Báo cáo khoa học: Control of transferrin expression by b-amyloid through the CP2 transcription factor pdf

Control of transferrin expression by
b
-amyloid through the
CP2 transcription factor
Sang-Min Jang
1,
*, Jung-Woong Kim
1,
*, Chul-Hong Kim
1
, Joo-Hee An
1
, Eun-Jin Kang
1
,
Chul Geun Kim
2
, Hyun-Jung Kim
3
and Kyung-Hee Choi
1
1 Department of Life Science (BK21 Program), College of Natural Sciences, Chung-Ang University, Seoul, Korea
2 Department of Life Science and Research Institute for Natural Sciences, Hanyang University, Seoul, Korea
3 College of Pharmacy, Chung-Ang University, Seoul, Korea
Introduction
Alzheimer’s disease (AD) is a neurodegenerative dis-
ease that affects cognition, behavior and function [1].
Two major protein aggregates are associated with AD,
extracellular neuritic plaques (NP) and intracellular
neurofibrillary tangles (NFT). b-amyloid peptides (Ab)
are 40 and 42 amino acid peptides derived from

the amyloid precursor protein by the action of b- and
c-secretase, and are the major components of NPs [2].
NFTs are composed of the microtubule-associated
protein tau, which is phosphorylated by kinases such
as glycogen synthase kinase 3b (GSK3b), cAMP-
dependent kinase, stress activated protein kinase
(SAPK)4 ⁄ p38d and casein kinase 1 [3–5]. Hyper-
phosphorylated tau forms toxic aggregates that pre-
cede NFT formation [6,7]. These two aggregates
induce neuronal death and synaptic loss during devel-
opment of AD.
Oxidative stress-related neuronal cell death has long
been implicated in a number of age-associated diseases,
including AD [8–10]. In many cases, the rate of oxygen
Keywords
Alzheimer’s disease; CP2; iron homeostasis;
oxidative stress; transferrin
Correspondence
K H. Choi, Department of Life Science
(BK21 Program), College of Natural
Sciences, Chung-Ang University, 221
Heuksuk Dong, Dongjak Ku, Seoul 156-756,
South Korea
Fax: +82 2 824 7302
Tel: +82 2 820 5209
E-mail:
*These authors contributed equally to this
work
The authors declare no conflict of interest
(Received 16 February 2010, revised 28

June 2010, accepted 12 July 2010)
doi:10.1111/j.1742-4658.2010.07801.x
Accumulation of b-amyloid protein (Ab) is one of the most important
pathological features of Alzheimer’s disease. Although Ab induces neurode-
generation in the cortex and hippocampus through several molecular mech-
anisms, few studies have evaluated the modulation of transcription factors
during Ab-induced neurotoxicity. Therefore, in this study, we investigated
the transcriptional activity of transcription factor CP2 in neuronal damage
mediated by Ab (Ab
1–42
and Ab
25–35
). An unbiased motif search of the
transferrin promoter region showed that CP2 binds to the transferrin pro-
moter, an iron-regulating protein, and regulates transferrin transcription.
Ectopic expression of CP2 led to increased transferrin expression at both
the mRNA and protein levels, whereas knockdown of CP2 down-regulated
transferrin mRNA and protein expression. Moreover, CP2 trans-activated
transcription of a transferrin reporter gene. An electrophoretic mobility
shift assay and a chromatin immunoprecipitation assay showed that CP2
binds to the transferrin promoter region. Furthermore, the binding affinity
of CP2 to the transferrin promoter was regulated by Ab,asAb (Ab
1–42
and Ab
25–35
) markedly increased the binding affinity of CP2 for the trans-
ferrin promoter. Taken together, these results suggest that CP2 contributes
to the pathogenesis of Alzheimer’s disease by inducing transferrin expres-
sion via up-regulating its transcription.
Abbreviations

Ab, b-amyloid protein; AD, Alzheimer’s disease; AICD, amyloid precursor protein (APP) intra-cellular domain; ChIP, chromatin
immunoprecipitation; EMSA, electrophoretic mobility shift assay; GSK3b, glycogen synthase kinase 3b; GST, glutathion S-transferase;
NFT, neurofibrillary tangle; NP, neuritic plaque; ROS, reactive oxygen species; shRNA, small hairpin RNA.
4054 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS
radical production is directly related to damage to the
elements of living cells, such as proteins, DNA and
membranes [11–15]. The results of a previous study
suggest that the effects of Ab accumulation induce the
production of hyperreactive oxygen species (ROS) via
production of free radicals [16]. Increased oxidative
stress can promote both formation of Ab [17] and
hyperphosphorylation of tau in a manner that is
reminiscent of neurofibrillar tangles [18]. Among the
many possible metabolic consequences of progressive
Ab accumulation, altered ionic homeostasis, particu-
larly excessive calcium entry into neurons, makes a
strong contribution to selective neuronal dysfunction
and death, based on studies of the effects of aggre-
gated Ab in culture [19,20].
Iron is involved in the generation of ROS by cata-
lyzing the production of OH
•
from hydrogen peroxide
(H
2
O
2
) via the Fenton reaction [21]. Hydroxyl radicals
can damage DNA, proteins and lipids, and are
believed to be responsible for much of the cellular and

