Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Crystal structure of the halotolerant
c-glutamyltranspeptidase from Bacillus subtilis in complex
with glutamate reveals a unique architecture of the
solvent-exposed catalytic pocket
Kei Wada
1
, Machiko Irie
1
, Hideyuki Suzuki
2
and Keiichi Fukuyama
1
1 Department of Biological Sciences, Graduate School of Science, Osaka University, Japan
2 Division of Applied Biology, Graduate School of Science and Technology, Kyoto Institute of Technology, Japan
Introduction
c-Glutamyltranspeptidase (GGT; EC 2.3.2.2), an
enzyme found in bacteria, yeast, plants, and mammals,
is involved in the degradation of c-glutamyl com-
pounds such as glutathione (GSH; c-glutamyl-cyste-
inyl-glycine) [1], a process that is critical to maint
enance of the cellular redox state [1–3]. GGT catalyzes
the initial step of the degradation of extracellular
GSH into its constituent amino acids, which are then
Keywords
electrostatic surface potential; glutathione;
Ntn-hydrolase family; salt-tolerant;
c-glutamyltranspeptidase
Correspondence
K. Fukuyama, Department of Biological
Sciences, Graduate School of Science,
Osaka University, Toyonaka, Osaka

560-0043, Japan
Fax: +81 6 6850 5425
Tel: +81 6 6850 5422
E-mail:
(Received 3 October 2009, revised 5
November 2009, accepted 8 December
2009)
doi:10.1111/j.1742-4658.2009.07543.x
c-Glutamyltranspeptidase (GGT; EC 2.3.2.2), an enzyme found in organ-
isms from bacteria to mammals and plants, plays a central role in glutathi-
one metabolism. Structural studies of GGTs from Escherichia coli and
Helicobacter pylori have revealed detailed molecular mechanisms of
catalysis and maturation. In these two GGTs, highly conserved residues
form the catalytic pockets, conferring the ability of the loop segment to
shield the bound c-glutamyl moiety from the solvent. Here, we have exam-
ined the Bacillus subtilis GGT, which apparently lacks the amino acids
corresponding to the lid-loop that are present in mammalian and plant
GGTs as well as in most bacterial GGTs. Another remarkable feature of
B. subtilis GGT is its salt tolerance; it retains 86% of its activity even in
3 m NaCl. To better understand these characteristics of B. subtilis GGT,
we determined its crystal structure in complex with glutamate, a product of
the enzymatic reaction, at 1.95 A
˚
resolution. This structure revealed that,
unlike the E. coli and H. pylori GGTs, the catalytic pocket of B. subtilis
GGT has no segment that covers the bound glutamate; consequently, the
glutamate is exposed to solvent. Furthermore, calculation of the electro-
static potential showed that strong acidic patches were distributed on the
surface of the B. subtilis GGT, even under high-salt conditions, and this
may allow the protein to remain in the hydrated state and avoid self-aggre-

gation. The structural findings presented here have implications for the
molecular mechanism of GGT.
Structured digital abstract
l
MINT-7383558: GGT (uniprotkb:P54422) and GGT (uniprotkb:P54422) bind (MI:0407)by
X-ray crystallography (
MI:0114)
Abbreviations
GGT, c-glutamyltranspeptidase; GSH, glutathione; L-subunit, large subunit; S-subunit, small subunit.
1000 FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS
transported into the cell and reused as a cysteine source
[1,3–5]. The localization of GGT differs by organism:
in bacteria, GGT is expressed in the periplasmic space
or secreted into the extracellular environment [1]; in
mammalian cells, it is bound to the external surface of
the plasma membrane [1,5]; and in plants, it is localized
to the apoplast and the vacuole [6].
The mature GGT is a heterodimer comprising one
large subunit (L-subunit;  40 kDa) and one small
subunit (S-subunit;  20 kDa), generated by post-
translational autocatalytic cleavage of the inactive pre-
cursor protein ( 60 kDa) [7]. Crystallographic studies
of GGTs from Escherichia coli and Helicobacter pylori
have revealed the detailed molecular mechanisms of
catalysis and maturation [8–10]. The side chain of
Thr391 of the E. coli GGT precursor protein acts as
the nucleophile for the cleavage, by which it becomes
the new N-terminal residue of the S-subunit, and in
turn acts as the nucleophile for the enzymatic reaction.
Following cleavage, the C-terminal segment of the

