or a lysate fraction-
ated into membrane-associated and cyto-
solic proteins, was submitted to western
blot detection of hDlg and the fraction
markers N-cadherin and ribosomal S6 kinase
(RSK). (C–F) Cultured hVSMCs were stained
for hDlg (green signal) and, as a red signal,
(C) calreticulin, an endoplasmic reticulum
marker, (D) GM130, a Golgi marker, (E)
tubulin or (F) F-actin. Cells were analyzed by
confocal microscopy; colocalization (overlay)
appears in yellow and is indicated by white
arrowheads.
O. Maı
¨
ga et al. hDlg in ERK cascade
FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2657
followed by amplification product sequencing (Fig. S1).
Taken together, the results allow us to conclude that the
larger form of hDlg expressed in hVSMCs corresponds
to the I1A–I1B and I3–I5 insertions, whereas the shorter
form contains I1B and I3–I5 insertions. Both isoforms
contain a Lin-2,-7 domain.
hDlg interacts with MEK2 as assessed by the

yeast two-hybrid system
We then sought to identify hDlg interacting partners
in hVSMCs. Accordingly, we used a vector encoding
the hDlg PDZ1 and PDZ2 domains as bait in a yeast
two-hybrid screening assay of a human aorta cDNA
library. Interestingly, two independent clones were
identified as containing the C-terminal region of the
human MEK2 cDNA. To analyze in more detail the
interacting sites within hDlg and MEK2, mutant deriv-
atives of PGKBT7-PDZ-1-2 and pACT2-MEK2 were
constructed. On the one hand, the conserved GLGF
sequences present in the PDZ1 and PDZ2 domains
were mutated to the positively charged inactive GRRF
sequence [16]. On the other hand, the C-terminal
RTAV putative PDZ-binding motif of MEK2 was
either mutated to RAAV, or deleted. The expression
levels of the mutated forms and of their wild-type
counterparts were similar in yeasts (Fig. 3B, D). These
data suggest that the PDZ1 and PDZ2 domains of
hDlg are separately able to interact with the C-termi-
nus of MEK2, even though the interaction implicating
PDZ2 is stronger, whereas the PDZ3 domain shows
no interaction. Coexpression of the MEK2 mutant
forms with wild-type PDZ-1-2 abolished yeast growth
(Fig. 3C), demonstrating the crucial involvement of the
MEK2 C-terminus in the interaction. Taken together,
these results indicate that the PDZ2 domain of hDlg
and the C-terminal RTAV sequence of MEK2 are
required for the optimal interaction of the two protein
partners.

Coimmunoprecipitation of endogenous hDlg and
MEK2 proteins
To determine whether endogenous hDlg and MEK2
physically interact, coimmunoprecipitation assays were
carried out in HEK-293 (used as a cell model) and in
confluent hVSMC cell lysates. The specific hDlg anti-
body was able to coimmunoprecipate MEK2 from
HEK-293 (Fig. 4A) and hVSMC (Fig. 4C) cell lysates,
whereas, reciprocally, the specific MEK2 antibody
coimmunoprecipitated hDlg from both cell lysates
(Fig. 4B, D). hDlg and MEK2 were not (or minimally)
detectable after immunoprecipitation with irrelevant
antibodies. These results suggest that the hDlg iso-
forms expressed endogenously in HEK-293 cells or in
confluent hVSMCs can physically interact with MEK2,
even though only a small fraction of MEK2 is coim-
munoprecipitated with hDlg, as shown by the large
β1
β3β2 α1 2 Ι1Α Ι1Β 3
//
12 13 Ι3 Ι2 Ι5 Ι4 14 15
//
L27A
BC
DE
CXC PDZ1 SH3
GUK
//////
19
//

Primers 1
Primers 2
Primers 3
bp
600
500
Primers 1
Primers 3
Primers 2
Primers GAPDH
132
bp
400
300
312
400
300
132
300
200
312
Fig. 2. Two hDlg isoforms predominate in human arterial tissues. (A) Schematic representation of the hDlg genomic structure. Open boxes
represent constitutive exons and gray boxes indicate alternatively spliced exons. Three b exons encode an Lin-2,-7 domain (b isoform) and
one a exon a cystein doublet (a isoform). Various combinations of two (I1A and I1B) or four (I2–I5) insertions were described as being tran-
scribed in a tissue-specific manner. Arrows show the relative position of the primer pairs used for RT-PCR. (B–E) Transcripts obtained by
RT-PCR, using (B) primer pair 1, (C) primer pair 2, (D) primer pair 3 or (E) primers directed against GAPDH, on mRNAs extracted from three
different pulmonary artery samples.
hDlg in ERK cascade O. Maı
¨
ga et al.

