Báo cáo khoa học: Characterization of an N6 adenine methyltransferase from Helicobacter pylori strain 26695 which methylates adjacent adenines on the same strand pptx

Characterization of an N
6
adenine methyltransferase
from Helicobacter pylori strain 26695 which methylates
adjacent adenines on the same strand
Ritesh Kumar
1
, Asish K. Mukhopadhyay
2
and Desirazu N. Rao
1
1 Department of Biochemistry, Indian Institute of Science, Bangalore, India
2 Division of Bacteriology, National Institute of Cholera and Enteric Disease, Kolkata, India
Introduction
DNA methylation is one of the most common forms
of DNA modification occurring in the prokaryotic
genome. This modification does not affect the Wat-
son–Crick pairing, but creates a signature motif that
can be recognized by the proteins interacting with
DNA. It has been shown that DNA methylation can
enhance or abrogate the affinity of transcription fac-
tors for DNA, thus affecting gene expression and regu-
lation. These base modifications thus act as a second
line of genetic information [1].
Prokaryotic DNA methyltransferases (MTases) are
classified into two major groups – exocyclic amino
MTases and endocyclic MTases – based on the
position of the methyl group on the bases. The exocy-
clic amino MTases methylate adenine at the N
6
position and cytosine at the N

4
position, whereas
endocyclic MTases methylate the cytosine at the C
5
position [2,3]. In prokaryotes most of the MTases are
associated with a restriction enzyme and form a
restriction-modification (R-M) system. R-M systems
are involved in the protection of bacteria from bacte-
riophage invasion. However, the identification of
MTases without any associated restriction enzyme in
many bacteria has compelled biologists to explore the
functions of MTases beyond the distinction of self and
nonself DNA. Extensive work on solitary MTases,
Keywords
base flipping; DNA methyltransferase;
Helicobacter pylori; S-adenosyl-
L-methionine;
site-directed mutagenesis
Correspondence
D. N. Rao, Department of Biochemistry,
Indian Institute of Science, Bangalore 560
012, India
Fax: +91 80 2360 814
Tel: +91 80 2293 2538
E-mail:
(Received 18 November 2009, revised 26
December 2009, accepted 25 January 2010)
doi:10.1111/j.1742-4658.2010.07593.x
Genomic sequences of Helicobacter pylori strains 26695, J99, HPAGI and
G27 have revealed an abundance of restriction and modification genes.

hp0050, which encodes an N
6
adenine DNA methyltransferase, was cloned,
overexpressed and purified to near homogeneity. It recognizes the sequence
5¢-GRRG-3¢ (where R is A or G) and, most intriguingly, methylates both
adenines when R is A (5¢-GAAG-3¢). Kinetic analysis suggests a nonpro-
cessive (repeated-hit) mechanism of methylation in which HP0050 methyl-
transferase methylates one adenine at a time in the sequence 5¢-GAAG-3¢.
This is the first report of an N
6
adenine DNA methyltransferase that
methylates two adjacent residues on the same strand. Interestingly, HP0050
homologs from two clinical strains of H. pylori (PG227 and 128) methylate
only 5¢-GAGG-3¢ compared with 5 ¢-GRRG-3¢ in strain 26695. HP0050
methyltransferase is highly conserved as it is present in more than 90% of
H. pylori strains. Inactivation of hp0050 in strain PG227 resulted in poor
growth, suggesting its role in the biology of H. pylori. Collectively, these
findings provide impetus for exploring the role(s) of this conserved DNA
methyltransferase in the cellular processes of H. pylori.
Abbreviations
2AP, 2-aminopurine; AdoMet, S-adenosyl-
L-methionine; Dam, DNA adenine methylase; DLS, dynamic light-scattering; IPTG, isopropyl thio-b-D-
galactoside; K
D
, dissociation constant; LB, Luria–Bertani; MTase, methyltransferase; R
h
, hydrodynamic radius; R-M, restriction-modification.
1666 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
such as DNA adenine methylase (Dam) and cell cycle-
regulated methylase (CcrM), have indeed shown the

role of DNA methylation in regulating cellular events
such as bacterial virulence, cell cycle regulation and
phase variation [4–6].
The Gram-negative bacterium Helicobacter pylori
persistently colonizes the human stomach and is wide-
spread throughout the world. It is a major cause of
gastritis and peptic ulcer disease, and is an early risk
factor for gastric cancer. H. pylori is one of the most
genetically diverse species of bacteria, and strain-spe-
cific genetic diversity has been proposed to be involved
in the organism’s ability to cause different diseases
[7,8]. Analysis of genome sequences of H. pylori strains
26695 and J99 revealed the presence of 23 and 22 R-M
systems, respectively, far more than the number
detected in other bacterial genomes sequenced to date
[9–11]. Two more H. pylori strains – HPAG1 (isolated
from a patient with chronic atrophic gastritis) and
G27 – were sequenced and a similar number of puta-
tive R-M systems were identified [12,13]. Comparison
of strains 26695 and J99 showed that the two genomes
are quite similar, with only 6–7% strain-specific genes.
R-M systems are a major source of the strain differ-
ences [14]. iceA-hpyIM, which encodes a cognate
restriction enzyme and an N
6
adenine methylase has
been studied in various H. pylori strains. It was shown
that hpyIM expression is growth-phase regulated and
required for normal bacterial morphology. Deletion of
hpyIM altered the expression of the stress-responsive

dnaK operon, suggesting that hpyIM may play a role
in H. pylori physiology beyond its R-M function [15].
The Type II MTase, M.HpyAIV, which recognizes the
5¢-GANTC-3¢ site, has been shown to affect the
expression of the katA gene encoding the H. pylori
catalase [16].
H. pylori 26695 has three DNA MTases that lack
cognate restriction enzymes. Vitkute et al. [17] and Lin
et al. [18] showed that HP0050, an orphan N
6
adenine
MTase from H. pylori 26695 recognizes 5¢-GAGG-3¢
and methylates adenine; these findings were based on
the results of a restriction endonuclease assay. The
ORF hp0050 has been reported to be part of an R-M
system that contains two MTases and an inactive
restriction endonuclease. This R-M system was later
assigned as HpyAVI, with hp0050 designated as
M1.HpyAVI, hp0051 as M2.HpyAVI and hp0052 as
HpyAVIP (putative). The hp0050 homolog of H. pylori
strain HPAGI (HPAG1_0046) is a chronic atrophic
gastritis-associated gene [12].
Strain-specific DNA-modification genes are thought
to influence strain-specific phenotypic traits, host speci-
ficity, adaptability to changing micro-environmental
conditions or virulence [14]. The identification and
study of both species-specific and strain-specific
MTases of H. pylori could enhance our understanding
of the pathogenic mechanisms of this organism. Our
findings indicate that hp0050 from strain 26695 has

evolved a relaxed specificity as a result of mutations,
compared with other strains. These observations fur-
ther highlight the capability of this organism to
undergo random mutations and evolve proteins with
new functions.
Results and Discussion
HP0050 is an N
6
adenine MTase from H. pylori and
belongs to the b subgroup of MTases, based on the
linear arrangement of the S-adenosyl-l-methionine
(AdoMet)-binding domain (FXGXG), the target rec-
ognition domain and the catalytic domain (DPPY).
HP0050 MTase is present in all the three sequenced
strains of H. pylori. HP0050 MTase is present in all
the three strains of H. pylori (26695, J99 and HPAGI)
for which genome has been sequenced. The HP0050
proteins from H. pylori J99 and HPAG1 have 91.7%
and 90% identities respectively, to the HP0050 protein
from H. pylori 26695 [19]. In H. pylori 26695, hp0050
exists as an overlapping ORF with another MTase,
hp0051. These MTases are remnant MTases of a
defunct R-M system. Both these ORFs have a high
similarity with the MnlI DNA MTase that belongs to
the Type IIS R-M system [20]. However, in H. pylori
the functional MnlI restriction enzyme is absent [21].
Cloning, overexpression and purification of
HP0050 protein
A 699 bp fragment (Fig. S1A), representing the hp0050
gene from H. pylori 26695, was PCR amplified using

primers 1 and 2 (Table 1) and cloned between the
BamHI and XhoI sites of the expression vector pET28a
(data not shown). A polypeptide of the expected
Table 1. Primers used for cloning and mutagenesis. The restriction
enzyme site is indicated in bold letters. SN, serial number.
SN Primer sequence (5¢-to3¢)
Restriction site
created(+) ⁄
lost(-)
1 GGATCCATGATACAAATTTATCACGCT BamHI (+)
2 CTCGAGTTAAAACAGATTCAAACG XhoI (+)
3 GGATCCGATCTTAAAAAGCTTAAGAAAATG BamHI (+)
4 CTCGAGATTCAAATAGCGTTTTTA XhoI (+)
5 TAGATCCTTCCATGGGGAGCGGCACCACCGGCT NcoI (+)
6 AACCGAAATGTTTAAAGGAGGGTCCGTGATGAT Psi I (-)
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1667
molecular mass (32 kDa) was expressed at high levels
upon induction with 0.5 mm isopropyl thio-b-d-galac-
toside (IPTG) (Fig. S1B). HP0050 was expressed as an
N-terminal His-tagged protein and was purified. As
the purified HP0050 protein has an N-terminal His-
tag, western blot analysis was carried out with anti-His
IgG and a single band corresponding to HP0050 pro-
tein was detected (Fig. S1C). The His-tag was removed
using the Thrombin cleancleave
TM
kit, according to