tissue injury associated with reperfusion disorders [22].
In cases of AD, redox-active iron is associated with
NPs and NFTs through participation in in situ oxida-
tion and catalysis of H
2
O
2
-dependent oxidation [23]. It
is generally accepted that iron overload leads to axonal
dystrophy and necrotic or apoptotic cell death [24]. In
AD, alterations of iron regulatory proteins cause an
abnormal distribution of iron in the brain. Transferrin
is an iron regulatory protein that carries ferric iron
from the plasma, lymph and cerebrospinal fluid to cells
through the transferrin cycle [25]. It has been reported
that transferrin is homogenously distributed around
NPs, and is found in astrocytes in the cerebral cortical
white matter of AD brain tissue [26]. Moreover,
a strong immunoreactivity with the iron storage
protein ferritin was observed in NPs in AD hippo-
campuses [27].
CP2 is a transcription factor that belongs to the
Drosophila grainyhead-like gene family, and has been
found to stimulate transcription of the a-globin gene
[28]. Although CP2 is expressed ubiquitously, it has
specific regulatory functions in certain types of cells. In
erythrocytes, CP2 regulates a-globin expression by
binding to the CP2 binding motif CNRG-N
6
-

CNR(G ⁄ C) in the a-globin promoter [29,30]. CP2 is
also known to play pivotal roles in neural tissue
development, and it has been suggested that a poly-
morphism in the 3¢-untranslated region of the CP2
gene is associated with sporadic AD [31]. Moreover,
it has been proposed that CP2 plays an important
role in Down syndrome-related AD by regulating
the expression of a trifunctional enzyme encoded by
the glycinamide ribonucleotide synthetase ⁄ aminoimi-
dazole ribonucleotide synthetase ⁄ glycinamide ribonu-
cleotide transformylase gene, which is localized to
chromosome 21q22.1 within the Down syndrome
critical region [32,33]. However, the mechanisms of
transcriptional regulation of CP2 that may play an
important role in the pathology of AD have not yet
been fully elucidated.
In this study, we identified CP2 as a novel transcrip-
tional factor that regulates transferrin expression in
response to Ab. An unbiased motif search of transfer-
rin promoter sequences revealed that the transferrin
promoter has putative CP2 binding sequences; there-
fore, the functional roles of CP2 in transferrin tran-
scription were examined in vitro and in vivo. These
findings identify a new molecular pathway through
transcription factor CP2 by which Ab increases gene
transcription associated with the pathology of AD.
Results
Conserved sequences of the transferrin promoter
region contain CP2 binding sites
The iron regulatory protein transferrin is involved in

ROS production, which causes neurotoxicity in neuro-
nal cells. We therefore investigated which transcription
factors could regulate transcription of the transferrin
gene. To identify conserved sequences in the transfer-
rin promoter, we first aligned the DNA sequence of
the human transferrin promoter from )600 to )1, in
relation to the transcriptional start site, with the corre-
sponding regions of the mouse, rat, cow and horse
transferrin genes. Analysis using multiple sequence
alignment programs revealed the presence of conserved
sites at positions )179 to )1 in the transferrin pro-
moter. We next searched for transcription factors that
are likely to recognize a binding motif in the conserved
transferrin promoter sequences. As shown in Fig. 1A,
several transcription factors were identified as putative
binding factors for transferrin promoter regions includ-
ing CP2, specificity protein 1 and p53. Interestingly,
we found that the CP2 binding site was the most fre-
quent motif in the conserved transferrin promoter.
Specifically, our analysis revealed that there are four
CP2 consensus sites at positions )178 to )159, )130
to )113, )115 to )105 and )53 to )35 (Fig. 1B).
Transcription factor CP2 increases the
endogenous transferrin mRNA level
To determine whether CP2 is a possible transcriptional
regulator of transferrin, HEK293 cells were tran-
siently transfected with CP2 expression plasmids, and
S M. Jang et al. Regulation of transferrin expression by CP2
FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4055
transferrin mRNA expression was analyzed by RT-

PCR. As shown in Fig. 2A, over-expression of CP2
significantly up-regulated transferrin transcription in a
concentration-dependent manner. Moreover, transfec-
tion of CP2 small hairpin RNA (shRNA) that effec-
tively decreased the level of exogenous FLAG-tagged
CP2 proteins reduced the mRNA level of transferrin
(Fig. 2A, lane 4). In addition, knockdown of endoge-
nous CP2 using its shRNA significantly reduced trans-
ferrin mRNA expression (Fig. 2B). Taken together,
these results suggest that transcription of transferrin is
dependent on CP2 expression. To further examine the
functional roles of CP2 in transferrin transcription,
promoter reporter assays were performed. The trans-
ferrin promoter fragment from )600 to )1 was cloned,
and reporter constructs were transiently transfected
into HEK293 cells with CP2 expression plasmids. In
the presence of exogenous CP2, transferrin promoter
activity was stimulated to a level 6.2 times greater than
that of the control, and increased in a CP2 dose-
dependent manner (Fig. 2C). In addition, transferrin
promoter activity decreased in HEK293 cells transfect-
ed with CP2 shRNA. Moreover, knockdown of endog-
enous CP2 protein reduced the level of transferrin
reporter activation. These results indicate that CP2 is
able to activate the transcription of transferrin.
The transferrin proximal promoter contains a
CP2-response element
To determine the responding element for the CP2-med-
iated expression of transferrin, we performed luciferase
CCCGTTAACCTGACGCGTTTGTGTTCTCCAGTTTCTAACGCGGGTCGGCCGGGGGAGGGAGGCACGT-ATTTCCGCTCGCC