2658 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS
amount of MEK2 remaining after hDlg precipitation
in hVSMCs (Fig. S2A). Subsequently, the ability of
hDlg to interact with other members of the ERK cas-
cade was tested. Under our experimental conditions,
the hDlg antibody was unable to coimmunoprecipate
MEK1, Raf or ERK1 ⁄ 2 proteins from hVSMCs
(Fig. S2B).
Colocalization of hDlg and MEK2
The localization of transfected full-length EGFP-hDlg
and human HA-MEK2 in CHO cells was assessed by
confocal immunofluorescence microscopy. EGFP-hDlg
and HA-MEK2 exhibited a diffuse staining with an
occasional patchy appearance and both types of label-
ing partially colocalized in these patches, suggesting
the presence of aggregates (Fig. 5A). In addition, the
localization of endogenous hDlg and MEK2 was
assessed in HEK-293 cells and in hVSMCs. In HEK-
293 cells, hDlg exhibited a general diffuse staining,
although this appeared to be stronger in the region of
the plasma membrane. MEK2 appeared to be more
homogenously distributed in the cytoplasm, although
the two stains overlapped significantly at cell–cell
junctions (Fig. 5B). In hVSMCs, both hDlg and
MEK2 exhibited a diffuse staining, although overlay
revealed a colocalization of the two proteins at some
perinuclear location (Fig. 5C). Taken together, these
results suggest that either transfected or endogenous
hDlg and MEK2 partially colocalize in mammalian
cells.

Discussion
In the present study, we show, for the first time, the
expression of hDlg in the human vascular cell popu-
lation, which is the most abundant in arterial wall
tissue (i.e. the hVSMCs). This protein exists in the
form of two immunoreactive species in membrane
fractions. Subcellular localization experiments suggest
that, in hVSMCs, this MAGUK is mainly associated
with the endoplasmic reticulum, as well as with the
PDZ-1-2
PDZ-1mut-2
PDZ-1-2mut
PDZ3
Media
SD-LT
SD-LT
SD-LT + X-α-gal
RTAV
RAAV
Del
RTAV
RAAV
Del
Ct
50
37
50
Myc
AD
GAPDH

50
AB
CD
Ct
PDZ-1-2
PDZ-1mut-2
PDZ-1-2mu
t
PDZ3
WB
Myc
AD
kDa
50
37
25
50
GAPDH
50
SD-LT + X-α-gal
Fig. 3. The PDZ2 domain of hDlg strongly interacts with the C-terminal sequence RTAV of MEK2. (A, C) Interactions were analyzed by a
yeast two-hybrid assay. (A) The PDZ-1–2 domains of hDlg, either wild-type or mutated on the GLGF sequence in either the PDZ1 domain
(PDZ-1mut-2) or the PDZ2 domain (PDZ-1-2mut), or the hDlg PDZ3 domain, all fused to the GAL4 DNA-binding domain, were co-expressed
in yeasts with the C-terminus of MEK2 fused to the GAL4 activating domain. (C) The PDZ-1-2 domains of hDlg fused to the GAL4 DNA-bind-
ing domain were co-expressed in yeasts with the C-terminus of MEK2, encompassing the PDZ binding sequence, which was intact (RTAV),
replaced by an irrelevant sequence (RAAV), or deleted (Del), all fused to the GAL4 activating domain. Yeasts were grown on two selection
media: SD-LT that selects double transformants, and SD-LTHA + X-a-gal that selects protein–protein interactions with high stringency.
Yeasts grow and turn blue when GAL-4-responsive genes, which encode galactodidases, are activated. (B, D). Western blotting of fusion
protein expression: hDlg PDZ domains fused to the Myc-tagged GAL4 DNA-binding domain were detected by Myc antibody (Myc), and
MEK2 C-terminus fused to the GAL4 activation domain was detected using GAL4 activation domain antibody (AD). Nontransfected yeast

protein extracts were used as control (Ct) and GAPDH detection as a loading control.
O. Maı
¨
ga et al. hDlg in ERK cascade
FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2659
microtubular network located both in the cytoplasm
and at the cell periphery. hDlg has been previously
shown to be associated with the endoplasmic reticu-
lum in cultured neurons [17–20], where hDlg is impli-
cated in the trafficking of newly-synthesized
receptors, AMPAR and NMDAR, and voltage-gated
K
+
channel 4.2 from the reticulum to the plasma
membrane. The interaction of hDlg and various
microtubule-associated proteins, such as adenomatous
polyposis coli, and the motor proteins kinesin and
dynein, has also been previously highlighted in
different cell types [19,21,22]. In this context, hDlg
controls intracellular trafficking and cell polarity dur-
ing oriented migration.
Previews studies performed on various tissues out-
side the vascular system, including the brain, liver and
heart, have initially revealed the existence of several
isoforms of the hDlg protein, containing various com-
binations of alternatively spliced insertions: I1A, I1B,
I2, I3, I4 and I5 [15,23]. More recently, two additional
alternative motifs located in the N-terminal region of
hDlg have been described, defining the a and b iso-
forms [14]. A CXC motif is present in the a isoform,