the manufacturer’s instructions (see the Experimental
procedures). The protein was purified to > 95%
homogeneity, as judged by SDS ⁄ PAGE followed by
silver staining (Fig. S1D).
Peptide finger mapping of HP0050
A peptide finger map of the HP0050 protein was
obtained by digesting purified HP0050 protein with
trypsin and subjecting it to MALDI analysis. The
finger map thus obtained was then matched with
the expected finger map. It was found that eight pep-
tide ions matched with the expected ions, as shown by
the asterisk in Fig. S2A, suggesting the authenticity of
the purified protein.
Oligomeric status of HP0050 protein
HP0050 protein elutes as a monomer, and the molecular
mass was determined to be 28 kDa by analytical gel-fil-
tration chromatography (Fig. S2B). Dynamic light-scat-
tering (DLS) measurements on HP0050 MTase were
performed on a DynaPro DLS instrument using 20 lL
of 1.5 mgÆmL
)1
of protein with a data-acquisition time
of 10 s. Scattering intensities at various time intervals
(ls) with the initial (t = 0 s) intensity were compared
and a combined correlation function was constructed
(inset, Fig. S2C). As seen in Fig. S2C, DLS data, when
fitted to the Stokes–Einstein equation, gave a hydrody-
namic radius (R
h
) of 2.2 nm. The frictional ratio was

calculated as 0.89, suggesting that HP0050 is more or
less spherical in structure. An ideal spherical protein
would give a value of 1.0. Higher values indicate an
anisotropic structure.
Kinetics of methylation reaction
To establish the relationship between the initial veloc-
ity of the reaction and the enzyme concentration, the
rate of DNA methylation catalysed by HP0050 was
determined. pUC19 DNA was used as a substrate.
Different concentrations of HP0050 protein (10–
100 nm) were added to the reaction mixture containing
DNA (80 nm) and AdoMet (2.0 lm) and incubated at
37 °C. When the initial velocities were plotted against
increasing enzyme concentrations, a linear relationship
was obtained (Fig. 1A). This indicated that the initial
velocity of the reaction was directly proportional to
the enzyme concentration. Next, the initial velocities
were determined at various concentrations of the sub-
strates, [
3
H]AdoMet and pUC19 DNA. For the deter-
mination of K
m (DNA)
, a series of similar reactions
containing HP0050 MTase (100 nm), [
3
H]AdoMet
(2.0 lm) and increasing concentration of pUC19 DNA
(10–80 nm) were performed and a conventional hyper-
bolic dependence was obtained. Nonlinear regression

analysis of initial velocity versus DNA concentration
established the K
m (DNA)
as 19.9 ± 3 nm (Fig. 1B).
To determine K
m (AdoMet)
, a series of reactions
containing HP0050 MTase (100 nm), DNA (50 nm)
and increasing concentration of [
3
H]AdoMet (0.3–
12 lm) were performed. Increasing the concentration
of AdoMet led to a progressive stimulation in the
reaction rate. Whereas the initial portion of the
concentration-dependence curve corresponded approx-
imately to a conventional hyperbolic dependence,
saturation was not achieved (Fig. 1C). Similar obser-
vations have been reported for T4 Dam and EcoDam
[22,23].
Determination of site of methylation
The recognition sequence of HP0050 MTase was previ-
ously reported by Vitkute et al. [17], based on restric-
tion enzyme digestion, to be 5¢-GAGG-3¢, where A is
methylated by HP0050 MTase in the target site. Using
different fragments of pUC19 with varying numbers of
GAGG sites (fragments 3 to 6), or fragments not con-
taining GAGG sites (fragments 1 and 2, Table S1), as
a substrates for the methylation reaction by HP0050
MTase, it was observed that besides fragments with
GAGG sites, fragment 2 (without GAGG site) was

also methylated. It should be noted that fragment 2
has one GAAG site, which could be a recognition site
for HP0050 MTase.
There are 20 GAAG and 13 GAGG sites per mole-
cule of pUC19. To further confirm this observation we
used 26 mer duplex substrates (Table 2) with GAGG
(duplex 1), GGAG (duplex 2), GAAG (duplex 3),
GTGG (duplex 4), GAGA (duplex 5) or GmAmAG
(duplex 8) site to determine the specificity of HP0050
MTase. It was found that HP0050 MTase recognized
and methylated GAGG, GGAG and GAAG, but did
not methylate GTGG, GmAmAG or GAGA (Fig. 2).
As HP0050 was able to recognize and methylate both
GAGG and GGAG, it was of interest to determine
which A was the target for the MTase in the oligonu-
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1668 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
cleotide with the GAAG sequence. To address this,
two 26-mer duplex substrates – one with 5¢- GAmAG-
3¢ (duplex 6) and the other with 5¢-GmAAG-3¢ (duplex
7) (where mA is the methyl-adenine) site – were used
individually as a substrate in the methylation assay. It
was found that HP0050 MTase was able to methylate
duplex 6 and duplex 7, suggesting that both adenine
residues were targets for HP0050 MTase (Fig. 2), and
Table 2. Duplex DNA used in this study. The underlined region of
the oligonucleotide represents the HP0050 MTase recognition
sequence, and restriction enzyme sites are shown in bold. 2,2-

amino purine; Bt, biotin; mA, methyl adenine.
Duplex Sequence (5¢-to3¢)
1 TACAATGTACC
GAGGATCTATTGATC
ATGTTACATGGCTCCTAGATAACTAG
2 TACAATGTACC
GGAGATCTATTGATC
ATGTTACATGGCCTCTAGATAACTAG
3 TACAATGTACC
GAAGATCTATTGATC
ATGTTACATGGCTTCTAGATAACTAG
4 TACAATGTACC
GTGGATCTATTGATC
ATGTTACATGGCACCTAGATAACTAG
5 TACAATGTACC
GAGAATCTATTGATC
ATGTTACATGGCTCTTAGATAACTAG
6 TACAATGTACC
GAmAGATCTATTGATC
ATGTTACATGGCTTCTAGATAACTAG
7 TACAATGTACC
GmAAGATCTATTGATC
ATGTTACATGGCTTCTAGATAACTAG
8 TACAATGTACC
GmAmAGATCTATTGATC
ATGTTACATGGCTTCTAGATAACTAG
9 TACAATGTACC
G2GGATCTATTGATC
ATGTTACATGGCTCCTAGATAACTAG
10 TACAATGTACTC

GAAGCTATCTATTGATC
ATGTTACATGAGCTTCGATAGATAACTAG
11 TACAATGTATCAT
GAAGTACTCTATTGATC
ATGTTACATAGTACTTCATGAGATAACTAG
12 TACAATGTATCGC
GAAGCGCTCTATTGATC
ATGTTACATAGCGCTTCGCGAGATAACTAG
13 TACAATGTACTCGAGCTAGATATCTATTTG
GAAGCTGATCGAGTC
ATGTTACATGAGCTCGATCTATAGATAAACCTT
CGACTAGCTCAG
14 ATACTGTACC
GAGGCTGCGATCTAGGTCTGCTGAGG
ATGATGTTGT
TATGACATGGCTCCGACGCTAGATCCAGACGAC
TCCTACTACAACA
15 Bt-TACAATGTACC
GAAGATCTATTGATC
ATGTTACATGGCTTCTAGATAACTAG
16 Bt-ATACTGTACC
GAGGCTGCGATCTAGGTCTGCT
GAGGATGATGTTGT
TATGACATGGCTCCGACGCTAGATCCAGACGAC
TCCTACTACAACA
17 TGCGAGGATGGTCTGTC
GAAGCTGATGTT
ACGCTCCTACCAGACAGCTTCGACTACAA
18 TACAATGTACC
GmAAGCTCTATTGATC

ATGTTACATGGCTTCGAGATAACTAG
A
B
C
600
400
200
0
500
400
300
200
100
0
2500
2000
1500
1000
500
Methyl groups transfered (mol·min
–1
) Methyl groups transfered (mol·min
–1
) Methyl groups transfered (mol·min
–1
)
0
0 20406080
0 20 40 60 80 100
HP0050 (n

M
)
pUC19 DNA (n
M
)
AdoMET (µ
M
)
04812
Fig. 1. Kinetics of methylation. (A) Initial ,velocity versus the con-
centration of HP0050 MTase. Increasing concentrations of HP0050
MTase (10–100 n
M) were incubated with 80 nM pUC19 and 2.0 lM
AdoMet in standard reaction buffer at 37 °C for 15 min, then the
reaction was stopped and analyzed as described in the Experimen-
tal procedures. (B) Determination of K
m (DNA)
. Methylation assays
were carried out in reactions containing 2.0 l
M [
3
H]AdoMet and
increasing concentrations of pUC19 DNA (10–80 n
M) in standard
reaction buffer at 37 °C for 15 min. HP0050 MTase (100 n
M) was
added to start the reaction. The data points were analysed using
nonlinear regression analysis. (C) Initial velocity versus the concen-
tration of AdoMet. Methylation assays were carried out in
reactions containing 50 n

M pUC19 DNA and increasing concentra-
tions of [
3
H] AdoMet (0.3–12 lM) in standard reaction buffer at
37 °C for 15 min. HP0050 MTase (100 n
M) was added to start the
reaction.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1669
this was carried out at different protein concentrations
(data not shown).
Experiments were then performed to estimate the
kinetic constants for these DNA substrates by nonlin-
ear regression analysis. The duplex with GAGG was
the substrate most preferred, with a K
m
of 5.2 lm, and
DNA with a GAAG site was a preferred substrate over
DNA with GGAG, GAmAG or GmAAG sites, with a
K
m
of 13 lm compared with K
m
values of 17 lm,
27 lm or 29 lm, respectively (Table 3). In addition, the
k
cat
⁄ K

m
(specificity constant) was calculated for differ-
ent DNA substrates and it was found that the specific-
ity constant for duplex 1 was 10 times higher than the
specificity constant for duplex 2, suggesting that duplex
1 was a better substrate than duplex 2 (Table 3). The
specificity constant for duplex 3 was 2.1-fold higher
than the specificity constant for duplex 2, and the K
m
values were very similar, which again suggests that both
the adenines are methylated by HP0050 MTase.
Furthermore, to confirm the observation that both
adenines in GAAG are methylated by HP0050 MTase,
duplex 10 (Table 2) was used as a substrate. Duplex 10
contains an HP0050 MTase recognition sequence
(GAAG) with overlapping AluI (AGCT) and TaqI
(TCGA) restriction sites. Upon methylation with
HP0050 MTase if both adenine bases were modified,
the DNA would be resistant to both AluI and TaqI
digestion. It is clear from Fig. 3A that the methylated
duplex is resistant to restriction with AluI and TaqI,
confirming that HP0050 MTase indeed methylates both
the adenines in 5¢-GAAG-3¢. Furthermore, duplex 11
(Table 2) was used, which contains an HP0050 MTase
site (GAAG) with an overlapping ScaI site (AG-
TACT), as a substrate in the methylation assays. Upon
methylation, if the second adenine was methylated in
GAAG, the DNA would be resistant to ScaI digestion.
It was found that upon methylation with HP0050
MTase the duplex DNA was resistant to ScaI digestion