CCCGTTAACCTGACGCGTTTGTGTTCTCCAGTTTCTAACGTGGGTCGGCCGGGGGAG GCACAT-ATTTCCCCTCGCCCGGTGTCCCTCCGCCACGTCTTCGCCCAGACAGACAT
CCCGTTCGCCCGACGCGTTTGTGTTCCCCAGTTCCTAACA
CCCGTTCGCCCATCGCGTTTGTGTCCTCCAGTTCCCAACACGAGACGGGAGGCCCGG CTCCTATTTCCCCGCGCCCCGCACCCCTCCGCCGTGTCTGCGGCTAGTCAGACACGAGCGG
CACACT AACAGCACCATCACCTAAGGTACGCGTCAAGACAGGGTG
TCGAGTCCTTTACTCCACTAGTAGTC-CCGTTCTTTCCTTCCCCC ACCTACGCCCCACTAA
CACACACACACACCACCACCACAAACGGGACCACCACCTAAGGTACGCGTCAAGACAGGGTGTATAGTCCTTTACTCCACTGGTAGTC-CCGTTCTTTCCTTCCCCC ACCCACGTCCCGCTAA
AAAACA ACCTAAGGTGGGTGCCCAGACAAGGTCTCCAGTCCTTTACTCCACTAGTCGGGGCCGCTCCTTACTTCCCCCT-CCCGACTCCCCTCTAA
AACGCG ACCTAAGGTAGGTGCCTAGACAGGGTCTCGGGTCTTTTACTCCACTAGTCGGACCCGCTCCTTACTTCACCCT-CCCTACTTTCCGCTAA
AcaC acctAAGGT G G C AGaca GGT Tc aGTC TTTACTCCACTaGT g CcG TC TT CTTCcCCC CC aC cCC CTAA
GACACG ACC TGAGGAAGGTGAGCGCCCAGCAGAGGTCTCGAGTCTTTTACTCCACTAGTCACC-CTGCTCATTCCTTCCCCCCAACCCTCTCCCCGCTAA
CCCGTT cC gaCGcGTTTGTGt CtCCAGTT CtAAC g g cgg gg g atttcc cgcc
CCCGTTGGGCCGACGTGTTTGTGCCCTCCAGTTTCTAACGCGG
GTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA
Homo sapiens :
Mus musculus :
Rattus norvegicus :
Bos taurus :
Equus caballus :
CP2 II CP2 III CP2 IV
CP2 I
+1
–35
–53
–94
–105–115 –113–130–159–178
–193
Enhancer region Negative region
–3600 –3300 –1000 –620
Promoter region
–125 +1

Homo sapiens :
Mus musculus :
Rattus norvegicus :
Bos taurus :
Equus caballus :
TCCTCGGACTCGAGTCGCCCCGTCCTTCTCCCTCGTCGAGGAGGCACCCCCTGGAAACTCTCGGGTCCTCGTCCT
AAAGCTCCCTGTGGACCACCCCTC
GTTTTCCACGACTCAGACAGAAACTGGAACTCGGGTCGAACAAAGAGGACG
TAGGAGGGGGTTTTCCC
CGAAACGGACAGTAAGACGTCAAGATCACACCCCAGACCCGCGTCAAGAAAAGGGAGA
GGTCGGAGCCTCAGAAGGAGACACCTGAC
GCGTCTATCCTGACCACCGTGCCTGGTCGAGACGTCGGGACCTCAG
TCCTCGTCTCGGGGGGCCGAGGGTCGGGCGGCATCGGC
GAGGACCGTGGCTCGCTCGGCGCTACTGTTACCGACG
TAACACGAAGTACAGGGAAGGGTAGTTGTAAAGACAC
GACCTGAGGAAGGTGAGCGCCCAGCAGAGGTCTCGAGT
CTTTTACTCCACTA
GTCACCCTGCTCATTCCTTCCCCCCAACCCTCTCCCCGCTAACCCGTTGGGCCGACGTGTT
TGTGCCCTCCAGTTTCTAACGCGGGTCGGGCGGGTCCGGCCCTTACCTTATTTCCCTGCGCCCCGCGGCCTCCGA
p300
SP-1
AP-1 SRY
Human TF Gene ID: 7018
A
B
NF-κB
E2F GATA-1, GATA-3
MyoD, NKX-2.5
GATA-1, GATA-2
G ATA - 1 , G ATA - 2