with both cysteines being potentially palmitoylated,
and thus conferring membrane targeting to the protein.
The b isoform contains a Lin-2,-7 domain that allows
dimerization or interaction with other partners [24].
We found that the two isoforms of hDlg expressed
in hVSMCs are b-I1A-I1B-I3-I5 and b-I1B-I3-I5.
Indeed, Godreau et al. [25] have described the presence
of two hDlg isoforms expressed in the human atrial
myocardium.
To date, the I1A and I1B insertions are known to
form a src-homology 3 binding domain that may, for
example, modulate hDlg self-association, whereas the
I3 insertion may direct hDlg to the plasma membrane-
associated actin cytoskeleton, particularly through
interaction with protein 4.1 [15,23,26,27]. The presence
of an I3 insertion in both hDlg isoforms detected in
hVSMCs is thus in agreement with our findings
indicating that this scaffold protein partly colocalizes
with F-actin at the cell periphery. To our knowledge,
the potential function(s) of the I5 insertion have not
yet been investigated.
A salient finding of the present study concerns the
direct interaction of hDlg with MEK2. Using the
PDZ-1-2 domains of hDlg as bait in a yeast two-
hybrid screening assay, we identified the MAPK
MEK2 as a potential, yet unrecognized, interacting
partner of hDlg in human aorta. PDZ domains are
known to associate with a C-terminally-located
X-S ⁄ T-X-L ⁄ V motif in their target proteins [8]. On
the basis of site-directed mutagenesis of both interac-

tants, we confirmed the major involvement of the
PDZ-2 domain of hDlg in the interaction with the
C-terminal sequence RTAV of MEK2. Furthermore,
we observed that hDlg and human MEK2 ectopically
expressed in CHO cells partially colocalize in the
cytoplasm, thus supporting a direct interaction of the
two proteins. This interaction was further observed in
HEK-293 cells and confluent hVSMCs through coim-
munoprecipitation assays performed on endogenous
proteins. We conducted a phylogenic analysis of the
MEK1 and MEK2 amino acid sequence using the
Entrez Protein database ( />protein), which revealed a conservation of the MEK2
C-terminal sequence RTAV among mammalian
species (human, mouse, rat, cow), thus providing evi-
dence of an important role for this sequence in
MEK2 functions. By contrast, the C-terminal
sequence of MEK1 (i.e. AAGV) does not correspond
to the PDZ consensus target pattern. The results show
that MEK2 coimmunoprecipitated with hDlg, whereas
MEK1 did not. Taken together, these data suggest
that the hDlg interaction with MEK2 implicates a
functional difference between the two kinases, MEK1
and MEK2.
Finally, we raised the hypothesis that hDlg is an
upstream, MEK2-specific scaffold protein for the ERK
150
100
50
37
hDlg

MEK2
150
100
50
37
hDlg
MEK2
Lysate
IP: hDlg
IP: IgG1
kDa WB
150
100
hDlg
50
37
MEK2
150
100
hDlg
Lysate
IP: MEK2
IP: IgG
kDa WB
50
37
MEK2
AB
CD
Fig. 4. Coimmunoprecipitation of endogenous hDlg and MEK2 pro-

teins in human cells. Lysates derived from either HEK-293 cells (A,
B) or hVSMCs (C, D) were immunoprecipitated using monoclonal
hDlg antibody (A, C), polyclonal MEK2 antibody (B, D) or a control
IgG. Lysates and immunoprecipitates were subjected to western
blotting with hDlg- or MEK2-specific antibodies. An experiment
representative of three independent ones is shown in each panel.
hDlg in ERK cascade O. Maı
¨
ga et al.
2660 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS
signaling pathway. Zhang et al. [28] have previously
shown that membrane-associated GK-3, a PDZ
domain-containing protein, facilitates lysophosphatidic
acid-induced ERK activation by an unknown mecha-
nism [28]. To date, ERK is the only known substrate
for MEK2 and, according to this function, MEK2 is
known to be part of various protein complexes, includ-
ing Raf, ERK and scaffold proteins, that stabilize the
interaction between the ERK cascade members, direct
the complexes to proper subcellular localization, and
control signal duration [1]. Under conditions that
allow hDlg and MEK2 coimmunoprecipitation, Raf1
and ERK were not pulled down with hDlg in
hVSMCs. Nevertheless, a bioinformatics analysis of
the hDlg amino acid sequence, using a motif scanning
software (), revealed the
presence of one potential ERK1 ⁄ 2 D-docking domain
of medium stringency, KRLQIAQLYPISIFI (con-
served amino acids are indicated in bold) [29] located
in the GK domain of hDlg, suggesting that an