L-subunit (I378–Q390) moves away from the threo-
nine, thereby forming the c-glutamyl moiety-binding
pocket and concomitantly allowing the flexible loop
(residues 438–449 of the E. coli GGT) to cover the
pocket. Interestingly, the loop has been shown to
shield the catalytic pocket from the solvent when the
pocket is occupied by a substrate or inhibitor, whereas
the loop is disordered when the pocket is empty [10–
12]. Hence, we assumed that the loop, which is called
the ‘lid-loop’, is involved in recruiting the substrate by
changing its conformation according to the conditions
of the catalytic pocket, and is therefore necessary for
the GGT reaction. Indeed, mutational analysis of
H. pylori GGT demonstrated that substitution of a res-
idue on the loop (Y433A) significantly diminished its
catalytic activity [13].
We were interested in Bacillus subtilis GGT because
it lacks the sequences corresponding to the lid-loop,
and instead has extra residues at the C-terminus of the
L-subunit, whereas the catalytic threonine and the resi-
dues involved in substrate binding are mostly con-
served (Fig. 1). A phylogenetic sequence alignment of
confirmed and putative GGTs using the Microbial
Genome Database [14] showed that, among the
enzymes from 305 species, several bacterial GGTs,
including those of Bacillus, Oceanobacillus and Staphy-
lococcus, apparently lack the sequences corresponding
to the lid-loop. Because the structural rearrangements
occur at the active site pocket upon E. coli GGT mat-
uration [10], the inserted residues at the L-subunit

C-terminus in B. subtilis GGT could shield the active
site pocket by occupying the position corresponding to
the lid-loop. To better understand the significance of
the absence of the lid-loop sequence and the presence
of the extra residues at the L-subunit C-terminus, we
embarked on a crystallographic analysis of B. subtilis
GGT in complex with glutamate.
Another goal of this analysis was to determine the
structural factors underlying the salt tolerance of
B. subtilis GGT [15,16]. In the presence of 3 m NaCl,
B. subtilis GGT retained 86% of its hydrolytic activity,
whereas E. coli GGT lost 90% of its activity, in com-
parison with NaCl-free conditions. B. subtilis GGT has
therefore attracted attention because of its possible
application to the fermentation of food in high salt
concentrations, e.g. with soy sauce and miso (fer-
mented soybeans), the traditional Japanese seasonings,
in which the desired taste depends mainly on the
amount of glutamic acid present. Elucidation of the
structural factors related to the salt tolerance of
B. subtilis GGT may help in the development of bet-
ter-engineered GGT.
Here, we report the crystal structure of B. subtilis
GGT in complex with glutamate, a product of the
enzymatic reaction, at 1.95 A
˚
resolution, revealing the
unique structure of the catalytic pocket. We also pres-
ent a structural comparison between the salt-tolerant
B. subtilis GGT and the nonhalophilic E. coli GGT.

Results and Discussion
Overall structure of B. subtilis GGT
N-terminal His-tagged GGT from B. subtilis lacking
the signal peptide composed of the first 35 residues
was produced in E. coli. The recombinant protein was
subjected to autocatalytic processing to yield a stable
heterodimeric enzyme comprising an L-subunit (resi-
dues 36–402) and an S-subunit (residues 403–587). The
structure of this GGT in complex with glutamate, a
product of the enzymatic reaction, was refined at
1.95 A
˚
resolution to R and R
free
values of 0.208 and
0.262, respectively. The asymmetric unit contains two
GGT molecules, which bind one glutamate each at
identical sites. Although the electron density for GGT
was mostly of high quality and continuous, the densi-
ties for the N-terminal His-tag segment and resi-
dues 396–402, corresponding to the C-terminus of the
L-subunit, were poorly defined; therefore, these resi-
dues were not included in the model. B. subtilis GGT
has a four-layer sandwich (a ⁄ b ⁄ b⁄ a) core structure,
comprising two central b-sheets and surrounding
a-helices, similar to the structure of the Ntn hydrolase
superfamily [17,18].
Recently, the crystal structure of ligand free-GGT
from B. subtilis was determined by Sharath et al.
K. Wada et al. Structure of B. subtilis c-glutamyltranspeptidase

FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS 1001
(Protein Data Bank ID: 2V36). To determine the struc-
tural change caused by the binding of glutamate, the
structures of ligand-free GGT and glutamate-bound
GGT were superimposed. No significant structural
change was observed; the rmsd for the Ca atom was
0.40 A
˚
. In the glutamate-bound GGT, one additional
Fig. 1. Multiple sequence alignment of GGTs from several representative organisms. The sequence numbering is shown for B. subtilis GGT.
Identical residues are highlighted in light green, and similar residues are boxed in blue. The residues of the catalytic nucleophile are high-
lighted in orange. The residues that participate in hydrogen bonding with glutamate are highlighted in yellow. The secondary structural ele-
ments of B. subtilis GGT are shown above the alignment, and 3
10
helices are labeled g. The figure was prepared with CLUSTALW [35] and
ESPRIPT [36]. B. subtilis 168, NCBI accession no. NP_389723; E. coli K-12, NP_417904; H. pylori, NP_207909; Human, Homo sapiens,
NM_005265; Pig, Sus scrofa, NM_214030; Rat, Rattus norvegicus, NM_053840.
Structure of B. subtilis c-glutamyltranspeptidase K. Wada et al.
1002 FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS
residue in the C-terminal region of the L-subunit was
visible as compared with ligand-free GGT.
One glutamate was bound to each of the deeply
grooved catalytic pockets in the asymmetric unit, and
the glutamate-binding modes are identical to each
other (Fig. 2A). The a-carboxyl and a-amino groups
of the bound glutamate are at the bottom of the
pocket, and are held in this position by extensive
hydrogen bonds and salt bridges in a similar manner
as the c-glutamyl intermediate in the E. coli GGT
molecule [8] and the glutamate complex in the