Oct-1
p53
CP2
AP-4
p300
CP2 CP2
p53
CP2
AP-2
+1
Fig. 1. Highly conserved regions of the transferrin promoter containing putative CP2 binding motifs. (A) The highly conserved region of the
human transferrin gene (gene ID 7018) promoter was analyzed using the MOTIF searching program (TRANSFAC database, -
ome.jp) to identify possible transcription factors. CP2 is the factor that appears most frequently. (B) The promoter sequences for human,
mouse, rat, cow and horse transferrin genes were aligned using a ClustalW multiple sequencing alignment program. The conserved
sequences of the transferrin promoter are indicated in gray or black according to the percentage conservation (100% black, 80% gray).
Boxes indicate conserved CP2 sites (CP2 I, GGGGCAGTGAGGGGCGGTG; CP2 II, GGGCAAGCGGGAACCAGGT; CP2 III,
ATCTGTTTATTTCTGGCCG; CP2 IV, CCCCAAACCAA) and their positions relative to the transcriptional start site of the human transferrin
promoter are indicated. CP2 III and IV overlap by 2 bp.
Regulation of transferrin expression by CP2 S M. Jang et al.
4056 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS
reporter assays using various mutant forms of human
transferrin promoter in HEK293 cells. To accomplish
this, we used three mutants from which the following
regions had been deleted: CP2 binding site I (mutant
1; mut1), CP2 binding site I, III and IV (mutant 2;
mut2), and the entire CP2 binding site (mutant 3;
mut3) (Fig. 3A). As the CP2 binding site III sequence
overlaps with the CP2 binding site IV sequence by two
base pairs, we deleted these portions concurrently
(Fig. 3A). As expected, the wild-type (WT) promoter

encompassing nucleotides )600 to )1 induced lucifer-
ase reporter activity in a CP2 concentration-dependent
manner, while CP2 shRNA significantly reduced this
activity (Fig. 3B, lanes 1–4). However, the mut1, mut2
and mut3 promoter constructs abolished the luciferase
activity under both the CP2 over-expressed and knock-
down conditions (Fig. 3B, lanes 5–16). These findings
suggest that the CP2 binding site I at positions )53 to
)35 is responsible for the CP2-mediated transcriptional
activation of human transferrin, and imply that CP2
binds to CP2 binding site I directly or through
interaction with other transcription factors to enhance
transferrin gene expression in cells.
CP2 binds to the transferrin promoter in vitro
and in vivo
To confirm whether CP2 binds directly to CP2 bin-
ding site I in the proximal promoter region of trans-
ferrin, we performed an electrophoretic mobility shift
assay (EMSA) using glutathion S-transferase (GST)-
tagged recombinant CP2 protein. An oligonucleotide
FLAG-CP2 :
1
AB
CD
234
–+
++ ++
–––+
TF
GAPDH

CP2 shRNA :
1234
mRNA ratio of
TF/GAPDH
0.0
0.5
1.0
1.5
2.0
**
TF
CP2 shRNA : – +
GAPDH
12
mRNA ratio of
TF/GAPDH
12
0.0
0.4
0.7
1.0
**
FLAG-CP2
β-tubulin
FLAG-CP2 :
–+ ++
++
–––+
CP2 shRNA :
Fold change

1234
0
2
4
6
8
10
TF-luc
**
TF-luc
CP2 shRNA :
–+
Endo CP2
β-tubulin
Fold change
12
0
0.5
1.0
**
Fig. 2. Transcription factor CP2 increases the endogenous transferrin mRNA level. (A) Total RNA from HEK293 cells transfected with plas-
mids expressing FLAG-tagged CP2 and ⁄ or CP2 shRNA was analyzed by RT-PCR using transferrin- and GAPDH-specific primers. The level of
GAPDH was used as a loading control. Representative images of agarose gels are shown (upper panels) and band intensity was measured.
Normalized transferrin levels were calculated relative to GAPDH (bottom panel). (B) HEK293 cells were transiently transfected with CP2
shRNA. RNA was extracted, and RT-PCR analysis was performed as in (A). (C) Lysates from HEK293 cells transfected with increasing
amounts of plasmids encoding CP2 DNA, transferrin promoter–luciferase or CP2 shRNA vectors were analyzed for luciferase activity. All data
were normalized to b-galactosidase activity. Data are expressed as fold increases compared to the control (upper panel). The expression lev-
els of proteins were assessed by immunoblotting (bottom panels). Expression of b-tubulin was included as a loading control. (D) HEK293
cells were co-transfected with transferrin promoter–luciferase and pCMV-b-galactosidase with/without CP2 shRNA. Luciferase activity was
measured 48 h after transfection and normalized to b-galaosidase activity. The expression levels of proteins were assessed by immunoblot-