hDlg ⁄ ERK interaction may still be expected. The
highly dynamic nature of D-domain and ERK1 ⁄ 2
interaction may explain why coimmunoprecipitation
assays failed to detect any hDlg-ERK1 ⁄ 2 interaction
under our experimental conditions. No docking site
for ERK and FXFP domain, the other well known
docking-domain for ERK, was found in the hDlg
sequence using the same software. To more precisely
delineate the location of hDlg in the ERK signaling
pathway, it will be necessary to identify other members
of the hDlg ⁄ MEK2 complex.
In conclusion, in the present study, we report a pre-
viously unidentified interaction between the hDlg scaf-
fold protein and MEK2, a member of the major ERK
signaling pathway, in various human cell types, includ-
ing hVSMCs. A number of studies have established
the involvement of ERK activation in hVSMC migra-
tion and proliferation, as well as in neointimal forma-
tion in a model of balloon arterial injury in rats
[30,31]. Alternatively, the ERK pathway has been
recently implicated in the early secretory pathway in
HeLa cells [32]. It is of note that, during atherosclero-
sis, hVSMCs adopt an active synthetic phenotype [33].
Because hDlg and MEK2 colocalize in the perinuclear
area of hVSMCs, and hDlg is associated with the
endoplamic reticulum and microtubules, hDlg and
MEK2 may together regulate the trafficking of newly-
synthesized proteins to the cell periphery. Therefore,
a better understanding of the role played by hDlg
and MEK2 could lead to an improvement of our

knowledge about critical signaling events in hVSMC
pathophysiology.
A
B
C
hDlg MEK2 Overlay
10 μm
10 μm
10 μm
Fig. 5. Transfected and endogenous hDlg
and MEK2 colocalize in mammalian cells.
(A) CHO cells were cotransfected to
express EGFP-hDlg (green signal) and
HA-MEK2 (red signal). (B) Confluent
HEK-293 cells and (C) subconfluent hVSMCs
were stained for endogenous hDlg (green)
and MEK2 (red). The colocalization (overlay)
was analyzed by confocal microscopy.
O. Maı
¨
ga et al. hDlg in ERK cascade
FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2661
Materials and methods
Antibodies
The antibodies used were: anti-Dlg (sc-9961) from Santa
Cruz Biotechnology (Santa Cruz, CA, USA); anti-MEK2
(ab32517), anti-MEK1 (ab32091), anti-Raf1 (ab18761), an-
ticalreticulin (ab2907), anti-GM130 (ab52649), anti-RSK1
p90 (ab32114), anti-N-cadherin (ab18203) and anti-GAP-
DH (ab9485) from Abcam (Cambridge, MA, USA); anti-

MEK2 (610236) from BD Biosciences (Franklin Lakes, NJ,
USA); anti-a ⁄ b-tubulin (2148), anti-Myc-Tag (2278) and
anti-p44 ⁄ 42 MAPK (4695) from Cell Signaling Technology
(Beverly, MA, USA); anti-GAL4 activating domain
(630402) from Clontech (Palo Alto, CA, USA); anti-HA.11
(MMS-101R) from Covance (Princeton, NJ, USA); peroxi-
dase-conjugated affiniPure goat anti-(rabbit IgG) (111-035-
144) and anti-(mouse IgG) (115-035-146) from Jackson Im-
munoResearch (West Grove, PA, USA); Mouse TrueBlot
Ò
ULTRA: anti-mouse Ig HRP from eBioscience (Carlsbad,
CA, USA); and Alexa Fluor
Ò
488 goat anti-mouse IgG
highly cross-adsorbed (A11029) and Alexa Fluor
Ò
555 goat
anti-rabbit IgG highly cross-adsorbed (A21429) from Invi-
trogen (Carlsbad, CA, USA).
RT-PCR assay
Total mRNAs from de-endothelialized human pulmonary
artery segments were extracted in accordance with a method
described previously [34]. To evaluate which hDlg isoforms
are expressed in the arterial media, cDNAs were submitted
to PCR using the Platinium
Ò
Taq DNA High Fidelity Poly-
merase (Invitrogen) and specific primers: primers 1, forward:
5¢-GATCTGGTGTAGGCGAGGTCACG-3¢ and reverse:
5¢-GTGGGGAAATATGCTCTTGAGGAGGT-3¢; primers