H. pylori GGT molecule [13]. The carboxyl group is
bonded with Arg113 Ng, Ser464 Oc, and Ser465 N,
and the a-amino group with Glu442 Oe, Glu423 Oe,
and Asp445 Od. The glutamate carbonyl oxygen at the
e-position is hydrogen-bonded with the two main chain
amino groups of Gly485 and Gly486, which are
assumed to form the oxyanion hole. As compared with
E. coli GGT (Fig. 2B) [8], all of the interactions with
glutamate are identical, except that Glu423 and
Glu442 in B. subtilis GGT are replaced by asparagine
(Asn411) and glutamine (Gln430), respectively, in
E. coli GGT.
Unique structure of the catalytic pocket of
B. subtilis GGT
Comparison of the B. subtilis GGT structure with the
previously reported E. coli and H. pylori GGT struc-
tures [8,9] revealed a unique structural feature of B. sub-
tilis GGT (Fig. 3). Unlike in the E. coli and H. pylori
GGTs, in which the lid-loop covers the catalytic pocket
when the pocket is occupied by the substrate or one of
its analogs, in the B. subtilis GGT there was no ordered
segment covering the bound glutamate in the catalytic
pocket (Fig. 3A). Consequently, the bound glutamate is
exposed to solvent, whereas the glutamates in both
E. coli and H. pylori GGTs are buried as if in a cave
(Fig. 3B,C). The segment of B. subtilis GGT that corre-
sponds to the lid-loops of the E. coli and H. pylori
GGTs (439–448 and 428–437 residues) is cut short.
B. subtilis GGT has additional residues not present
in most other GGTs at the C-terminal region of the

L-subunit. In E. coli GGT, upon autocatalytic cleavage
of the peptide bond on the N-terminal side of Thr391,
the C-terminal segment of the newly produced L-sub-
unit flips away, with the result that the C-terminus of
the L-subunit and the N-terminus of the S-subunit
become quite distant from one another (> 35 A
˚
) [10].
The present crystallographic analysis has revealed that
the L-subunit C-terminal segment in the mature form
of B. subtilis GGT is located close to the catalytic
pocket, although the seven C-terminal residues (396–
402) are invisible. The location of the L-subunit C-ter-
minal segment in B. subtilis GGT is similar to that of
the E. coli GGT precursor protein but distinct from
that of the mature E. coli GGT. Hence, unlike other
GGTs with known structures, it is assumed that
B. subtilis GGT undergoes no significant structural
change during maturation. In
B. subtilis GGT, the seg-
ment consisting of residues 391–395 undergoes no spe-
cific interaction with neighboring residues.
In summary, B. subtilis GGT does not have the lid-
loop motif, and the C-terminal segment of the newly
A
B
Fig. 2. Glutamate binding in the catalytic pocket of GGT. (A) Elec-
tron density map for the bound glutamate in B. subtilis GGT. An
omit F
o

– F
c
map for glutamate contoured at 2.0r (orange) is
overlaid on the stick models of GGT and the bound glutamate. (B)
The glutamate-binding mode in E. coli GGT. The bound glutamate
and catalytic threonines are shown in orange and cyan, respec-
tively. Dashed lines indicate hydrogen bonds.
K. Wada et al. Structure of B. subtilis c-glutamyltranspeptidase
FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS 1003
produced L-subunit appears to be changed little after
autocatalytic processing. Moreover, additional residues
at the L-subunit C-terminus are not involved in shield-
ing the active site pocket from the solvent; therefore,
the substrate ⁄ product is exposed to solvent when
bound to the catalytic pocket. As described above, for
E. coli GGT it has been well established that the cata-
lytic reaction proceeds in the active site pocket, which
is shielded from solvent by the lid-loop, as well as by
release of the C-terminal segment from the active site
pocket upon autocatalytic processing. The role of the
lid-loop is made possible by its flexible nature, which
allows it to adopt open or closed conformations.
The structure of B. subtilis GGT shows that neither
the lid-loop nor the alternative segment that covers
the active site pocket is present, prompting questions
about the role and significance of the lid-loop in GGT
catalysis.
During the preparation of this article, the crystal
structures of Bacillus anthracis CapD, a GGT-related
enzyme, in the absence and presence of a glutamate