(Fig. S3A). It is possible that HP0050 MTase binds
strongly to the duplex and thus inhibits the cleavage.
To rule out this possibility we used duplex 12, which
contains an HP0050 MTase site (GAAG) with an over-
lapping AfeI site (AGCGCT), as a substrate in the
methylation assays. AfeI is not sensitive to the methyla-
tion status of adenine in its cognate sequence. It was
found that, upon methylation, the duplex DNA was
sensitive to digestion with AfeI (Fig. 3B). In addition,
duplex 13 was used, which contains two AluI sites –
one overlapping with the HP0050 MTase site (GAAG)
and other 15 bp away from it. When duplex 13 was
methylated by HP0050 MTase and then digested with
AluI, two fragments were obtained. It was observed
that, upon methylation, the AluI site overlapping with
the HP0050 MTase cognate sequence became resistant
to AluI digestion. However, three fragments of same
size were obtained when unmethylated duplex 13 was
digested with AluI (Fig. S3B). To eliminate the possibil-
ity that AluI is blocked by modification immediately
outside its recognition site, duplex 18 was used. Duplex
18 has a GAAG site with an overlapping AluI site and
in which the first A was methylated (GmAAG). Duplex
18 was completely digested with AluI, suggesting that
the modification immediately outside the recognition
site of AluI has no effect on its activity (Fig. S3C).
1600
1200
800
400

0
0 5 10 15
Oligonucleotide (µ
M
)
Methyl groups transfered
(mol·min
–1
)
GAGG
GAAG
GGAG
GmAAG
GAmAG
GTGG
GAGA
GmAmAG
Fig. 2. Specificity of HP0050 MTase. (A) Methylation activity of
HP0050 MTase as a function of increasing concentrations of differ-
ent 26-mer duplex DNA species. Methylation assays were carried
out in reactions containing 2.0 l
M [
3
H]AdoMet and increasing con-
centrations of 26-mer duplex DNA (2.5–15 l
M), with one GAGG site
or with a modified GAGG site, in standard reaction buffer at 37 °C.
HP0050 MTase (100 n
M) was added to start the reaction. (d,
GAGG;

, GAAG; , GGAG; ., GmAAG; r, GAmAG; s, GTGG; h,
GAGA; D, GmAmAG). mA, methyl adenine.
Table 3. Kinetic parameters for HP0050 N
6
adenine methyltransferase.
K
m
(M) k
cat
(s
)1
) k
cat
⁄ K
m
(M
)1
Æs
)1
)
pUC19 1.9 ± 0.3 · 10
)8
0.5 ± 0.05 · 10
)2
2.6 · 10
5
Duplex 1 (GAGG) 5.2 ± 1.0 · 10
)6
2.4 ± 0.05 · 10
)2

4.6 · 10
3
Duplex 2 (GGAG) 17.0 ± 2.0 · 10
)6
0.8 ± 0.03 · 10
)2
0.47 · 10
3
Duplex 3 (GAAG) 13.0 ± 3.0 · 10
)6
1.1 ± 0.02 · 10
)2
0.84 · 10
3
Duplex 6 (GAmAG) 27.0 ± 1.0 · 10
)6
0.3 ± 0.03 · 10
)2
0.11 · 10
3
Duplex 7 (GmAAG) 29.0 ± 2.0 · 10
)6
0.2 ± 0.02 · 10
)2
0.07 · 10
3
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1670 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS

To further confirm the methylation of adjacent ade-
nines in GAAG, we used duplex 17, which contains a
FokI site (GGATG) and GAAG, which is 7 bp away
from the FokI site. Duplex 17 was used as a substrate
and the methylation reaction was carried out in the
presence of [
3
H] AdoMet. The methylated duplex was
purified and then digested by FokI, which resulted in
two fragments, each containing one adenine from
GAAG. These fragments were separated by electro-
phoresis on a 20% polyacrylamide gel and then
checked for the incorporation of radiolabel. It was
found that both fragments were labelled, confirming
that HP0050 MTase indeed methylates both the ade-
nines in 5¢-GAAG -3¢ (Fig. 4). It is worth mentioning
here that the Type IIS MnlI R-M system, comprising
N
6
adenine and C
5
cytosine MTase and a restriction
endonuclease, recognizes the nonpalindromic nucleo-
tide sequence 5¢-CCTC(N)7 ⁄ 6-3¢. While the C
5
MTase
modifies the first cytosine base within the 5¢-CCTC-3¢
sequence, the N
6
adenine MTase methylates the

bottom strand of the MnlI target, resulting in
5¢-G mAGG. Interestingly, these two MTases share
the greatest degree of similarity with HP0050 MTase
and HP0051 MTase from H. pylori 26695 [20]. In the
case of the FokI MTase, two domains are responsible
for methylating two adenine residues – one in the
upper strand and one in the lower strand [24].Yet
another variation is seen in the case of MmeI, where it
has been reported that MmeI modifies the adenine in
the top strand of the recognition sequence 5¢-TCC
RAC-3¢ and uses modification only on one of the two
DNA strands for host protection [25]. Interestingly,
M.Alw261, M.Eco31l and M.Esp3l methylate both
strands of their recognition sites, yielding C
5
methyl
AluITaqI
Unmethylated duplex 10 Methylated duplex 10
M
*
29 mer
12 mer/13 mer
AluI
AluI+TaqI
TaqI
UD
AluI
AluI+TaqI
TaqI
UD

Unmethylated
duplex 12
Methylated
duplex 12
M
50 bp
30 bp
12 bp
AfeI
A
feI
UD
A
feI
UD
A
B
Fig. 3. Comparison of restriction digestion patterns of methylated and unmethylated duplex DNA. (A) Restriction digestion of 29-mer duplex
10. M, molecular mass marker, AluI and TaqI denote digestion of duplex 10 with these respective enzymes. Schematic representation of
the 29-mer duplex 10 is shown with HP0050 MTase and overlapping AluI and TaqI sites. (B) Restriction digestion of the 30-mer duplex 12.
AfeI denotes digestion of duplex 12. Schematic representation of the 30-mer duplex 12 is shown with HP0050 MTase and an overlapping
AfeI site. The underlined region of the oligonucleotide represents the HP0050 MTase recognition sequence. UD, undigested duplex.
* Corresponds to a 50-bp band in the marker.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1671
cytosine and N
6
methyl adenine on opposite strands

[26]. To the best of our knowledge, M.CviPII is the
only other DNA MTase that modifies adjacent resi-
dues in the cognate sequence. In addition to modifyng
the first cytosine in CCD (D = A, G or T) sequences,
M.CviPII also modifies both the cytosines in CCAA
and CCCG sites [27].
Processivity of DNA methylation
HP0050 MTase methylates adjacent adenines in
GAAG. The methylation can take place either in a sin-
gle binding event or in two separate binding events.
To address this, 100 nm HP0050 MTase was pre-incu-
bated with 5 lm AdoMet for 10 min at 37 °C to pro-
mote the formation of the protein–AdoMet complex.
This complex was then made catalytically competent
by adding 2 lm duplex 15 and incubated for an addi-
tional 5 min on ice to allow the formation of a ternary
complex. Following the second incubation, the reac-
tion mixture was split in two and 40 lm duplex 3 was
added in one set as a trap and the other set was
allowed to proceed without the DNA trap. Both the
reaction mixes were incubated at 25 °C, and reaction
aliquots withdrawn at 2 min intervals were checked for
methylation. The reaction mixes were incubated at
25 °C in order to decrease the turnover rate so that
the first turnover could be monitored.
If HP0050 MTase methylates in a nonprocessive
manner, it would dissociate from the substrate mole-
cule after each round of methylation and would
re-associate in the next round of catalysis. If, however,
the MTase works in a processive manner, then it would

dissociate from the substrate molecule after methylating
both the adenines in GAAG (duplex 15). A biotin–
avidin microplate assay was used to separate biotiny-
lated substrate from nonbiotinylated duplex DNA and
to monitor the methylation of biotinylated substrate.
The addition of a molar excess of duplex 3 to duplex
15 at different time-points of the modification reaction
of the GAAG substrate resulted in a decrease in the
rate of methylation of duplex 15 (Fig. 5A). This result
clearly suggests that HP0050 methylates adjacent
adenines in a nonprocessive manner.
To determine if HP0050 MTase methylates the
duplex with two recognition sites in a nonprocessive
manner, we used duplex 16 containing two GAGG
sites (duplex 14 with a 5¢ biotin tag) as a substrate and
duplex 14 as competitor DNA. The biotin–avidin mi-
croplate assay was used to separate biotinylated sub-
strate from nonbiotinylated duplex DNA and to
monitor the methylation of biotinylated substrate. It
was observed that, in the presence of a 20-fold excess
of nonbiotinylated duplex DNA, the extent of the
methylation reaction did not increase, but in the
absence of nonbiotinylated competitor, methylation
was observed (Fig. 5B). This suggests a distributive
mechanism of methylation. In this assay, EcoDam was
used as a positive control for the processive mecha-
nism of methylation (data not shown).
Yet another approach was used to show the proces-
sivity of HP0050. A 294 bp dsDNA containing a
GAAG site with overlapping AluI and TaqI sites (simi-

lar to duplex 10) was used for the methylation assay.
The master mix (400 lL) containing 1 lm HP0050
MTase was incubated with 5 lm [
3
H] AdoMet and
Fragment 1 Fragment 2
12
Duplex 17
FokI
29 bp
1
19
10
2200 ± 150
Fragment c.p.m.
Duplex 17
Fragment 1 (19 bp) 950 ± 100
Fragment 2 (10 bp) 850 ± 100
20% PAGE
Fig. 4. Analysis of the methylation pattern
of HP0050 MTase. Duplex 17 was methylat-
ed by HP0050 MTase using [
3
H]AdoMet.
After cleavage with FokI, the DNA was
electrophoresed through a 20% polyacryl-
amide gel and specific restriction fragments
(Fragments 1 and 2) were isolated. The
labelled methyl group contents of the
fragments are shown in counts per minute