2, forward: 5¢-GTGACTTCAGAGACACTGCCA-3¢, and
reverse: 5¢-CCCTTTCAAGTGTGATTTCTTC3¢; primers
3, forw ard: 5¢-ACCAGATG GTGAGAG CGAT-3 ¢, and reverse:
5¢-CTGTCTTTCATAGGTCCCAAT-3¢. The RT-PCR
products were sequenced (GATC Biotech, Konstanz, Germany).
Expression vectors, cDNA library and
site-directed mutagenesis
cDNAs derived from human mammary arteries were ampli-
fied by RT-PCR using Platinium
Ò
Taq DNA High Fidelity
Polymerase (Invitrogen) and the primers: PDZ-1-2, forward:
5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and
reverse: 5¢GGATCCCCATCATTCATATACATACTTGT
GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA
TGATGAAATTACAAGGG-3¢, and reverse: 5¢GGATCCA
TTCTTCAGGTCGATATTGTGCAAC-3¢. PCR products
were subcloned by TA-cloning in the PCR2 vector (Invitro-
gen). Inserts were digested by EcoR1 and BamH1 (New
England Biolabs, Beverly, MA, USA) and introduced into
the pGKBT7 vector (Clontech) and sequenced (GATC Bio-
tech). The pACT2-MEK2 vector that encodes the 179–400
amino acid sequence of the MEK2 C-terminus resulted from
the Human Aorta MATCHMAKER cDNA Library (Clon-
tech). To create inactive PDZ domains within the PDZ-1–2
domains, the conserved residues GLGF were mutated to
GRRF; similarly, the putative PDZ target sequence, RTAV
in the C-terminus of MEK2 was deleted or mutated to
RAAV. Mutagenesis was performed by PCR using the
QuickChange

Ò
II Site-Directed Mutagenesis Kit (Strata-
gene, La Jolla, CA, USA) in accordance with the manufac-
turer’s instructions. The sens mutagenic primers were:
GRRF-PDZ1: 5¢GAAAGGGGAAATTCAGGGCGTCGT
TTCAGCATTGCAGGAGG-3¢; GRRF-PDZ2: 5¢-ATTA
AAGGTCCTAAAGGTCGTCGGTTTAGCATTGCTGGA
GG-3¢; RAAV-MEK2: 5¢-CACCCACGCGCGCCGCCGT
GTGA-3¢ and RTAV-deleted-MEK2: 5¢-CCCGGCACAC
CCTAGCGCACCGCCGT-3¢. The resulting plasmids were
sequenced.
The pEGFPC1-hDlg (b isoform containing the I1B, I3
and I5 insertions) and the pMCL-HA-MEK2 vectors
encoding the full-length tagged proteins EGFP-hDlg and
HAMEK2 were generous gifts from F. Peiretti (INSERM
U626, Marseille, France) [35] and N. Ahn (University of
Colorado, Boulder, CO, USA) [36], respectively.
Yeast two-hybrid screening and yeast protein
extraction
The yeast reporter strain AH109 was cotransformed by the
Human Aorta MATCHMAKER cDNA Library plasmids
(Clontech) and the pGKBT7-PDZ-1-2 vector in accordance
with the manufacturer’s instructions (Matchmaker Two-
Hybrid System 3; Clontech). Bait and library fusion protein
interactions were selected by plating the yeasts on a histidine-
, adenine-, leucine- and tryptophan-free medium (SD-LTHA)
supplemented with X-a-GAL. cDNA clones from positives
colonies were isolated using the Yeast Plasmid Isolation Kit
from Clontech, used to transform Escherichia coli DH5a
bacteria (Invitrogen) and identified by DNA sequencing

(GATC Biotech). Yeast proteins were extracted in accor-
dance with the urea ⁄ SDS method according to the Match-
Maker II procedure (Clontech). Protein concentration was
evaluated in each sample by measuring A
280
considering that
a1mgÆmL
)1
protein solution has an A
280
of 0.66. Finally,
60 lg of proteins were submitted to western blotting.
Cell cultures and transient transfections
Cells were cultured in an incubator at 37 °C with 5% CO
2
.
CHO and HEK-293 cells were maintained with Ham’s F-12
and DMEM high glucose medium (Invitrogen), respec-
tively, supplemented with 10% fetal bovine serum (PAA
Laboratories, Pasching, Austria) and the antibiotic cocktail
(PAA Laboratories): penicillin (5 UÆmL
)1
), streptomycin
hDlg in ERK cascade O. Maı
¨
ga et al.
2662 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS
(0.5 lgÆmL
)1
) and amphotericin B (25 ngÆmL

)1
). CHO
cells were transfected with the pEGFPC1-hDlg and the
pMCL-HA-MEK2 vectors using Fugene reagent (Roche
Diagnostics, Basel, Switzerland) in accordance with the
manufacturer’s instructions. Human lung tissues were
obtained from patients who had undergone surgery for lung
carcinoma at Bichat Hospital (Paris, France). Segments of
pulmonary artery were dissected from macroscopically nor-
mal regions of the diseased lungs and arterial media sam-
ples were digested with 0.3% (w ⁄ v) collagenase (Sigma,
St Louis, MO, USA) and 0.05% (w ⁄ v) pancreatic elastase
(Sigma) for 2 h at 37 °C. Isolated hVSMCs were cultured
in Smooth Muscle Cell Basal medium 2 (Promocell, Heidel-
berg, Germany) supplemented with the Smooth Muscle
Cells Growth Medium 2 kit (Promocell) and the antibiotic
cocktail. Human internal mammary arteries were obtained
from patients undergoing coronary bypass surgery in the
Department of Cardiovascular Surgery at Bichat Hospital.
All experiments involving the use of human tissues and cells
were approved by the INSERM Ethics Committee, in con-
formity with Helsinki standards, with these tissues being
considered as surgical waste in accordance with French
Ethical Laws (L.1211-3-L.1211-9). Written consent was
obtained from each patient.
Cell lysate fractionation
Arterial pulmonary hVSMCs were lysed in 2 mL of
10 mm Tris-HCl, 150 mm NaCl, 5 mm EDTA (pH 7.4)
supplemented with Protease Inhibitor Cocktail (P8340)
(Sigma) by two freeze ⁄ thaw cycles. Lysates were preclari-