dipeptide were reported [19]. B. anthracis CapD cata-
lyzes the cleavage of the c-glutamyl bond but, unlike
GGTs, transfers the poly-c-d-glutamic acid to the pep-
tidoglycan cell wall, and is therefore involved in link-
ing the capsule of poly-c-d-glutamic acid to the
bacterial envelope [20]. When the structure of CapD in
complex with di-a-l-glutamate peptide, a nonhydrolyz-
able analog of the substrate, is compared with that of
the B. subtilis GGT–glutamate complex, it is apparent
that CapD is a member of the Ntn hydrolase
superfamily, like GGT. Differences in structural char-
acteristics between the two enzymes can be observed at
the active sites. CapD lacks the lid-loop, as seen in
B. subtilis GGT, and therefore the ligand bound to
CapD is exposed to solvent. A notable difference
between the two enzymes can be seen in the manner of
AB C
Fig. 3. Comparison of the structures of GGTs from (A) B. subtilis, (B) E. coli and (C) H. pylori . The structure of each GGT is indicated in the
upper panel. The catalytic pocket is shown in the square box, and the molecular surface corresponding to this region is shown in the lower
panel. The bound glutamate molecule is depicted in each GGT with a space-filling model. The region corresponding to the unique C-terminal
segment of B. subtilis GGT and the lid-loops of E. coli and H. pylori GGTs are shown as dark red and light green sticks, respectively. The
characters N and C indicate the N-terminus and C-terminus, respectively. This figure was prepared with
PYMOL [37].
Fig. 4. Comparison of the binding modes of the ligands. The struc-
tures of B. subtilis GGT and B. anthracis CapD (Protein Data Bank
ID: 3G9K) are shown in gray and brown, respectively. Stick models
of the glutamate (orange) in GGT and the di-a-glutamate (purple) in
CapD are shown. Hydrogen bonds in GGT and in CapD are shown
in blue and orange, respectively.
Structure of B. subtilis c-glutamyltranspeptidase K. Wada et al.

1004 FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS
ligand binding to the enzyme (Fig. 4); there is little
correspondence in the amino acids that are involved in
the recognition of the functional groups of the ligands.
Moreover, in GGT the a-carboxyl group of the gluta-
mate protrudes into the groove, whereas in CapD the
corresponding c-carboxyl group of the dipeptide ana-
log is skewed towards the surface. This difference may
reflect the different sizes of the physiological sub-
strates; that is, the substrate of GGT is a small GSH,
whereas that of CapD is a huge polymer.
Structural basis for the salt tolerance
B. subtilus GGT is so salt-tolerant that it retains most
of its catalytic activity even in 3 m NaCl solution [16].
It has been reported that that the protein’s acidic sur-
face enhances its stability by increasing solvation
through increased water-binding capacity [21–23];
therefore, we analyzed its surface potential. The water-
binding capacities of glutamate and aspartate have
been reported to be 7.5 and 6.0 molecules per amino
acid, respectively, whereas those for asparagine, serine
and threonine have been estimated to be 2.0 molecules
per amino acid [24].
B. subtilis and E. coli GGTs both have a negatively
charged surface (Fig. 5A,B), whereas H. pylori GGT
has positively charged patches globally distributed
across its molecular surface (Fig. 5C), consistent with
the theoretical pI value (9.12) calculated from the
amino acid sequence. Contrary to our expectation that
more negatively charged residues would be present on

the molecular surface of B. subtilis GGT than on that
of E. coli GGT, there was no significant difference in
surface potential between the two GGTs. To better
understand the factors underlying the high salt toler-
ance, the effect of salt concentration on the enzyme sur-
face properties was assessed by solving the Poisson–
Boltzmann equation. At high salt concentrations, nota-
bly different results were observed in the electrostatic
surface potentials between the two GGTs; in B. subtilis
GGT, apparent negatively charged areas were main-
tained on the surface in the presence of 3 m monovalent
ion, whereas in E. coli GGT, under the same condi-
tions, the negatively charged patches on the surface that
had been observed in the absence of salt had completely
disappeared. The negatively charged areas of B. subtilis
GGT under high-salt conditions even increased the
solvation, owing to increased water-binding capacity.
This may allow the protein to remain in a hydrated
state, preventing the binding of inorganic cations in the
high-salt solution, and also preventing self-aggregation.
B. subtilis GGT may be applicable to the manufac-
ture of fermented food, because this enzyme possesses
A
B
C
B. subtilis GGT (0 M NaCl)
90°
E. coli GGT (0
M NaCl)
B. subtilis GGT (3

M NaCl)
E. coli GGT (3
M NaCl)
H.
py
lori GGT
(
0 M NaCl
)
Fig. 5. Surface electrostatic properties of GGTs. (A) Electrostatic
potentials of B. subtilis (upper panels) and E. coli (lower panels) GGTs
calculated using parameters without taking into account ion strength.
(B) Electrostatic potentials of B. subtilis (upper panels) and E. coli
(lower panels) GGTs calculated for 3
M concentration of monovalent
ion. (C) The surface potential of H. pylori GGT calculated using para-
meters without taking into account ion strength. The color scale ranges
from )10 kT per electron (red) to +10 kT per electron (blue). The struc-
tures are graphically depicted with the viewpoint looking down the cat-
alytic pocket (right panels) or rotated 90° from this view (left panels).
K. Wada et al. Structure of B. subtilis c-glutamyltranspeptidase
FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS 1005
not only c-glutamyl compound-degrading activity
(GGT activity) but also the steady glutaminase activity
[16] that converts glutamine into glutamic acid and
ammonia. Decreasing the level of glutamine in fer-
mented foods improves the taste, as glutamine is spon-
taneously converted to slightly sour pyroglutamic acid.
Although glutaminases from fungi such as Aspergil-
lus oryzae or Aspergillus sojae are applied to remove