(c.p.m.).
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1672 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
3 lm of 294 bp dsDNA at 25 °C (to decrease the turn-
over). Two aliquots (of 25 lL each) were withdrawn at
3-min intervals up to 15 min and the reactions were
stopped by snap-freezing in liquid nitrogen. One ali-
quot from each time-point was analyzed for protection
from AluI digestion and the other for protection from
TaqI digestion (Fig. 6). If HP0050 methylates adjacent
adenines in a processive manner there should not be
any difference in the resistance to AluI digestion and
to TaqI digestion. However, if HP0050 methylates
adjacent adenines in a nonprocessive manner then the
substrate DNA should show early resistance to TaqI
digestion compared with AluI digestion.
It is evident from Fig. 6 that after 3 min the sub-
strate starts showing resistance to TaqI digestion but
shows AluI resistance only at the 6-min time-point.
These results suggest that HP0050 methylates adjacent
residues in a nonprocessive manner. In general, DNA
MTases accompanied with a restriction enzyme, such
as M.EcoRI exhibit a nonprocessive mechanism of
action, whereas solitary MTases, such as T4 Dam and
EcoDam, methylate DNA in a processive manner [3].
Purification and characterization of
AdoMet-binding motif (F195S) and catalytic
motif (Y32L) HP0050 mutant proteins

All N
6
adenine MTases have conserved characteristic
motifs such as the AdoMet-binding motif (FXGXG)
and the catalytic motif (DPPY). Several research
groups have performed mutational studies on amino
acids in these motifs, which, in turn, have revealed the
significance of these motifs in catalysis [1,3]. For
instance, Pues et al. [28] have shown in the case of
M.TaqI that replacement of Y108 with alanine or
glycine resulted in mutant MTases with reduced enzy-
matic activities, which highlights the importance of
tyrosine in the methylation activity. It was shown that
the replacement of F39 with alanine in the AdoMet-
binding motif of M.EcoRV abrogated AdoMet binding
[29]. Site-directed mutagenesis was performed to
replace F195 and Y32 of HP0050 MTase by serine and
lysine, respectively. Both the AdoMet-binding motif
(F195S) and the catalytic motif (Y32L) HP0050
mutant proteins were purified to near homogeneity
and analyzed on an SDS-polyacrylamide gel for altera-
tions in their electrophoretic mobilities. Both mutant
proteins fractionated like the wild-type HP0050 protein
and no apparent changes were detected. To determine
the size and subunit structure of the HP0050 mutant
proteins in solution, gel-filtration chromatography was
performed and it was found that the mutant proteins
eluted as monomers with a molecular mass of 28 kDa
(data not shown). Analysis of the wild-type, F195S
and Y32L mutants did not reveal significant differ-

ences in the CD spectra (data not shown), indicating
that the amino acid exchanges did not affect the over-
all structure of the mutant proteins.
HP0050+AdoMet
HP0050-AdoMet
Binary complex
at 37°C
+Duplex 15/16
HP0050-AdoMet-DNA
Ternary complex at 4°C
+ competitor – competitor
0
0
2468
Time (min)
Without competitor
Without competitor
Competitor added at 0 min
Competitor added at 0 min
Competitor added at 4 min
Competitor added at 4 min
Competitor added at 8 min
Competitor added at 8 min
10 12 14 16
02468
Time (min)
10 12 14 16
100
Methyl groups transfered (fmol)
Methyl groups transfered (fmol)

200
300
400
600
400
200
0
AB
Fig. 5. Nonprocessive methylation catalyzed by HP0050 MTase. HP0050 MTase (100 nM) was incubated with 5 lM [
3
H]AdoMet at 37 °C for
10 min to facilitate formation of the HP0050–AdoMet binary complex and then the 2 l
M duplex 15 or duplex 16 was added. The mixture
was incubated on ice for 5 min to allow the formation of a ternary complex. Then, the mixture was divided into two sets and 40 l
M duplex
3 or duplex 14 was added to one set at different time-points (
, 0 min; , 4 min; and ., 8 min) and the other set was allowed to proceed
without a DNA trap (d), as described in the Experimental procedures. The reaction was monitored at 2-min time intervals by processing
25 lL of the reaction mixture in duplicate. (A) Duplex 15; (B) duplex 16.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1673
The methylation activity of both the mutant
proteins was analysed as a function of increasing
enzyme concentration. It was found that both the
mutant proteins were catalytically inactive compared
with wild-type HP0050 MTase (Fig. 7A). The loss of
activity could be a result of the inability of these
mutant proteins to bind to one or both substrates. To

investigate the AdoMet binding of the F195S mutant,
fluorescence emission spectra and fluorescence intensi-
ties were measured in the presence of different concen-
trations of AdoMet. The F195S mutant protein
showed significantly less quenching in the presence of
AdoMet (up to 80 lm) compared with wild-type
HP0050 MTase. The K
a
value for AdoMet was calcu-
lated (using a modified Stern-Volmer plot) as 7 lm for
the wild-type protein and (using a Stern–Volmer plot)
as 64 lm for the F195S mutant (Fig. S4), which is
nine times higher than that obtained for the wild-type
MTase. This result showed that the F195S mutant was
not able to bind to the AdoMet as effectively as the
wild-type protein, therefore resulting in the loss of
activity. When the Y32L mutant protein was analysed
for its AdoMet-binding property, it was found to
binds to AdoMet as efficiently as wild-type HP0050
MTase (Fig. S4) but was catalytically inactive
(Fig. 7A).
DNA distortion induced by wild-type HP0050
MTase upon binding to 2-aminopurine-containing
duplexes
Most DNA MTases flip the target base within the cog-
nate sequence [30]. The fluorescence of 2-aminopurine
(2AP) is often used as a signal for base flipping
because it shows enhanced fluorescence when its envi-
ronment is perturbed. However, it is now well estab-
lished that the enhancement of 2AP fluorescence is a

more general measure of DNA distortion [31]. To
study the change in DNA conformation in the
enzyme–DNA complex, we used the 2AP fluorescence-
based assay. Irradiation of oligonucleotide (upper
strand, duplex 9) containing 2AP at a target base
instead of at an adenine base, at 320 nm produced a
strong fluorescence emission spectrum with a k
max
at
375 nm (Fig. 7B). Annealing of this oligonucleotide
with the complementary strand resulted in a decrease
of approximately threefold in fluorescence intensity at
375 nm. When HP0050 MTase (100 nm) was incubated
with 200 nm double-stranded 2AP DNA (duplex 9,
Table 2), a fivefold increase in 2AP fluorescence was
observed. The increased fluorescence observed upon
enzyme binding was more substantial than the fluores-
cence of the single-stranded 2AP oligonucleotide. This
suggests that the increased fluorescence was not just
caused by an enzyme-induced local unwinding of the
helix resulting in a region of single-stranded DNA sur-
rounding the 2AP, but possibly a result of DNA dis-
tortion caused by binding of the protein. The addition
of 1 lm sinefungin (an AdoMet analog) resulted in
further enhancement of fluorescence. Interestingly, the
addition of sinefungin shifted the fluorescence emission
spectrum 10 nm towards a longer wavelength. This
could be because of a change in the environment of
the adenine base upon the addition of sinefungin. By
contrast, the Y32L mutant of the HP0050 MTase

failed to show any increase in fluorescence, suggesting
that, unlike the wild-type MTase, the mutant protein
was not able to interact with DNA, and this could be
the reason for being catalytically inactive. When the
F195S mutant was incubated with double-stranded
2AP DNA (duplex 9, Table 2), an increase in 2AP
fluorescence was observed, but the addition of 1 lm
sinefungin did not lead to further enhancement of
fluorescence. This is in agreement with the observation
TaqI
AluI
TaqI
294 bp
150/146 bp
1.6% Agarose gel
AluI
0
0 5 10 15 20
10
20
30
40
50
Taql
Alul
Time (min)
DNA protected from cleavage (%)
Fig. 6. Nonprocessive methylation of adjacent adenines in 5¢-
GAAG-3¢ by HP0050 MTase. HP0050 MTase (1 l
M) was incubated

with 5 l
M [
3
H]AdoMet and 3 lM of 294-bp dsDNA at 25°. Two
aliquots (each 25 lL) were withdrawn at 3-min intervals up to
15 min and the reactions were stopped by snap-freezing in liquid
nitrogen. One of these aliquots was analyzed for protection from
digestion with AluI(
) and the other was analyzed for protection
from digestion with TaqI(d).
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1674 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
that the F195S protein does not bind AdoMet. Using
the 2AP fluorescence-based assay, enhancements in flu-
orescence upon enzyme binding to canonical sequences
have been reported with other MTases, such as
EcoDam [32] and T4Dam [33].
Distribution of hp0050 in clinical H. pylori isolates
The strains of H. pylori (26695, J99 and HPAG1) for
which the genome sequence is available were isolated
from patients with superficial gastritis, duodenal ulcer
and chronic atrophic gastritis, respectively. In the pres-
ent study a number of clinical isolates of H. pylori
were screened for the presence of hp0050. hp0050 was
found to be present in 97.14% of strains obtained
from patients [n = 73 (Kolkata strains)] compared
with 90.63% of strains from healthy volunteers
[n = 32 (Santhali strains)] (data not shown). Primers 3