ting using CP2 antibody. All data are representative of three independent experiments, and statistical significance was determined using
Tukey’s post hoc test (**P < 0.01).
S M. Jang et al. Regulation of transferrin expression by CP2
FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4057
encompassing the consensus CP2 binding site I at posi-
tions )63 to )24 of the human transferrin promoter
was used as a probe for EMSA. As shown in Fig. 4A,
addition of CP2 produced a slower-migrating DNA–
protein complex in a dose-dependent manner (lanes 4
and 5), whereas the GST protein, used as a control,
did not form a DNA–protein complex (lanes 2 and 3).
The presence of CP2 in the protein–DNA complex
was verified by adding CP2 antibody. Addition of the
CP2 antibody supershifted a portion of the CP2 com-
plex (lane 6), but use of IgG as a negative control
did not alter the binding pattern (lane 7). The trans-
ferrin probe–CP2 protein–CP2 antibody complex dis-
appeared when cold transferrin probes were added as
competitors (lane 8).
To further confirm CP2 binding to the region of the
transferrin promoter in vivo, we performed a chroma-
tin immunoprecipitation assay (ChIP) in HT22 cells, a
mouse hippocampal cell line, using CP2 antibody.
Prior to the ChIP assay, we observed endogenous CP2
protein expression by Western analysis in HT22 cells
(data not shown). Binding of CP2 to the transferrin
promoter was examined by PCR using appropriate
primers. Normal rabbit serum used as a negative
control did not immunoprecipitate the transferrin pro-
moter, whereas CP2 antibody precipitated a region of

the transferrin promoter that contains the CP2 binding
sequences (Fig. 4B). These results (Fig. 4A,B) clearly
indicate that CP2 induces transferrin transcription by
directly binding to the transferrin promoter.
Ab induces transcriptional activity of CP2 by
enhancing its binding affinity to the transferrin
promoter
It has been reported that Ab regulates the transcrip-
tional activity of several classic transcription factors,
including nuclear factor-jB and activator protein-1
[34,35]. These observations raise the possibility that Ab
modulates the transcriptional activity of CP2. To
determine whether the transcriptional activity of CP2
can be modulated by Ab, HT22 cells were transiently
transfected with luciferase reporter plasmids containing
the CP2-responsive element of the human transferrin
TF promoter
A
B
–600
+1
II
III IV I
–600
–600
–600
–600
II
III IV I
–1

II
III IV
–82
II
–131
–188
Control
–600 ~ –1
Mutant 1
–600 ~ –82
Mutant 2
–600 ~ –131
Mutant 3
–600 ~ –188
Fold change
0
2
4
6
8
10
12
14
FLAG-CP2 :
CP2 shRNA :
––––
–––+ –––+ –––+ –––+
TF-luc : WT mut 1 mut 2 mut 3
1 2 3 4 5 6 7 8 9 10 11 12
13 14 15 16

FLAG-CP2
β-tubulin
**
n.s. n.s. n.s.
Fig. 3. The transferrin proximal promoter region contains a CP2 response element. (A) Transferrin promoter constructs used in transactiva-
tion studies. Various mutants of human transferrin promoters were used, and are indicated as a mutant 1, mutant 2 and mutant 3. The
method used for mutation of transferrin promoters is described in Experimental procedures. (B) Each of the constructs shown in (A) and
pCMV-b-galactosidase were transiently transfected into the HEK293 cells, together with increasing amounts of plasmids encoding CP2 DNA
or CP2 shRNA vectors. At 48 h after transfection, cells were lysed and subjected to luciferase assays. Data were normalized against b-galac-
tosidase activity and are expressed as the relative luciferase units compared to the control. The level of CP2 expression in each group of
cells was confirmed by Western blotting, an example of which is shown (bottom panel). Expression of b-tubulin was used as a loading
control. All data are representative of three independent experiments, and statistical significance was determined using Tukey’s post hoc
test (**P < 0.01; n.s., not significant).
Regulation of transferrin expression by CP2 S M. Jang et al.
4058 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS
promoter. Forty-eight hours after transfection, cells
were treated with Ab (Ab
1–42
: 0, 50 and 100 nm;Ab
25–35
:
0, 5, 10 and 20 lm) for an additional 12 h. As shown
in Fig. 5A, Ab
1–42
treatment increased the level of
transferrin transcripts by up to 3.5-fold compared
with the control (lane 1), while knockdown of CP2
reduced Ab-induced transferrin–luciferase activities
(lanes 5 and 6). Ab
25–35

treatment also increased CP2-
mediated luciferase activity 2–3.5-fold compared with
the control (Fig. 5B, lanes 1–4). Ab-induced transfer-
rin–luciferase activity was decreased by the knockdown
of CP2 (Fig. 5B, lane 5). Moreover, immunoblot
analysis demonstrated that transferrin protein levels
were increased by Ab
1–42
and Ab
25–35
treatment,
whereas knockdown of CP2 reduced the transferrin
protein level (Fig. 5A,B, bottom panel). These findings
indicate that Ab (Ab
1–42
or Ab
25–35
) modulates either
expression of CP2 or the binding affinity to its target
gene. However, CP2 protein expression was not chan-
ged by Ab treatment (Fig. 5A,B).
Taken together, these findings suggest that Ab
enhances the ability of CP2 to bind to the transferrin
promoter. To determine whether Ab increases CP2
binding affinity to the transferrin promoter, HT22 cells
were treated with Ab (100 nm Ab
1–42
or 20 lm Ab
25–
35