the glutamine during the process of fermentation, the
activity of these glutaminases is seriously reduced by
the high salt concentration. In contrast, halotolerant
B. subtilis GGT could be used to increase the level of
glutamic acid, a major component of the desired taste,
at the same time decreasing the amount of glutamine,
even under high-salt conditions, by both its GGT
activity and its glutaminase activity. The structural
basis for the salt tolerance presented here could be a
guide for further improvements in the usefulness of
B. subtilis GGT by protein engineering.
Experimental procedures
Cloning of the ggt gene into an expression vector
The ggt gene from B. subtilis was amplified by PCR from the
plasmid pCY167 (Suzuki H & Yamada C, Unpublished),
using forward primer 5¢-
CATATGGATGAGTACAAACA
AGTAGATG-3¢ and reverse primer 5¢-
GGATCCTCGAG
CTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin-
ed sequences indicate NdeI and BamHI sites, respectively).
The PCR product was initially subcloned into pTA2 (Toyobo,
Osaka, Japan), and the sequence was confirmed. As the origi-
nal ggt sequence has one NdeI site in the middle, we intro-
duced a synonymous mutation into this site, using the
Quikchange Site-Directed Mutagenesis kit (Stratagene, La
Jolla, CA, USA) with forward primer 5¢-GAAACGATGC
ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse
primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA
TCGTTTC-3¢. The sequence of the second PCR product was

also confirmed. Following the digestion of the second PCR
product with NdeI and BamHI, the DNA fragment containing
the ggt gene was ligated into the pCold-I vector (Takara
Bio, Shiga, Japan), and pCold I–His
6
–ggt was subsequently
generated.
Overproduction and purification of B. subtilis
GGT
The pCold I–His
6
–ggt expression vector was transformed
into E. coli C41(DE3) [25]. The transformant was grown at
37 °C in 3.6 L (900 mL · 4) of liquid TB containing ampi-
cillin (50 lg ⁄ mL) to an attenuance of 0.6 at 600 nm. At
this stage, expression of the N-terminal His-tagged GGT
was induced by decreasing the temperature from 37 °Cto
15 °C, and then adding 1 mm isopropyl-b-d-thiogalactopyr-
anoside. After induction, the transformant was cultured at
15 °C for 30 h. The cells were harvested, resuspended in
50 mm Tris ⁄ HCl (pH 7.8) containing 20 mm imidazole, and
disrupted by sonication. The soluble fraction was mixed
with His-select resin (Sigma, St Louis, MO, USA), and the
N-terminal His-tagged GGT was purified by batch method
according to the manufacturer’s protocol. Fractions contain-
ing GGT were collected and concentrated with ammonium
sulfate at 70% saturation. The precipitate was dissolved in
50 mm Tris ⁄ HCl (pH 7.8), and was then subjected to gel
filtration using a HiPrep 16 ⁄ 60 Sephacryl S-200 HR column
(GE Healthcare, Milwaukee, WI, USA). All purification

steps were performed at 4 °C. Fractions containing GGT
were monitored by absorption at 280 nm and GGT activity
[26], and purity was confirmed by SDS ⁄ PAGE.
Crystallization of B. subtilis GGT
The purified GGT was concentrated to 10 mg ⁄ mL with a
Vivaspin filter (GE Healthcare). All crystallization trials were
performed at 4 °C, using the hanging-drop vapor-diffusion
method. Crystallization drops containing 1 lL of protein solu-
tion in 20 mm Hepes (pH 7.8) and 0.5 mml-glutamate, and
1 lL of precipitant solution, were equilibrated against 200 lL
of precipitant solution. The initial trials were performed
using the following commercially available sparse-matrix
screening kits: Crystal Screen I, II and Lite, PEG ⁄ Ion screen
(Hampton Research, Aliso Viejo, CA, USA), Wizard I–III
(Emerald BioSystems, Bainbridge Island, WA, USA), and JB
screen 1–6 (Jena Bioscience GmbH, Jena, Germany).
The crystallization trials produced small crystals in sev-
eral drops containing poly(ethylene glycol) as a precipitant
(e.g. PEG ⁄ Ion screen, tube nos. 10, 11, 13 and 14; Wiz-
ard III, tube no. 10; JB screen 3, C2). The crystals were
improved using Additive Screen (Hampton Research), and
the conditions were then manually optimized using home-
made solutions. The best crystals of His
6
–GGT were grown
in the drop containing a 1 : 1 mixture of protein solution
[10 mg ⁄ mL in 20 mm Hepes (pH 7.8) containing 0.5 mm
l-glutamate] and reservoir solution [poly(ethylene gly-
col) 4000, 100 mm Mes (pH 7.0), 600 mm NaCl, and
5% (v ⁄ v) Jeffamine M-600]. Crystals grew to maximum