fied by centrifugation at 800 g for 15 min at 4 °C. Half
the volume (1 mL) was kept as total lysate, whereas the
other half was submitted to an ultracentrifugation
(105 000 g) for 1 h at 4 °C. The resulting pellets (mem-
brane fraction) were resuspended in 1 mL of lysis buffer
supplemented with 1% (v ⁄ v) Triton X-100. The superna-
tants corresponded to the cytosolic fraction. Protein con-
centrations were determined in each sample using the
BCA Protein Assay (Pierce, Rockford, IL, USA). Finally,
the same volumes of all three fractions, corresponding to
20 lg of proteins in the total lysates, were submitted to
western blotting.
Immunocytochemistry
Cells were grown on four-chamber Permanox Lab-Tek
slides (Nalgene Nunc Corp., Rochester, NY, USA) coated
(HEK-293) or not (hVSMCs and CHO) with fibronectin.
Cells were fixed with 3.7% (w ⁄ v) paraformaldehyde for
15 min, permeabilized with 0.1% (v ⁄ v) Triton X-100 for
4 min and blocked with 1% (w ⁄ v) BSA. Wells were then
incubated with the suitable primary antibody for 1 h at
room temperature. Negative control staining was performed
using nonrelevant IgG or whole rabbit serum. Cells were
labeled with the appropriate Alexa Fluor
Ò
fluorochrome-
conjugated secondary antibody. F-actin was stained with
Alexa Fluor
Ò
633conjugated phalloidin (Invitrogen). Finally,
slides were mounted in DAKOCytomation Fluorescent

Mouting Medium (Dako, Glostrup, Denmark) and cells
were imaged using a confocal microscope (LSM510 META;
Carl Zeiss, Oberkochen, Germany).
Immunoprecipitation
Cells were lysed with 1% (v ⁄ v) Igepal CA-630, 20 mm Tris-
HCl, 75 mm NaCl (pH 6.8) [35], supplemented with Prote-
ase Inhibitor Cocktail and Phosphatase Inhibitor Cocktail 1
and 2 (Sigma). Lysates were preclarified by centrifugation
(15 000 g at 4 °C for 15 min). Immunoprecipitation was
performed by incubating 600 lg of proteins with 2 lgof
antibody for 2 h at 4 °C. Irrelevant IgG were used as con-
trols. Magnetic beads (30 lL; Ademtech, Pessac, France)
coupled with Protein A or to Protein G were used to pre-
cipitate the immunocomplexes in accordance with the man-
ufacturer’s instructions. Immunoprecipitates were finally
eluted from the beads by boiling for 5 min in a SDS ⁄ PAGE
buffer containing bmercaptoethanol. Samples were submit-
ted to western blotting.
Western blotting
Samples in Laemmli buffer were separated by SDS ⁄ PAGE.
Proteins were then transferred onto nitrocellulose mem-
branes (AmershamÔHybond ÔECL; Amersham Bioscience,
Little Chalfont, UK), membranes were blocked with
NaCl ⁄ Tris-Tween containing 5% (w ⁄ v) skimmed milk or
BSA for 1 h at room temperature, incubated overnight with
the primary antibody at 4 °C and, finally, with the suitable
secondary antibody coupled with peroxydase. Immune
complexes were revealed by enhanced chemiluminescence
(ECL+; Amersham Bioscience) and vizualized by expo-
sure to films (Amersham HyperfilmÔECL; Amersham

Bioscience).
Immunohistochemistry
Serial frozen sections of human mammary artery were fixed
with acetone and treated with 3% (v ⁄ v) H
2
O
2
in deionized
H
2
O to quench endogenous peroxydase activity. Nonspe-
cific binding was blocked with NaCl ⁄ Tris containing 0.02%
(v ⁄ v) Tween 20 and 0.06% (w ⁄ v) casein (Sigma). Slides
were incubated for 90 min at room temperature with hDlg
antibody or an irrelevant IgG
1
as control. Labeling of the
primary antibody was carried out using an appropriate bio-
tinylated secondary antibody (Vectastain ABC complex;
Vector Laboratories, Inc., Burlingame, CA, USA) and
staining was obtained using the DAB substrate chromogen
system (Dako). Sections were counterstained with Mayer’s
haematoxylin (Sigma).
O. Maı
¨
ga et al. hDlg in ERK cascade
FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2663
Acknowledgements
The authors are grateful to Xavier Norel and the labo-
ratory of Anatomy and Pathological Cytology, CHU