and 4 (Table 1) were used to amplify hp0050 homo-
logs. The functionality of HP0050 MTase in the strains
was checked by digestion with MnlI. If a strain has a
functional MTase then the genomic DNA will be resis-
tant to digestion with MnlI. It was found that all
strains which were positive for the presence of hp0050
by PCR were resistant to digestion with MnlI (data
not shown). Kolkata strains are H.pylori isolates from
patients suffering from ulcer, gastritis or cancer,
whereas Santhali strains are isolates from healthy vol-
unteers [34]. The hp0050 gene from two clinical isolates
(strain PG227 isolated from a patient suffering from
duodenal ulcers and strain 128 isolated from a patient
with antral gastritis) was cloned into the BamHI and
XhoI sites of pET28a, overexpressed and the proteins
purified as mentioned in the Experimental procedures.
Both were found to be as active as wild-type HP0050
MTase (from H. pylori 26695), and, in the presence of
1 lm sinefungin, which is a competitive inhibitor of all
MTases, methylation activity was inhibited by 70%,
similarly to the wild-type MTase (data not shown).
The hp0050 gene from H. pylori strains PG227 and
128 was sequenced and found to be 89% similar to its
homolog from strain 26695 (Fig. 8A).
Interestingly, when HP0050 MTase homologs were
checked for their specificity, it was found that HP0050
MTase from strains PG227 and 128 methylate GAGG
but do not methylate GAAG or GGAG (Fig. 8B).
A dot-blot assay was performed to further confirm this
observation using duplexes 1, 2 and 3 (Table 2)

(Fig. 8C–D). These observations suggest that because
of mutations, hp0050 from strain 26695 has evolved
relaxed specificity. HP0050 MTase from strain 26695 is
able to methylate GAAG and GGAG, whereas its
homologs from strains PG227 and 128 lack this speci-
ficity as they methylate only GAGG. Because HP0050
is an orphan MTase and lacks a cognate restriction
enzyme, it can afford to undergo mutations that result
in changed specificity.
Isolation and characterization of the Dhp0050
derivative of H. pylori
Transcriptional regulation by methylation patterns has
been described for a number of prokaryotes, where
promoter methylation alters the interaction of regula-
Methyl groups transferred
(femtomol·min
–1
)
Duplex 9 + wild type HP0050 MTase + Sf
a
Enzyme (n
M)
Wild type
a
b
Duplex 9 + F195S
c
Duplex 9 + F195S + Sf
d
F195S

Y32L
Duplex 9 + wild type HP0050 MTase
d
Duplex 9 + Y32L
e
ss 2AP DNA
f
g
Duplex 9
h
Wild type HP0050 + Sf
B
A
800
Wild type
Y32L
F195S
550
440
Relative intensity
330
220
110
0
350 400
450
500
Wavelength (nm)
600
400

200
0
020406080
Fig. 7. Characterization of HP0050 MTase Y32L and F195S mutants. (A) Initial velocity versus enzyme concentration. Increasing concentra-
tions of wild-type or mutant HP0050 MTase (10–80 n
M) were incubated with 80 nM pUC19 and 2.0 lM AdoMet in the presence of 10 mM
Tris ⁄ HCl, pH 8.0, containing 5 mM b-mercaptoethanol, at 37 °C for 15 min. The reactions were stopped and analyzed as described in the
Experimental procedures. (
) wild type, (•) Y32L, ( ) F195S. (B) Steady-state fluorescence emission spectra of 2AP-substituted DNA with
HP0050 MTase. Spectra were recorded after incubating 100 n
M enzyme and 200 nM duplex 9 for 15 min on ice in 10 mM Tris ⁄ HCl, pH 8.0,
containing 5 m
M b-mercaptoethanol. The total volume of the reaction mixture was 400 lL. Curve a, HP0050 MTase with duplex 9 in the
presence of 1 l
M sinefungin; curve b, F195S mutant with duplex 9; curve c, F195S mutant with duplex 9 in the presence of 1 lM sinefungin;
curve d, HP0050 MTase with duplex 9; curve e, Y32L mutant with duplex 9; curve f, 2AP ssDNA; curve g, duplex 9; curve h, HP0050
MTase with sinefungin.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1675
tory proteins with their target DNA [4,5]. To investi-
gate the role of the HP0050 MTase in gene regulation,
a knockout of hp0050 was constructed in H. pylori
strain 227, as described in the Experimental procedures
(Fig 9A). An electroporation protocol, which includes
20 h of outgrowth for recovery from electric shock
and expression of the chloramphenicol gene, was used,
first to replace the wild-type hp0050 allele with the
hp0050 deletion allele (marked with cat, a Cam

r
deter-
minant) in eight different H. pylori strains. As a con-
trol we used a knockout construct for HP0051 (a C
5
cytosine MTase from H. pylori). Surprisingly, a large
number of H.pylori strains were obtained with nor-
mally growing chloramphenicol-resistant colonies con-
taining HP0051 MTase (data not shown) but for
hp0050 the chloramphenicol-resistant colonies could be
HP0050
strain 26695
0
20
40
GAGG
GAAG
GGAG
Activity (%)
60
80
100
HP0050
strain PG227
HP0050
strain 128
26695
26695
Duplex 1
GAGG

CTCC
Duplex 2
GGAG
CCTC
Duplex 3
GAAG
CTTC
Duplex 1
GAGG
CTCC
Duplex 2
GGAG
CCTC
Duplex 3
GAAG
CTTC
PG227PG227
128
A
B
CD
Fig. 8. (A) Multiple sequence alignment of HP0050 MTase from Helicobacter pylori strains 26695, PG225 and 128. (B) Methylation activity
of HP0050 MTase homologs from H. pylori strains 26695, PG227 and 128. HP0050 MTase (50 n
M) was incubated with 1 lM duplex 1,
duplex 2 or duplex 3 in independent reactions and with 2.0 l
M AdoMet in standard reaction buffer at 37 °C for 15 min. Then, the reaction
was stopped and analyzed as described in the Experimental procedures. Dot-blot assays were carried out to check the specificity of HP0050
from different strains of H. pylori. (C) Dot-blot assay of HP0050 from strain 26695 versus HP0050 from strain PG227. (D) Dot-blot assay of
HP0050 from strain 26695 versus HP0050 from strain 128.
N

6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1676 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
obtained only in strain PG227. PCR was performed
using different sets of primers to confirm the replace-
ment of the wild-type allele with the deletion allele
(Fig 9B). It was observed that Dhp0050 derivatives of
H. pylori grew very slowly compared with wild type
H. pylori (Fig 9C–D). It has been shown earlier that
disruption of DNA adenine methylase of Salmo-
nella typhimurium resulted in an alteration in colony
morphology [35]. This suggests the possible significance
of hp0050 in the physiology of H. pylori. However,
further analyses are required to understand, in greater
detail, the role of this DNA MTase.
Most H. pylori strains possess a large number of
MTase genes, many of which are strain-specific [36].
hpyIM (5¢-CATG-3¢) is the only MTase whose activity
is present among all strains, suggesting a strong selec-
tion for this phenotype. Its universality, despite the
absence or inactivity of its cognate endonuclease from
the great majority of strains, suggests that its function
may extend beyond host defence [37].
H. pylori has a very plastic genome. It undergoes
random changes, and this ability is used by it to adapt
according to a changing microenvironment or mac-
roenvironment. In this report we show that HP0050,
an N
6
adenine MTase from H. pylori strain 26695, can

methylate two adjacent residues on the same strand,
but HP0050 homologs from H. pylori strains PG227
and 128 lack this property. These results clearly dem-
onstrate that in H. pylori, because of random muta-
tions, genes can evolve with unique functions in a
case-specific manner.
It has been demonstrated that DNA methylation,
especially adenine methylation, plays an important role
in pathogenesis in number of bacterial pathogens [4,5].
Epigenetic regulation of pathogenesis thus makes N
6
adenine MTase an interesting target for drug design
[38]. The lack of adenine methylation in higher eukary-
otes has sparked interest in targeting adenine MTases
for the development of new antibiotics. A detailed
understanding of both the structure and mechanism of
N
6
adenine MTases thus becomes important.
Experimental procedures
Strains and plasmids
H. pylori 26695 (cagA
+
iceA1 vacAs1am1) genomic DNA
was obtained as a gift from New England Biolabs (Bever-
ley, MA, USA). Escherichia coli strain DH5a [F’end A1
hsd R17 (r
k
)
m

k
)
) glnV44 thi1 recA1 gyrA (Nal
R
) relA1 D
(lacIZYA – argF) U169 deoR{F80dlac D (lacZ)M15}] was
used as a host for the preparation of plasmid DNA. E. coli
BL21 (DE3) pLysS- F
)
ompT hsdS
B
(r
B
)
m
B
)
) gal
(dcm)(lon) (DE3) pLysS (cam
R
) cells were used to express
wild-type and mutant HP0050 proteins.
PCR amplification and cloning of the hp0050
gene of H. pylori 26695 and other clinical isolates
The 699 bp hp0050 gene was amplified from the genomic
DNA of H. pylori 26695 by PCR with Pfu polymerase
using primers 1 and 2 (Table 1). Primers 3 and 4 were used
to amplify the hp0050 homolog from strains PG227 and
128. The primers were designed with the help of the
annotated complete genome sequence of H. pylori 26695,

considering the putative gene sequence of hp0050, obtained
from TIGR. The amplified PCR fragment was cloned into
the bacterial expression vector pET28a at BamHI and XhoI
sites.
I
III
IV
Δhp0050::cam
II
1 2 3
1 2 3
2.0 kb
1.5
2 kb
1
1.8 kb
1.1
1.4 kb
0.7
1.0
0.750
1
H. pylori strain 227
H. pylori strain 227Δhp0050
A
B
DE
C
Fig. 9. Construction and characterization of Helicobacter pylori
strain 227Dhp0050. (A) Approximate positions of PCR primers flank-