dimensions of 0.05 · 0.1 · 0.4 mm in 1 week.
Data collection for B. subtilis GGT
The crystals were transferred to a reservoir solution con-
taining 15% (v ⁄ v) glycerol as a cryoprotectant for a few
seconds, and then flash-cooled in a cryostream at )180 °C.
To measure the GGT crystals, we used a goniometer head
with a large arc to alter the rotation axis of the mounted
crystal; because the spaces between reciprocal points along
the c*-axis were so small, it was necessary to choose a rota-
tion axis nearly parallel to the c-axis to avoid overlapping
Structure of B. subtilis c-glutamyltranspeptidase K. Wada et al.
1006 FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS
of the diffraction spots on a frame derived from the adja-
cent reciprocal lattice planes. Intensity datasets were
collected at the BL38B1 station of the SPring-8 (Hyogo,
Japan), using the oscillation method on an ADSC Q210
detector (Area Detector Systems Corporation, Poway, CA,
USA) with synchrotron radiation (k = 1.000 A
˚
). The crys-
tal-to-detector distance was 200 mm; 1470 images were
recorded at 0.1° intervals, with an exposure time of 15 s per
image. The intensity data were processed and scaled with
xds [27]. The results of the data collection are summarized
in Table 1.
Structure determination for GGT
When we reached the stage of solving the phase problem,
we learned that the coordinates for substrate-free B. subtilis
GGT had been deposited by Sharath et al. at the RCSB
Protein Data Bank (2V36). Because their crystal form was

different from ours, we applied the molecular replacement
method to solve our crystal structure, using their coordi-
nates as the search probe. Rotational and translational
searches of the diffraction data (15.0–4.0 A
˚
resolution), per-
formed using molrep [28] from the ccp4 package, located
two crystallographically independent molecules in an asym-
metric unit. The structure was subjected to rigid-body
refinement for 25–3.0 A
˚
resolution data, using cns [29].
The structure was further refined at 1.95 A
˚
resolution with
the cns simulated annealing protocol, and this was fol-
lowed by energy minimization and individual temperature-
factor refinements; manual model building was performed
with xfit [29a]. The electron density map at this stage was
clear enough for exact assignment of the orientations of the
two glutamates in the asymmetric unit, and the model was
unambiguously fitted to the F
o
–F
c
map of the substrate-
binding pocket of each molecule. The ordered water mole-
cules were added to the model using the cns water-pick
and water-delete functions. Finally, energy minimization
and temperature-factor refinements were applied to the

model. Although the crystallization drops contain 600 mm
NaCl, the electron densities and the temperature factors of
the picked atoms indicated that neither sodium ion nor
chloride ion was bound to this GGT. Structure refinement
statistics are summarized in Table 1. Atomic coordinates
and structure factors have been deposited in the RCSB Pro-
tein Data Bank () under accession
number 3A75.
The software programs used were as follows: promotif
[30] for secondary structure assignment, procheck [31] for
the validity of the final model, and lsqman [32] for super-
position and rmsd values of the structures. The electrostatic
potentials of the molecular surface were calculated with
pbeq-solver [33], which uses the Poisson–Boltzmann equa-
tions module from the biomolecular simulation program
charmm [34].
Acknowledgements
We thank S. Baba, N. Mizuno and T. Hoshino for
their assistance with data collection using the synchro-
tron radiation at SPring-8 (Hyogo, Japan). The syn-
chrotron radiation experiments were performed at
BL38B1, SPring-8, with the approval of the Japan
Synchrotron Radiation Research Institute (Proposal
No. 2008B1079). We also thank M. Sugishima of
Kurume University for valuable comments and sugges-
tions, and N. Kaseda of Osaka University for technical
assistance. This work was supported by a grant from
the Japan Foundation for Applied Enzymology (to
K. Fukuyama), Grants-in-Aid for Scientific Research
21380059 (to H. Suzuki), 20370037 (to K. Fukuyama)

and 21770112 (to K. Wada) from the Ministry of
Table 1. Crystallographic data and refinement statistics (values in
parentheses are for the outermost shell).
Crystallographic data
Space group P 2
1
2
1
2
1
Cell parameters (A
˚
) a = 49.4, b = 98.9, c = 227.9
Resolution range (A
˚
) 25.0–1.95 (2.02–1.95)
Observed reflections 408 102
Unique reflections 76 177
Mean I ⁄ r (I) 18.3 (4.6)
Redundancy 5.4 (3.4)
Completeness (%) 92.5 (86.2)
R
sym
(%)
a
6.2 (26.2)
Refinement statistics
R
cryst
(%)

b
20.8
R
free
(%)
c
26.2
Disordered regions
d
Molecule A
L-subunit 36–37, 396–402
S-subunit 585–587
Molecule B
L-subunit 36–38, 396–402
S-subunit –
rmsd from ideal values
Bond length (A
˚
) 0.017
Bond angle (°) 1.9
Average B-factor (A
˚
2
) 23.3
Ramachandran plot
Most favored (%) 91.0
Additionally allowed (%) 8.8
Generously allowed (%) 0.0
Disallowed (%)
e