) for 12 h, and ChIP was performed. CP2 binding to
the transferrin promoter increased under Ab-treated
conditions (Fig. 5C,D), and this increase was clearly
related to the increased levels of transferrin transcripts.
To further confirm the effects of Ab on CP2-dependent
precipitation of the transferrin promoter, CP2 shRNA-
transfected HT22 cells were incubated with Ab (Ab
1–42
and A b
25–35
), and a ChIP assay was performed.
Knockdown of CP2 reduced the amount of trans-
ferrin promoter precipitated in the presence of Ab
(Fig. 5C,D, lane 3). These results show that Ab mark-
edly enhances the binding affinity of CP2 towards its
target gene promoter.
Discussion
Mis-regulation of iron-related proteins changes iron
homeostasis and causes ROS generation, which medi-
ates neurodegenerative diseases. Transferrin is an iron-
transporting protein that is involved in the storage and
maintenance of iron homeostasis in living organisms.
In case studies, transferrin was found to be signifi-
cantly up-regulated in the AD frontal cortex compared
with normal cases [36]. In the present study, we
explored the molecular mechanisms by which CP2 reg-
ulates transferrin expression in response to Ab.To
identify possible transcription factors that can modu-
late transferrin expression, we used a motif searching
program and found several putative transcription fac-

tors that can bind to the highly conserved transferrin
promoter (Fig. 1A). Of these putative transcription
factors, we selected CP2, because its binding sites
appear most frequently on the transferrin promoter,
suggesting that CP2 plays an important role in
12345678
GST (ng) :
A
B
GST-CP2 (ng) :
CP2 Ab :
IgG :
cold probe :
– –––––
–––
40 80
40 80808080
–––––+––
––––––+–
–––––––+
Free probe -
shift -
super shift -
N.S. -
Input IgG CP2
HT22 (TF promoter)
Densitometric
value
0.0
5.0

10.0
23
1 2 3
IP with:
Fig. 4. CP2 is able to bind to the proximal transferrin promoter con-
sensus element in vitro and in vivo. (A) An oligonucleotide probe
covering a 19 bp CP2-dependent enhancer DNA segment of the
transferrin promoter was used for CP2 binding by EMSA. GST-
fused recombinant CP2 was purified from E. coli using GST beads.
The CP2–DNA complex migrated slowly and the amount increased
in a concentration-dependent manner (lanes 4 and 5). The exis-
tence of CP2 in this slow-migrating complex was verified by adding
CP2 antibody, which caused a supershift (lane 6). Rabbit IgG and
non-labeled probe were included as negative controls (lanes 7 and
8). N.S., non-specifically bound probe. (B) Chromatin from mouse
hippocampal cell line HT22 was cross-linked with endogenous CP2.
After precipitation with antibody against CP2 and rabbit IgG,
the transferrin promoter regions containing the CP2 element
were amplified by PCR from the precipitated DNA (upper panel).
The intensity of the transferrin promoter band was quantified by
densitometry (bottom panel).
S M. Jang et al. Regulation of transferrin expression by CP2
FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4059
transferrin transcription. Indeed, ectopic expression or
knockdown of CP2 modulated transferrin mRNA level
and transferrin–luciferase activity (Fig. 2). In luciferase
experiments using transferrin promoter deletion
mutants, we found that the short sequence between
positions )53 and )35 of the transferrin promoter
region was the responding element (Fig. 3B). CP2 was

able to bind to this site both in vitro and in vivo
(Fig. 4A,B). Furthermore, in the presence of Ab (both
Ab
1–42
and Ab
25–35
), the binding affinity of CP2 to
transferrin promoter was enhanced (Fig. 5C,D) and
the transcriptional activity of CP2 to induce transferrin
expression was also up-regulated (Fig. 5A,B).
Although CP2 is necessary to regulate the expression
of globins in erythrocytes, it has also been identified as
a possible transcription factor that mediates enhanced
transcription of the glycinamide ribonucleotide synthe-
tase ⁄ aminoimidazole ribonucleotide synthetase ⁄ glycina-
mide ribonucleotide transformylase gene, which
increases the levels of oxidative stress markers such as
de novo purine biosynthesis and production of hypo-
xanthine and xanthine in Down syndrome-related
AD [32,33]. GSK3b is also known as a transcrip-
tional target of CP2 [37], and it has been reported
that CP2 increases the level of GSK3b transcripts
via binding to CP2 binding sites at positions )1to
TF promoter
Aβ
25–35

(20 mM) :
CP2 shRNA :
IP : CP2 Ab

Input
123
–++
––+
123
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
1.6
Fold increase
**
TF-Luc
123456
0
1
2
3
4
5
AB
CD
0 50 100 0 50 100
Aβ
1–42
(nM):

CP2 shRNA :
WB: anti-TF
WB: anti-CP2
WB: anti-β-Tubulin
–––+++
β-tubulin
CP2
TF
Fold increase
WB : anti-CP2
WB : anti-β-Tubulin
WB : anti-TF
1234
5
Aβ
25–35
(mM) :
CP2 shRNA :
01020
20
––––+
1.00 1.49 1.46 2.12rel. TF : 0.18
Fold increase
0
1
2
3
4
TF-luc
**