ing hp0050 used for screening the hp0050 knockout are indicated
by arrows. Screening the hp0050 knockout by PCR is shown in
panels B and C. (B) Lane 1, amplification of the hp0050 locus from
a colony of the wild-type strain 227 using primers III and IV; lane 2,
amplification of the hp0050 locus from a chloramphenicol-resistant
colony using primers III and IV; lane 3, 1-kb DNA ladder. (C) Lane 1,
amplification of the hp0050 locus from a chloramphenicol-resistant
colony using primers I and II; lane 2, amplification of the hp0050
locus from a colony of the wild-type strain 227 using primers I and
II; lane 3, 1-kb DNA ladder. H. pylori strain 227 and H. pylori strain
227Dhp0050 growing on brain heart infusion agar (BHIA) plates are
shown in panels D and E. (D) H. pylori strain 227. (E) H. pylori
strain 227Dhp0050.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1677
Over-expression of HP0050 N
6
adenine MTase of
H. pylori
The pET28a–hp0050 construct DNA was transformed into
E. coli BL21 (DE3) pLysS cells [39]. Individual colonies,
obtained after transformation, were inoculated into Luria–
Bertani (LB) broth containing 50 lgÆmL
)1
of kanamycin and
grown overnight at 37 °C. Then, 1% of this primary inocu-
lum was re-inoculated into fresh LB containing 50 lgÆmL
-1

of
kanamycin and grown to an D
260
0.6. The production of
HP0050 protein was induced by the addition of 0.5 mm
IPTG. After 4 h of incubation at 30 °C, the culture was
cooled on ice and approximately equal numbers of bacterial
cells from uninduced and induced cultures were harvested by
centrifugation at 5000 rpm for 10 min. The induction of
HP0050 protein was verified by electrophoresis, on a 10%
SDS-polyacrylamide gel, of crude cell extract obtained by
sonication in SDS ⁄ PAGE buffer containing dye. As controls,
inductions were checked in E. coli BL21 (DE3) pLysS cells
minus the pET28a vector and in E. coli BL21 (DE3) pLysS
cells containing the pET28a vector minus the hp0050 gene.
Purification of wild-type and mutant HP0050 N
6
adenine MTases
E. coli BL21 (DE3) pLysS cells harboring pET28a–hp0050
constructs were grown in 600 mL of LB broth, containing
50 lgÆmL
)1
of kanamycin, to an D
260
of 0.6 and the expres-
sion of HP0050 protein was induced by the addition of
IPTG, to a final concentration of 0.5 mm,at30°C. After
4 h of induction at 30 °C, the culture was cooled on ice and
the cells were harvested by centrifugation at 8000 rpm for
30 min at 4 °C. All purification steps were carried out at

4 °C. The cell pellet was resuspended in extraction buffer
(10 mm Tris ⁄ HCl, pH 8.0, 0.05% Triton-X 100, 100 mm
l-arginine, 100 mm NaCl and 50 mm imidazole) and lysed
by sonication. The cell lysate was centrifuged for one hour at
8000 rpm, at 4 °C. Supernatant containing HP0050 protein
was loaded onto a Ni-nitrilotriacetic acid column, which had
been previously equilibrated with the above-mentioned buf-
fer. The enzyme was eluted with 10 mL of 10 mm Tris ⁄ HCl,
pH 8.0, containing 100 mm NaCl and 200 mm imidazole.
The eluted enzyme was dialysed overnight at 4 °C against
10 mm Tris ⁄ HCl, pH 8.0, containing 100 mm NaCl, 10 mm
b-mercaptoethanol and 30% glycerol. The purity of the pro-
tein preparation was judged by SDS ⁄ PAGE followed by
Coomassie Brilliant Blue staining [40] and silver staining
[41]. Protein was estimated by the method of Bradford using
BSA as a standard [42] and by measuring the absorbance at
280 nm (the extinction coefficient of HP0050 was calculated
as 39970 m
)1
Æcm
)1
). As the purified HP0050 protein has an
N-terminal His-tag, western blot analysis [39] was carried
out using anti-His Ig (GE Healthcare, Chalfont St Giles,
UK). The N-terminal His tag was removed using the Throm-
bin cleancleave
TM
kit (Sigma).
Methylation activity
To monitor the methylation activity of wild-type and

mutant HP0050 MTases, two types of assays were used.
In vitro methylation
All methylation assays monitored the incorporation of triti-
ated methyl groups into DNA by using a modified ion-
exchange filter-binding assay [43]. Methylation assays were
carried out in a reaction mixture (25 lL) containing super-
coiled pUC19 plasmid DNA or duplex DNA, which
harbors a single recognition sequence (Table 2), [
3
H]Ado-
Met (specific activity 66 CiÆmmol
)1
) and purified protein in
the reaction buffer (10 mm Tris ⁄ HCl, pH 8.0, 5 m m b-mer-
captoethanol). After incubation at 37 °C for 15 min, the
reactions were stopped by snap-freezing in liquid nitrogen.
Background counts were measured at zero-time incubation,
the incubation in the absence of enzyme was subtracted
and the data were analysed. All methylation experiments
were carried out at least in triplicate and the results were
averaged. Standard deviations of the average methylation
rates were < 10%.
Sensitivity to restriction endonucleases
To investigate methylation by HP0050 MTase, 250 pmol of
a 29-mer duplex (Table 2) containing one GAAG site with
overlapping AluI and TaqI sites (duplex 10), a 30-mer
duplex containing one GAAG site with an overlapping ScaI
site (duplex 11), a 30-mer duplex containing one GAAG
site with an overlapping AfeI site (duplex 12) and a 45-mer
duplex containing two AluI sites (duplex 13) – one overlap-

ping with the HP0050 MTase site – were incubated sepa-
rately with purified protein in the presence of 15 lm
AdoMet in reaction buffer (10 mm Tris ⁄ HCl, pH 8.0, 5 mm
b-mercaptoethanol) for 5 h at 37 °C followed by inactiva-
tion of protein by heating at 95 °C for 20 min. DNA was
purified and duplex 10 was digested with TaqI and AluI,
duplex 11 was digested with ScaI, duplex 12 was digested
with AfeI and duplex 13 was digested with AluI overnight,
and then all were analysed by electrophoresis on a 20%
polyacrylamide gel.
Processivity studies
A master mix (500 lL) containing 100 nm HP0050 MTase
was incubated with 5 lm [
3
H]AdoMet at room temperature
for 10 min to facilitate the formation of the HP0050–Ado-
Met binary complex; this was followed by the addition of
2 lm duplex 15 or duplex 16 as substrates (Table 2). This
mixture was incubated on ice for 5 min to facilitate the
formation of the HP0050–AdoMet–DNA ternary complex.
An aliquot of 250 lL was removed and mixed with a 20-
fold excess of duplex 3 or duplex 14 as a trap for MTase,
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1678 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
and the other half of the reaction mixture was mixed with
100 lL of water. Both reaction mixes were incubated at
25 °C, aliquots (25 lL) were withdrawn at 2-min intervals
up to 16 min and the reactions were stopped by snap-freez-

ing in liquid nitrogen and later analyzed. The number of
methyl groups transferred was analyzed using the Biotin–
avidin microplate assay, as described earlier [44].
MS
MALDI-MS data were acquired on an Ultraflex TOF ⁄ TOF
spectrometer (Bruker Daltonics, Billericia, MA, USA and
Bremen, Germany), equipped with a 50 Hz pulsed nitrogen
laser (l¼337 nm), operated in positive ion reflectron mode
using a 90-ns time delay, and a 25 kV accelerating voltage.
The samples were prepared by mixing an equal amount
of peptide (0.5 mL) with matrices dihydroxybenzoic acid ⁄
a-cyano-4-hydroxycinnamic acid saturated in 0.1% trifluo-
roacetic acid and acetonitrile (1 : 1, v ⁄ v). Masses below
500 m ⁄ z were not considered as a result of interference
from the matrix.
DLS
DLS measurement on the HP0050 protein was performed
on a DynaPro DLS instrument using 20 lLofa
1.5 mgÆmL
)1
protein concentration with a data-acquisition
time of 10 s. The protein sample was filtered through a
0.2 mm filter before measurements were taken. dynamics
v.6 software was used to calculate the R
h
of the HP0050
protein. The data were analysed to obtain the diffusion
coefficient (D
20,w
), which, in turn, was used to calculate the

R
h
values for each sample. The reported R
h
value is the
mean size of the dominant peak. The R
h
value was
obtained from the Stokes–Einstein equation:
R
h
¼
k
B
T
6pgD
20;w
; ð1Þ
where k
B
is the Boltzman constant, T is the temperature in
Kelvin, g is the viscosity of the solvent and R
h
is the hydro-
dynamic radius of the average scattering molecule.
The theoretical hydrodynamic radius (R
theo
h) for the
protein under investigation is calculated from the following
Equation:

R
theo
h
¼
3Mv
4pN

1=3
ð2Þ
In general, proteins have a mean specific volume of
v = 0.73 cm
3
Æg
)1
. M is the molecular mass of the protein,
and the R
theo
h
value can be estimated using Eqn (2) where
N is the Avogadro constant. Equation (2) is based on the
assumption of a spherical shape for the investigated mole-
cule. The diameter of a water molecule is approximately
0.3 nm. By adding this value to the calculated R
theo
h
of the
protein, hydration can be taken into account. The frictional
ratio is calculated as the ratio of R
h
and R

theo
h
.
Molecular mass and oligomeric status
determination
Gel filtration chromatography was performed on a
Superose 6 column to determine the molecular mass of the
wild-type HP0050 protein. The void volume (V
o
) was deter-
mined using Blue dextran and the column was calibrated
using the following standard molecular mass markers
(Sigma Chemical Co., St Louis, MO, USA): carbonic anhy-
drase (27 kDa), BSA (66 kDa), alcohol dehydrogenase
(150 kDa) and b-amylase (200 kDa). The elution volume
(V
e
) of the marker proteins and of the HP0050 protein was
determined. The molecular mass of the HP0050 protein was
calculated from a plot of V
e
⁄ V
o
versus log molecular mass.
Determination of kinetic parameters
Methylation assays were carried out, as described earlier, in
a series of similar reactions containing HP0050 MTase
(50 nm), [
3
H]AdoMet (2.0 lm) and pUC19 DNA