0.2
a
R
sym
=
P
hkl
P
i
|I
i
(hkl )–<I(hkl )>| ⁄
P
hkl
P
i
I
i
(hkl ), where <I(hkl )> is
the average intensity over equivalent reflections.
b
R
cryst
=
P
||F
obs
(hkl )| – |F
calc
(hkl )|| ⁄

P
|F
obs
(hkl )|.
c
R
free
is the R-value calculated for 5% of the dataset not included
in the refinement.
d
Numerals shown are invisible residue numbers.
e
Glu423, which corresponds to Asn411 in E. coli GGT, in the two
crystallographically independent molecules.
K. Wada et al. Structure of B. subtilis c-glutamyltranspeptidase
FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS 1007
Education, Culture, Sports, Science and Technology of
the Japanese Government, and a research grant from
Towa Food Research Foundation (to H. Suzuki).
References
1 Tate SS & Meister A (1981) c -Glutamyl transpeptidase:
catalytic, structural and functional aspects. Mol Cell
Biochem 39, 357–368.
2 Mehdi K & Penninckx MJ (1997) An important role
for glutathione and c-glutamyltranspeptidase in the
supply of growth requirements during nitrogen starva-
tion of the yeast Saccharomyces cerevisiae. Microbiology
143, 1885–1889.
3 Martin MN, Saladores PH, Lambert E, Hudson AO &
Leustek T (2007) Localization of members of the c-glut-

amyl transpeptidase family identifies sites of glutathione
and glutathione S-conjugate hydrolysis. Plant Physiol
144, 1715–1732.
4 Suzuki H, Kumagai H & Tochikura T (1986) c-Glutam-
yltranspeptidase from Escherichia coli K-12: formation
and localization. J Bacteriol 168, 1332–1335.
5 Taniguchi N & Ikeda Y (1998) c-Glutamyl transpepti-
dase: catalytic mechanism and gene expression. Adv
Enzymol Relat Areas Mol Biol 72, 239–278.
6 Ohkama-Ohtsu N, Fukuyama K & Oliver DJ (2009)
Roles of c-glutamyl transpeptidase and c-glutamyl
cyclotransferase in glutathione and glutathione-
conjugate metabolism in plants. Adv Bot Res 52,
87–113.
7 Suzuki H & Kumagai H (2002) Autocatalytic process-
ing of c-glutamyltranspeptidase. J Biol Chem 277,
43536–43543.
8 Okada T, Suzuki H, Wada K, Kumagai H &
Fukuyama K (2006) Crystal structures of c-glutamyl-
transpeptidase from Escherichia coli, a key enzyme in
glutathione metabolism, and its reaction intermediate.
Proc Natl Acad Sci USA 103, 6471–6476.
9 Boanca G, Sand A, Okada T, Suzuki H, Kumagai H,
Fukuyama K & Barycki JJ (2007) Autoprocessing of
Helicobacter pylori c-glutamyltranspeptidase leads to
the formation of a threonine–threonine catalytic dyad.
J Biol Chem 282, 534–541.
10 Okada T, Suzuki H, Wada K, Kumagai H &
Fukuyama K (2007) Crystal structure of the c-glutamyl-
transpeptidase precursor protein from Escherichia coli.

Structural changes upon autocatalytic processing and
implications for the maturation mechanism. J Biol
Chem 282, 2433–2439.
11 Wada K, Hiratake J, Irie M, Okada T, Yamada C,
Kumagai H, Suzuki H & Fukuyama K (2008) Crystal
structures of Escherichia coli c-glutamyltranspeptidase
in complex with azaserine and acivicin: novel mechanis-
tic implication for inhibition by glutamine antagonists.
J Mol Biol 380, 361–372.
12 Williams K, Cullati S, Sand A, Biterova EI & Barycki
JJ (2009) Crystal structure of acivicin-inhibited c-glut-
amyltranspeptidase reveals critical roles for its C-termi-
nus in autoprocessing and catalysis. Biochemistry 48,
2459–2467.
13 Morrow AL, Williams K, Sand A, Boanca G & Barycki
JJ (2007) Characterization of Helicobacter pylori c-glut-
amyltranspeptidase reveals the molecular basis for sub-
strate specificity and a critical role for the
tyrosine 433-containing loop in catalysis. Biochemistry
46, 13407–13414.
14 Uchiyama I (2007) MBGD: a platform for microbial
comparative genomics based on the automated con-
struction of orthologous groups. Nucleic Acids Res 35,
D343–D346.
15 Minami H, Suzuki H & Kumagai H (2003) A mutant
Bacillus subtilis c-glutamyltranspeptidase specialized in
hydrolysis activity. FEMS Microbiol Lett 224, 169–173.
16 Minami H, Suzuki H & Kumagai H (2003) Salt-tolerant
c-glutamyltranspeptidase from Bacillus subtilis 168 with
glutaminase activity. Enzyme Microb Technol 32,