5
β-tubulin
CP2
TF
**
**
n.s.
IP : CP2 Ab
Input
TF promoter
Aβ
1–42

(100 nM) :
CP2 shRNA :
123
–++
––+
123
0.0
0.5
1.0
1.5
2.0
Fold increase
**
Fig. 5. Treatment with Ab modulates the transcriptional activity of CP2 by enhancing its binding affinity to transferrin promoter. (A,B) Trans-
ferrin reporter vectors and pCMV-b-galactosidase were transiently transfected into HT22 cells, with or without CP2 shRNA vectors. Forty-
eight hours after transfection, cells were exposed to various concentrations of Ab
1–42

(50 or 100 nM) and Ab
25–35
(5, 10 and 20 lM) for 12 h,
then luciferase activity was measured (upper panel). Data were normalized using b-galactosidase activity, and are expressed as the relative
luciferase units compared to the control. Protein levels were verified by Western blotting using antibodies against transferrin, CP2 and
b-tubulin (as a loading control) (bottom panels). The band intensity was measured, and transferrin protein levels were normalized relative to
b-tubulin. (C,D) After transfection and Ab treatment in HT22 cells as described above, cells were cross-linked with 1% formaldehyde and
chromatin immunoprecipitations were performed using the CP2 antibody or rabbit IgG as a negative control. Binding of CP2 to the transferrin
was detected by performing PCR using primers to the highly conserved transferrin promoter site. The ChIP experiments were performed
several times, and representative gel images are shown. The equivalent of 1% of the chromatin used for each ChIP assay was also run on
each gel (left panels). After ChIP, the band intensity was measured and the normalized expression level under each condition was calculated
relative to the input level (right panels). All data are representative of three independent experiments, and statistical significance was
determined using Tukey’s post hoc test (**P < 0.01; n.s., not significant).
Regulation of transferrin expression by CP2 S M. Jang et al.
4060 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS
+10 in the GSK3b promoter [37]. Up-regulated
GSK3b expression accelerates tau phosphorylation,
which causes neuronal cell death by formation of
NFTs. The level of transferrin was significantly
up-regulated in the frontal cortex of AD patients com-
pared with aged normal cases [36]. Although normal
levels of transferrin protein are known to function as
anti-oxidants, it is thought that up-regulation of trans-
ferrin may cause problems associated with iron over-
load, such as hyperferritinemia [38].
It has been reported that CP2 interacts with the
intracellular domain of amyloid precursor protein
(AICD). AICD consists of 50 or 59 amino acids, and
is produced in the cytosol via the action of c-secretase
during the amyloid precursor protein processing path-

way. AICD is translocated to the nucleus through
interaction with adaptor protein Fe65 [39], after which
it acts as a co-activator by forming a ternary complex
with Tip60 [40] or CP2 [39]. We observed an increase
in transferrin mRNA expression when AICD protein
was co-located with CP2 on the transferrin promoter
(Fig. S1A,B). In addition, we found that CP2 modu-
lates transferrin expression, with increased binding
affinity to the transferrin promoter in the presence of
Ab (both Ab
1–42
and Ab
25–35
) (Fig. 5). However, it is
still not clear how A b modulates the binding affinity
of CP2. These findings raised the possibility that accu-
mulation of Ab increases the intracellular ROS level
[16], and that increased oxidative stress up-regulates
the activity of c-secretase [41–43]. This may increase the
production of AICD and result in up-regulation of the
AICD–CP2 complex. Thus, we believe that increased
production of AICD by Ab-related oxidative stress
may stabilize the AICD–Fe65–CP2 ternary complex
and increase the transferrin level by enhancing the
transcriptional activity of CP2. The addition of Ab to
CP2 shRNA-transfected HT22 cells resulted in
increased cell viability (Fig. S1C), suggesting that the
target genes of CP2 such as transferrin, GSK3b or gly-
cinamide ribonucleotide synthetase ⁄ aminoimidazole
ribonucleotide synthetase ⁄ glycinamide ribonucleotide

transformylase may be involved in neurodegeneration
or cell death. These results imply that CP2 plays an
important role in Ab-mediated neurodegeneration.
Despite intensive studies, there are few therapies
available for AD. Accordingly, strategies including
searching for and regulating factors that are involved
in AD pathology and cell survival are required to
improve treatment options. In the present study, we
identified CP2 as a transcriptional mediator of trans-
ferrin gene expression in response to Ab in HT22 cells.
This is a newly discovered molecular mechanism by
which AD may develop, and suggests a novel possibil-
ity for AD treatment and prevention.
Experimental procedures
Cell culture and transfections
Human embryonic kidney 293 (HEK293) cells were
obtained from the American Type Culture Collection
(Manassas, VA, USA). HEK293 and HT22 cells were
maintained in Dulbecco’s modified Eagle’s medium supple-
mented with 10% fetal bovine serum (Invitrogen, Carlsbad,
CA, USA) and penicillin–streptomycin (50 unitsÆmL
)1
). The
b-amyloid peptides Ab
1–42
(A9810) and Ab
25–35
(A4559)
were purchased from Sigma-Aldrich (St Louis, MO, USA).
Transient transfection was performed using Lipofecta-