(10–80 nm) or 26-mer duplex (2.5–15 lm) (Table 2). The
velocities were fitted into a one-site binding (hyperbola)
equation as follows:
v ¼ V
max
½S=K
m
þ½S
A nonlinear regression analysis of initial velocity versus
DNA (pUC19 or 26-mer duplex) concentration allowed the
determination of K
m (DNA)
and V
max
. k
cat
was calculated as
the ratio of V
max
⁄ [E]. Similarly, initial velocity experiments
were carried out by varying the concentration of [
3
H]Ado-
Met in the range of 0.3–2.4 lm while keeping the DNA
concentration fixed at 50 nm and keeping other reaction
conditions identical. The nonlinear regression analysis of
initial velocity versus AdoMet concentration allowed the
determination of K
m (AdoMet)
. Data were plotted by nonlin-

ear regression analysis (curve fit) using GraphPad Prism 5.
All methylation experiments were carried out in triplicate
and the results were averaged. Standard deviations of the
average methylation rates were below 10%.
Fluorescence spectroscopy analysis HP0050
MTase -AdoMet interaction
Fluorescence emission spectra and fluorescence intensities
were measured for HP0050 MTase on a Perkin Elmer spec-
trofluorimeter LS 55 using a 1-cm quartz cuvette at 25 °C.
The emission spectra were recorded over a wavelength of
300–400 nm with an excitation wavelength of 280 nm. The
protein was allowed to equilibrate for 1 min in 10 mm
Tris ⁄ HCl, pH 8.0, before measurements were recorded.
Small aliquots of AdoMet were added (1–10 lm for the
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1679
wild-type protein and the Y32L mutant protein, and
1–80 lm for the F195S mutant protein) to the reaction con-
taining HP0050 MTase, and spectra were recorded. Each
spectrum recorded was an average of three scans.
Quenching data were analyzed by a Stern–Volmer plot,
where static and collisional quenching do not occur simul-
taneously, using the following equation:
F
0
=F ¼ 1 þ K
SV
½Q;

where F
0
and F are fluorescence intensities in the absence
and presence of cofactor respectively, K
SV
is the collision
Stern–Volmer constant, and Q is the quencher concentra-
tion. A graph of F
0
⁄ F versus [Q] will yield a linear graph
for homogenous fluorescence emitters, and a nonlinear plot
indicates a heterogeneous population of fluorophores. In
this case, the modified Stern–Volmer equation is used:
F
0
=DF ¼ 1=ðfa Ka½QÞ þ 1=fa;
Where fa is the fraction of accessible fluorophores, and
Ka is the quenching constant [45].
2AP steady-state fluorescence measurements
Steady-state fluorescence emission spectra of the 2AP-con-
taining oligonucleotide samples were measured as described
earlier [46]. Duplex oligonucleotides were made by mixing
strands containing 2AP (duplex 9; Table 2) with a 1.5-fold
molar excess of nonfluorescent complementary strand
(Table 2) in the appropriate buffer and heating at 95 °C for
15 min followed by gradual cooling to room temperature.
In steady-state fluorescence experiments the final concentra-
tion of enzyme was 100 nm. All fluorescence emission spec-
tra and fluorescence intensities from titrations were
corrected for protein tryptophan fluorescence by subtrac-

tion of control spectra and control titrations. In addition,
fluorescence data were corrected for variable background
emission of the solutions.
Site-directed mutagenesis
Site-directed mutagenesis was performed using a PCR-
based technique to replace the required amino acids [47].
Mutations were introduced into the hp0050 gene using the
two-stage megaprimer PCR method. PCR reactions were
carried out with Phusion DNA polymerase (Finnzymes).
For each substitution, a mutagenic primer and an appropri-
ate second primer were used. In the first round of PCR,
oligonucleotide primers mentioned in Table 1 and pET28a-
hp0050 DNA were used to amplify a DNA fragment, which
was used as a megaprimer in the second round of PCR.
The full-length PCR product was obtained in the second-
round PCR by extension of the megaprimer. The PCR
product thus obtained was purified, digested with DpnI
restriction enzyme to cleave the methylated template DNA,
transformed into E. coli DH5a and plated onto LB agar
containing kanamycin (50 lgÆmL
)1
). The mutagenic primers
were designed in such a way to change the respective amino
acids and to create a Type II restriction enzyme site. Hence,
the resultant plasmids could be screened easily. The resul-
tant plasmids were used for expression and purification of
mutant HP0050 proteins. The amino acid, shown in bold,
in the AdoMet-binding motif, FXGXG, was replaced using
primers 2 and 5 (primer 5 was mutagenic). By substituting
F with S, it was possible to introduce a restriction site

(NcoI), thus allowing screening of F195S mutants. Simi-
larly, site-directed mutagenesis was performed to replace
the amino acid, shown in bold, in the catalytic site, DPPY,
using primers 1 and 6 (primer 6 was mutagenic). By substi-
tuting Y with L, the PsiI site was lost and this property
was used to screen Y32L mutants. The mutants were con-
firmed by restriction digestions and by DNA sequencing.
Dot-blot assay for methylation activity
Methylation activity was measured in a dot-blot assay using
rabbit primary antibodies raised against DNA with N
6
methyladenine. To investigate methylation by HP0050
MTase, 250 pmol of duplexes 1, 2 and 3 (Table 2) contain-
ing a GAGG, a GAAG or a GGAG site, respectively, were
incubated with 15 lm [
3
H] AdoMet and 1 lm purified pro-
tein in reaction buffer (10 mm Tris ⁄ HCl, pH-8.0, 5 mm
b-mercaptoethanol) and incubated for 5 h at 37 °C
separately followed by protein inactivation by heating
at 95 °C for 20 min. DNA was purified and spotted onto
a poly(vinylidene difluoride) (PVDF) membrane (Immo-
bilon-N; Millipore, Billerica, MA, USA) and fixed by UV
crosslinking (1.2 mJÆcm
)1
for 30 s). The dot-blot assay was
performed as explained earlier [11].
Construction of Dhp0050 derivatives of H. pylori
Plasmid pET28a_hp0050 was digested with DraI to release a
fragment of 401 bp from hp0050, leaving an overhang of 65

and 233 bp at both ends with a pET28a vector backbone.
The chloramphenicol cassette was amplified from plasmid
DR2 by using specific primers and ligated with DraI-
digested pET28a_hp0050 plasmid. The hp0050::cat construct
was amplified from the pET28a_hp0050 ::cat plasmid by
using primers 3 and 4 (Table 1) and this was used for elec-
troporation, as described earlier [48]. Specific PCR for scor-
ing mutant alleles was carried out using appropriate primers.
Acknowledgements
RK thanks CSIR for a Senior Research Fellowship.
Genomic DNA of H. pylori strain 26695 and antibodies
against N
6
methyladenine were kindly provided by New
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1680 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
England Biolabs, USA. We thank Dr Anand Swaroop
for the methylated oligonucleotides. All members of the
DNR laboratory are acknowledged for critical reading
of the manuscript and useful discussions. The work was
aided by a grant from the Department of Biotechnol-
ogy, Government of India, to DNR and AKM. We
thank the DBT mass spectrometry facility at the Indian
Institute of Science for peptide finger mapping. DNR
acknowledges DST for the J.C. Bose Fellowship.
References
1 Jeltsch A (2002) Beyond Watson and Crick: DNA
methylation and molecular enzymology of DNA meth-

yltransferases. Chem Bio Chem 3, 274–293.
2 Ahmad I & Rao DN (1996) Chemistry and biology of
DNA methyltransferases. Crit Rev Biochem Mol Biol
31, 361–380.
3 Bheemanaik S, Reddy YV & Rao DN (2006) Structure,
function and mechanism of exocyclic DNA meth-
yltransferases. Biochem J 399, 177–190.
4 Marinus MG & Casadesus J (2009) Roles of DNA ade-
nine methylation in host-pathogen interactions: mis-
match repair, transcriptional regulation, and more.
FEMS Microbiol Rev 33, 488–503.
5Fa
¨
lker S, Schmidt MA & Heusipp G (2007) DNA ade-
nine methylation and bacterial pathogenesis. Int J Med
Microbiol 297, 1–7.
6 Kahng LS & Shapiro L (2001) The CcrM DNA methyl-
transferase of Agrobacterium tumefaciens is essential,
and its activity is cell cycle regulated. J Bacteriol 183,
3065–3075.
7 Kusters JG, van Vliet AHM & Kuipers EJ (2006) Path-
ogenesis of Helicobacter pylori. Infection Clin Microbiol
Rev 19, 449–490.
8 Mukhopadhyay AK, Kersulyte D, Jeong JY, Datta S,
Ito Y, Chowdhury A, Chowdhury S, Santra A, Bhat-
tacharya SK, Azuma T et al. (2000) Distinctiveness of
genotypes of Helicobacter pylori in Calcutta India.
J Bacteriol 182, 3219–3227.
9 Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton
GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill

S, Dougherty BA et al. (1997) The complete genome
sequence of the gastric pathogen Helicobacter pylori.
Nature 388, 539–547.
10 Alm RA, Ling LSL, Moir DT, King BL, Brown ED,
Doig PC, Smith DR, Noonan B, Guild BC, deJonge
BL et al. (1999) Genomic-sequence comparison of two
unrelated isolates of the human gastric pathogen
Helicobacter pylori. Nature 397, 176–180.
11 Kong H, Lin LF, Porter N, Stickel S, Byrd D, Posfai J
& Roberts RJ (2000) Functional analysis of putative
restriction-modification system genes in the Helicobacter
pylori J99 genome. Nucleic Acids Res 28, 3216–3223.
12 Oh JD, Kling-Ba
¨
ckhed H, Giannakis M, Xu J, Fulton
RS, Fulton LA, Cordum HS, Wang C, Elliott G,
Edwards J et al. (2006) The complete genome sequence
of a chronic atrophic gastritis Helicobacter pylori strain:
evolution during disease progression. Proc Natl Acad
Sci USA 103, 9999–10004.
13 Baltrus DA, Amieva MR, Covacci A, Lowe TM,
Merrell DS, Ottemann KM, Stein M, Salama NR &
Guillemin K (2009) The complete genome sequence
of Helicobacter pylori strain G27. J Bacteriol 191, 447–
448.
14 Takata T, Aras R, Tavakoli D, Ando T, Olivares AZ &
Blaser MJ (2002) Phenotypic and genotypic variation in
methylases involved in Type II restriction-modification
systems in Helicobacter pylori. Nucleic Acids Res 30,
2444–2452.