X, Bichat, for providing the pulmonary tissues. We
would also like to thank Mary Pellegrin-Osborne for
her kind editorial assistance.
References
1 Kolch W (2005) Coordinating ERK ⁄ MAPK signalling
through scaffolds and inhibitors. Nat Rev Mol Cell Biol
6, 827–837.
2 Ramos JW (2008) The regulation of extracellular signal-
regulated kinase (ERK) in mammalian cells. Int J
Biochem Cell Biol 40, 2707–2719.
3 Pouyssegur J, Volmat V & Lenormand P (2002) Fidelity
and spatio-temporal control in MAP kinase (ERKs)
signalling. Biochem Pharmacol 64, 755–763.
4 Raman M, Chen W & Cobb MH (2007) Differential
regulation and properties of MAPKs. Oncogene 26,
3100–3112.
5 Teis D, Wunderlich W & Huber LA (2002) Localization
of the MP1-MAPK scaffold complex to endosomes is
mediated by p14 and required for signal transduction.
Dev Cell 3, 803–814.
6 Vaidyanathan H, Opoku-Ansah J, Pastorino S, Renga-
nathan H, Matter ML & Ramos JW (2007) ERK MAP
kinase is targeted to RSK2 by the phosphoprotein
PEA-15. Proc Natl Acad Sci USA 104, 19837–19842.
7 Funke L, Dakoji S & Bredt DS (2005) Membrane-asso-
ciated guanylate kinases regulate adhesion and plasticity
at cell junctions. Annu Rev Biochem 74, 219–245.
8 Jelen F, Oleksy A, Smietana K & Otlewski J (2003)
PDZ domains – common players in the cell signaling.
Acta Biochim Pol 50, 985–1017.

9 Round JL, Humphries LA, Tomassian T, Mittelstadt P,
Zhang M & Miceli MC (2007) Scaffold protein Dlgh1
coordinates alternative p38 kinase activation, directing
T cell receptor signals toward NFAT but not NF-kap-
paB transcription factors. Nat Immunol 8, 154–161.
10 Laprise P, Viel A & Rivard N (2004) Human homolog
of disc-large is required for adherens junction assembly
and differentiation of human intestinal epithelial cells.
J Biol Chem 279, 10157–10166.
11 Leonoudakis D, Mailliard W, Wingerd K, Clegg D &
Vandenberg C (2001) Inward rectifier potassium chan-
nel Kir2.2 is associated with synapse-associated protein
SAP97. J Cell Sci 114, 987–998.
12 Murata M, Buckett PD, Zhou J, Brunner M, Folco E
& Koren G (2001) SAP97 interacts with Kv1.5 in heter-
ologous expression systems. Am J Physiol Heart Circ
Physiol 281, H2575–H2584.
13 Godreau D, Vranckx R, Maguy A, Rucker-Martin C,
Goyenvalle C, Abdelshafy S, Tessier S, Couetil JP &
Hatem SN (2002) Expression, regulation and role of the
MAGUK protein SAP-97 in human atrial myocardium.
Cardiovasc Res 56, 433–442.
14 Schluter OM, Xu W & Malenka RC (2006) Alternative
N-terminal domains of PSD95 and SAP97 govern activ-
ity-dependent regulation of synaptic AMPA receptor
function. Neuron 51 , 99–111.
15 McLaughlin M, Hale R, Ellston D, Gaudet S, Lue RA
& Viel A (2002) The distribution and function of alter-
natively spliced insertions in hDlg. J Biol Chem 277,
64066412.