431–438.
17 Duggleby HJ, Tolley SP, Hill CP, Dodson EJ, Dodson
G & Moody PC (1995) Penicillin acylase has a single-
amino-acid catalytic centre. Nature 373, 264–268.
18 Oinonen C, Tikkanen R, Rouvinen J & Peltonen L
(1995) Three-dimensional structure of human
lysosomal aspartylglucosaminidase. Nat Struct Biol 2,
1102–1108.
19 Wu R, Richter S, Zhang RG, Anderson VJ, Missiakas
D & Joachimiak A (2009) Crystal structure of Bacillus
anthracis transpeptidase enzyme CapD. J Biol Chem
284, 24406–24414.
20 Richter S, Anderson VJ, Garufi G, Lu L, Budzik JM,
Joachimiak A, He C, Schneewind O & Missiakas D
(2009) Capsule anchoring in Bacillus anthracis occurs by
a transpeptidation reaction that is inhibited by capsidin.
Mol Microbiol 71, 404–420.
21 Frolow F, Harel M, Sussman JL, Mevarech M &
Shoham M (1996) Insights into protein adaptation to a
saturated salt environment from the crystal structure of a
halophilic 2Fe–2S ferredoxin. Nat Struct Biol 3, 452–458.
22 Premkumar L, Greenblatt HM, Bageshwar UK,
Savchenko T, Gokhman I, Sussman JL & Zamir A
(2005) Three-dimensional structure of a halotolerant
algal carbonic anhydrase predicts halotolerance of a
mammalian homolog. Proc Natl Acad Sci USA 102,
7493–7498.
23 Grochowski P & Trylska J (2008) Continuum molecular
electrostatics, salt effects, and counterion binding –
a review of the Poisson–Boltzmann theory and its modi-

fications. Biopolymers 89, 93–113.
24 Kuntz ID (1971) Hydration of macromolecules. IV.
Polypeptide conformation in frozen solutions. JAm
Chem Soc 93, 516–518.
Structure of B. subtilis c-glutamyltranspeptidase K. Wada et al.
1008 FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS
25 Miroux B & Walker JE (1996) Over-production of pro-
teins in Escherichia coli: mutant hosts that allow synthe-
sis of some membrane proteins and globular proteins at
high levels. J Mol Biol 260, 289–298.
26 Suzuki H, Kumagai H & Tochikura T (1986) c-Glutam-
yltranspeptidase from Escherichia coli K-12: purification
and properties. J Bacteriol 168, 1325–1331.
27 Kabsch W (1993) Automatic processing of rotation
diffraction data from crystals of initially unknown sym-
metry and cell constants. J Appl Crystallogr 26, 795–800.
28 Vagin A & Teplyakov A (2000) An approach to multi-
copy search in molecular replacement. Acta Crystallogr
D Biol Crystallogr 56, 1622–1624.
29 Bru
¨
nger AT, Adams PD, Clore GM, DeLano WL,
Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J,
Nilges M, Pannu NS et al. (1998) Crystallography &
NMR system: a new software suite for macromolecular
structure determination. Acta Crystallogr D Biol
Crystallogr 54, 905–921.
29a McRee DE (1999) XtalView ⁄ Xfit – a versatile program
for manipulating atomic coordinates and electron den-
sity. J Struct Biol 125 , 156–165.

30 Hutchinson EG & Thornton JM (1996) PROMOTIF:
a program to identify and analyze structural motifs in
proteins. Protein Sci 5, 212–220.
31 Laskowski RA, MacArthur MW, Moss DS & Thornton
JM (1993) PROCHECK: a program to check the ste-
reochemical quality of protein structures. J Appl Crys-
tallogr 26, 283–291.
32 Kleywegt GJ & Jones TA (1994) A super position.
ESF ⁄ CCP4 Newslett 31, 9–14.
33 Jo S, Kim T, Iyer VG & Im W (2008) CHARMM-
GUI: a web-based graphical user interface for
CHARMM. J Comput Chem 29, 1859–1865.
34 Brooks BR, Brooks CL 3rd, Mackerell AD Jr, Nilsson L,
Petrella RJ, Roux B, Won Y, Archontis G, Bartels C,
Boresch S et al. (2009) CHARMM: the biomolecular
simulation program. J Comput Chem 30, 1545–
1614.
35 Thompson JD, Higgins DG & Gibson TJ (1994)
CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weight-
ing, position-specific gap penalties and weight matrix
choice. Nucleic Acids Res 22, 4673–4680.
36 Gouet P, Courcelle E, Stuart DI & Metoz F (1999)
ESPript: analysis of multiple sequence alignments in
PostScript. Bioinformatics 15, 305–308.
37 DeLano WL (2002) PyMOL. DeLano Scientific, San
Carlos, CA.
K. Wada et al. Structure of B. subtilis c-glutamyltranspeptidase
FEBS Journal 277 (2010) 1000–1009 ª 2010 The Authors Journal compilation ª 2010 FEBS 1009