15 Donahue JP, Israel DA, TorresV J, Necheva AS &
Miller GG (2002) Inactivation of a Helicobacter pylori
DNA methyltransferase alters dnaK operon expression
following host-cell adherence. FEMS Microbiol Lett
208, 295–301.
16 Skoglund A, Bjo
¨
rkholm B, Nilsson C, Andersson AF,
Jernberg C, Schirwitz K, Enroth C, Krabbe M &
Engstrand L (2007) Functional analysis of the
MHpyAIV DNA methyltransferase of Helicobacter
pylori. J Bacteriol 189, 8914–8921.
17 Vitkute J, Stankevicius K, Tamulaitiene G, Maneliene
Z, Timinskas A, Berg DE & Janulaitis A (2001) Speci-
ficities of eleven different DNA methyltransferases of
Helicobacter pylori strain 26695. J Bacteriol 183, 443–
450.
18 Lin LF, Posfai J, Roberts RJ & Kong H (2001) Com-
parative genomics of the restriction-modification sys-
tems in Helicobacter pylori. Proc Natl Acad Sci USA
98, 2740–2745.
19 Peterson JD, Umayam LA, Dickinson T, Hickey EK &
White O (2001) The comprehensive microbial resource.
Nucleic Acids Res 29, 123–125.
20 Kriukiene E, Lubiene J, Lagunavicius A & Lubys A
(2005) MnlI – The member of H-N-H subtype of Type
IIS restriction endonucleases. Biochim Biophys Acta
1751, 194–204.
21 Zheng Y, Posfai J, Morgan RD, Vincze T & Roberts
RJ (2009) Using shotgun sequence data to find active

restriction enzyme genes. Nucleic Acids Res, 37, Epub.
22 Evdokimov AA, Zinoviev VV, Malygin EG, Schlagman
SL & Hattman S (2002) Bacteriophage T4 Dam DNA-
[N6-adenine]methyltransferase Kinetic evidence for a
catalytically essential conformational change in ternary
complex. J Biol Chem 277, 279–286.
23 Bergerat A & Guschlbauer W (1990) The double role of
methyl donor and allosteric effector of S-adenosyl-
methionine for Dam methylase of E coli. Nucleic Acids
Res 18, 4369–4375.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1681
24 Sugisaki H, Kita K & Takanami M (1989) The FokI
restriction – modification system Presence of two
domains in FokI methylase responsible for
modification of different DNA strands. J Biol Chem
264, 5757–5761.
25 Morgan RD, Bhatia TK, Lovasco L & Davis BD
(2008) MmeI: a minimal Type II restriction-modifica-
tion system that only modifies one DNA strand for host
protection. Nucleic Acids Res 36, 6558–6570.
26 Bitinaite J, Maneliene Z, Menkevicius S, Klimasauskas
S, Butkus V & Janulaitis A (1992) AIw261, Eco3l1 and
Esp3l-type lls methyltransferases modifying cytosine
and adenine in complementary strands of the target
DNA. Nucleic Acids Res 20, 4981–4985.
27 Chan S, Zhu Z, Etten JLV & Xu S (2004) Cloning of
CviPII nicking and modification system from

chlorella virus NYs-1 and application of NtCviPII in
random DNA amplification. Nucleic Acids Res 32,
6187–6199.
28 Pues H, Bleimling N, Holz B, Wolcke J & Weinhold E
(1999) Functional roles of the conserved aromatic
amino acid residues at position 108 (motif IV) and
position 196 (motif VIII) in base flipping and
catalysis by the N
6
-adenine DNA methyltransfer-
ase from Thermus aquaticus. Biochemistry 38, 1426–
1434.
29 Roth M, Helm-Kruse S, Friedrich T & Jeltsch A (1998)
Functional roles of conserved amino acid residues in
DNA methyltransferases investigated by site-directed
mutagenesis of the EcoRV adenine-N
6
-methyltransfer-
ase. J Biol Chem 273, 17333–17342.
30 Roberts RJ & Cheng X (1998) Base flipping. Annu Rev
Biochem 67, 181–198.
31 Su T-J, Connolly BA, Darlington C, Mallin R & Dry-
den DTF (2004) Unusual 2-aminopurine fluorescence
from a complex of DNA and the EcoKI methyltransfer-
ase. Nucleic Acids Res 32, 2223–2230.
32 Horton JR, Liebert K, Bekes M, Jeltsch A & Cheng X
(2006) Structure and substrate recognition of the Esc-
herichia coli DNA adenine methyltransferase. J Mol
Biol 358, 559–570.
33 Malygin EG, Evdokimov AA, Zinoview VV,

Ovechkina LG, Lindstrom WM, Reich NO,
Schlagman SL & Hattman S (2001) A dual role for
substrate S-adenosyl-L-methionine in the methylation
reaction with bacteriophage T4 Dam DNA-[N6-ade-
nine]-methyltransferase. Nucleic Acids Res 29, 2361–
2369.
34 Datta S, Chattopadhyay S, Nair GB, Mukhopadhyay
AK, Hembram J, Berg DE, Saha DR, Khan A,
Santra A, Bhattacharya SK et al. (2003) Virulence
genes and neutral DNA markers of Helicobacter
pylori isolates from different ethnic communities
of West Bengal, India. J Clin Microbiol 41, 3737–
3743.
35 Torreblanca J & Casadesus J (1996) DNA adenine
methylase mutants of Salmonella typhimurium and a
novel Dam-regulated locus. Genetics 144, 15–26.
36 Xu Q, Morgan RD, Roberts RJ & Blaser MJ (2000)
Identification of Type II restriction and modification
systems in Helicobacter pylori reveals their substantial
diversity among strains. Proc Natl Acad Sci USA 97,
9671–9676.
37 Takeuchi H, Israel DA, Miller GG, Donahue JP,
Krishna U, Gaus K & Peek RM Jr (2002) Characteriza-
tion of expression of a functionally conserved Helicob-
acter pylori methyltransferase-encoding gene within
inflamed mucosa and during in vitro growth. J Infect
Dis 186, 1186–1189.
38 Mashhoon N, Pruss C, Carroll M, Johnson PH & Reich
NO (2006) Selective inhibitors of bacterial DNA adenine
methyltransferases. J Biomol Screen 11, 497–510.

39 Sambrook J & Russell DW (2001) In Molecular Cloning:
A Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York.
40 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature 227, 680–685.
41 Chevallet M, Luche S & Rabilloud T (2006) Silver
staining of proteins in polyacrylamide gels. Nat Protoc
1, 1852–1858.
42 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein uti-
lizing the principle of protein-dye binding. Anal Bio-
chem 72, 248–254.
43 Rubin RA & Modrich P (1997) EcoRI methylase Physi-
cal and catalytic properties of the homogeneous
enzyme. J Biol Chem 252, 7265–7272.
44 Kumar R, Srivastava R, Singh RK, Surolia A & Rao
DN (2008) Activation and inhibition of DNA meth-
yltransferases by S-adenosyl-L-homocysteine analogues.
Bioorg Med Chem 16, 2276–2285.
45 Samworth CM, Degli esposti M & Lenaz G (1988)
Quenching of the intrinsic tryptophan fluorescence
of mitochondrial ubiquinol - cytochrome-c reductase
by the binding of ubiquinone. Eur J Biochem 171, 81–
86.
46 Reddy YV & Rao DN (2000) Binding of EcoP15I
DNA methyltransferase to DNA reveals a large struc-
tural distortion within the recognition sequence. J Mol
Biol 298, 597–610.
47 Kirsch RD & Joly E (1998) An improved PCR-muta-

genesis strategy for two-site mutagenesis or sequence
swapping between related genes. Nucleic Acids Res 26,
1848–1850.
48 Tan S, Fraley CD, Zhang M, Dailidiene D, Kornberg
A & Berg DE (2005) Diverse phenotypes resulting from
Polyphosphate kinase gene (ppk1) inactivation in differ-
ent strains of Helicobacter pylori. J Bacteriol 187, 7687–
7695.
N
6
adenine methyltransferase from H. pylori 26695 R. Kumar et al.
1682 FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS
Supporting information
The following supplementary material is available:
Fig. S1. PCR amplification, over expression and purifi-
cation of H. pylori HP0050 MTase.
Fig. S2. Peptide finger map and determination of the
molecular mass of HP0050 protein.
Fig. S3. Comparison of restriction digestion patterns
of methylated and unmethylated duplex DNA.
Fig. S4. Fluorescence spectroscopy analysis HP0050
MTase -AdoMet interaction.
Table S1. Methylation activity of HP0050 MTase using
pUC19 derived fragments.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not

copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
R. Kumar et al. N
6
adenine methyltransferase from H. pylori 26695
FEBS Journal 277 (2010) 1666–1683 ª 2010 The Authors Journal compilation ª 2010 FEBS 1683