16 Ishidate T, Matsumine A, Toyoshima K & Akiyama T
(2000) The APC-hDLG complex negatively regulates
cell cycle progression from the G0 ⁄ G1 to S phase.
Oncogene 19, 365–372.
17 Sans N, Racca C, Petralia RS, Wang YX, McCallum J &
Wenthold RJ (2001) Synapse-associated protein 97 selec-
tively associates with a subset of AMPA receptors early
in their biosynthetic pathway. J Neurosci 21, 7506–7516.
18 Mauceri D, Cattabeni F, Di Luca M & Gardoni F
(2004) Calcium ⁄ calmodulindependent protein kinase II
phosphorylation drives synapse-associated protein 97
into spines. J Biol Chem 279, 23813–23821.
19 Jeyifous O, Waites CL, Specht CG, Fujisawa S, Schubert
M, Lin EI, Marshall J, Aoki C, de Silva T, Montgomery
JM et al. (2009) SAP97 and CASK mediate sorting of
NMDA receptors through a previously unknown secre-
tory pathway. Nat Neurosci 12, 1011–1019.
20 Gardoni F, Mauceri D, Marcello E, Sala C, Di Luca M
& Jeromin A (2007) SAP97 directs the localization of
Kv4.2 to spines in hippocampal neurons: regulation by
CaMKII. J Biol Chem 282, 28691–28699.
21 Manneville JB, Jehanno M & Etienne-Manneville S
(2010) Dlg1 binds GKAP to control dynein association
with microtubules, centrosome positioning, and cell
polarity. J Cell Biol 191, 585–598.
22 Etienne-Manneville S, Manneville JB, Nicholls S,
Ferenczi MA & Hall A (2005) Cdc42 and Par6-PKCzeta
regulate the spatially localized association of Dlg1
and APC to control cell polarization. J Cell Biol 170,
895–901.

23 Lue RA, Marfatia SM, Branton D & Chishti AH
(1994) Cloning and characterization of hDlg: the human
homologue of the Drosophila discs large tumor suppres-
sor binds to protein 4.1. Proc Natl Acad Sci USA 91,
9818–9822.
24 Doerks T, Bork P, Kamberov E, Makarova O, Muecke
S & Margolis B (2000) L27, a novel heterodimerization
domain in receptor targeting proteins Lin-2 and Lin-7.
Trends Biochem Sci 25, 317–318.
25 Godreau D, Vranckx R, Maguy A, Goyenvalle C &
Hatem SN (2003) Different isoforms of synapse-associ-
ated protein, SAP97, are expressed in the heart and
have distinct effects on the voltage-gated K
+
channel
Kv1.5. J Biol Chem 278, 47046–47052.
hDlg in ERK cascade O. Maı
¨
ga et al.
2664 FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS
26 Lue RA, Brandin E, Chan EP & Branton D (1996)
Two independent domains of hDlg are sufficient for
subcellular targeting: the PDZ1-2 conformational unit
and an alternatively spliced domain. J Cell Biol 135,
1125–1137.
27 Hanada T, Takeuchi A, Sondarva G & Chishti AH
(2003) Protein 4.1-mediated membrane targeting of
human discs large in epithelial cells. J Biol Chem 278,
34445–34450.
28 Zhang H, Wang D, Sun H, Hall RA & Yun CC (2007)

MAGI-3 regulates LPA-induced activation of Erk and
RhoA. Cell Signal 19, 261–268.
29 Enslen H & Davis RJ (2001) Regulation of MAP kinas-
es by docking domains. Biol Cell 93, 5–14.
30 Muslin AJ (2008) MAPK signalling in cardiovascular
health and disease: molecular mechanisms and thera-
peutic targets. Clin Sci (Lond) 115, 203–218.
31 Gennaro G, Menard C, Michaud SE, Deblois D &
Rivard A (2004) Inhibition of vascular smooth muscle
cell proliferation and neointimal formation in injured
arteries by a novel, oral mitogen-activated protein
kinase ⁄ extracellular signal-regulated kinase inhibitor.
Circulation 110, 3367–3371.
32 Farhan H, Wendeler MW, Mitrovic S, Fava E, Silber-
berg Y, Sharan R, Zerial M & Hauri HP (2010) MAPK
signaling to the early secretory pathway revealed by
kinase ⁄ phosphatase functional screening. J Cell Biol
189, 997–1011.
33 Rudijanto A (2007) The role of vascular smooth muscle
cells on the pathogenesis of atherosclerosis. Acta Med
Indones 39, 86–93.
34 Chomczynski P & Sacchi N (1987) Single-step method
of RNA isolation by acid guanidinium thiocyanate-phe-
nol-chloroform extraction. Anal Biochem 162, 156–159.
35 Peiretti F, Deprez-Beauclair P, Bonardo B, Aubert H,
Juhan-Vague I & Nalbone G (2003) Identification of
SAP97 as an intracellular binding partner of TACE.
J Cell Sci 116, 1949–1957.
36 Skarpen E, Flinder LI, Rosseland CM, Orstavik S,
Wierod L, Oksvold MP, Skalhegg BS & Huitfeldt HS

(2008) MEK1 and MEK2 regulate distinct functions by
sorting ERK2 to different intracellular compartments.
FASEB J 22, 466–476.
Supporting information
The following supplementary material is available:
Fig. S1. Nucleotide and deduced amino acid sequences
of the RT-PCR products obtained for hDlg alternative
splice form determination.
Fig. S2. Coimmunoprecipitation of endogenous hDlg
and the members of the ERK cascade in hVSMCs.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
O. Maı
¨
ga et al. hDlg in ERK cascade
FEBS Journal 278 (2011) 2655–2665 ª 2011 The Authors Journal compilation ª 2011 FEBS 2665