mine 2000 (Invitrogen) with various plasmid DNAs accord-
ing to the manufacturer’s instructions.
Plasmid constructs
Full-length CP2 was cloned into the FLAG expression vector.
The human CP2 (hCP2) full-length coding region was ampli-
fied from hCP2 cDNA in the human brain library (Clontech,
Mountain View, CA) by PCR using primers 5¢-AAGCT
TATGGCCTGGGCTCTG-3¢ and 5¢-GTCGACCTACT
TCAGTATGAT-3¢, which contain HindIII and SalI sites,
respectively. It was introduced into the pFLAG-CMV2 vector
(Sigma-Aldrich), and the presence of the hCP2 clone was veri-
fied by DNA sequencing. pGEX4T1-CP2 and CP2 shRNA
were a gift from C.G. Kim (School of Life Sciences, Hanyang
University, Seoul, Korea).
Construction of reporter plasmids
As the first step in generating the luciferase reporter con-
structs, a human transferrin promoter sequence ()600 to
)1) was generated by PCR using the human genomic DNA
as a template and primers 5¢-AAGCTTAGGAGCC
TGAGCTCA-3¢ (forward) and 5¢-AAGCTTAG
CCTCCGGCGCCCC-3¢ (reverse). This PCR product was
digested with HindIII, introduced into the pGL4.12 basic
vector (Promega, Madison, WI) and verified by DNA
sequencing. CP2 binding sequence deletion mutants of the
transferrin promoter ()82 bp, TF-luc mut1; )131 bp,
TF-luc mut2; )188 bp, TF-luc mut3) were prepared by
PCR from the wild-type transferrin–luciferase construct
(TF-luc WT) using the reverse oligonucleotide primers
5¢-AAGCTTAGCCGGGTTGCCCAA-3¢ (TF-luc mut1),
5¢-AAGCTTCCACTGATCACCTCA-3¢ (TF-luc mut2) and

5¢-AAGCTTGCACAGAAATGTTGA-3¢ (TF-luc mut3)
and the forward primer given above for the TF-luc WT
construct. The amplified promoter sequences were cloned
into the HindIII sites of the pGL4.12 basic vector and then
S M. Jang et al. Regulation of transferrin expression by CP2
FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4061
verified by DNA sequencing using primer 5¢-CTAGCAA
AATAGGCTGTCCC-3¢.
Luciferase assay
The HEK293 cells were cultured in 60 mm diameter dishes,
and a total of 600–800 ng DNA including both the lucifer-
ase reporter constructs and pCMV-b-galactosidase together
with FLAG-tagged CP2 and ⁄ or CP2 shRNA was transfect-
ed using Lipofectamine 2000. After 48 h of transfection,
cells were lysed in reporter lysis buffer (Promega). The
HT22 cells were cultured in 60 mm diameter dishes and
transfected with the firefly luciferase transferrin reporter
gene (0.1 lg) together with pCMV-b-galactosidase and ⁄ or
CP2 shRNA. After 48 h of transfection, transfected HT22
cells were treated with Ab. Twelve hours after Ab treat-
ment, cells were lysed in reporter lysis buffer. Cell extracts
were analyzed with the luciferase reporter assay system
using a Glomax luminometer (Promega). Luciferase activi-
ties were normalized based on the b-galactosidase activity
of the co-transfected vector. All transfection experiments
were repeated at least three times independently.
Western blotting
For Western blot analysis, HEK293 and HT22 cells were
harvested in cold phosphate-buffered saline and lysed in a
buffer containing 1% Triton X-100, 150 mm NaCl, 50 mm

Tris ⁄ HCl, pH 7.5, 0.1% SDS, 1% Nonidet P-40 (Sigma-
Aldrich) and 1 mm phenylmethanesulfonyl fluoride. Total
lysates were centrifuged at 10 000 g at 4 °C for 15 min, and
the proteins were electrophoresed by 10% SDS ⁄ PAGE and
transferred to a nitrocellulose membrane (Bio-Rad, Hercu-
les, CA, USA). The membrane was blocked with 5% skim
milk in a solution of 20 mm Tris ⁄ HCl (pH 7.6), 137 mm
NaCl and 0.1% Tween-20, and incubated with appropriate
dilutions of the primary antibody at room temperature for
3 h. Excess primary antibody was removed by sequential
washing, and a 1 : 5000 dilution of the appropriate horse-
radish peroxidase-conjugated secondary antibody was added
to the membrane at room temperature for 1 h. The CP2 anti-
body was kindly provided by C.G. Kim (School of Life Sci-
ences, Hanyang University, Seoul, Korea). The monoclonal
antibody against FLAG (F3165) was purchased from Sigma-
Aldrich. Polyclonal antibodies against transferrin (sc-22597)
and b-tubulin (sc-9104) were purchased from Santa Cruz
Biotechnology Inc. (Santa Cruz, CA, USA). Western
Blotting was visualized by chemiluminescence using an ECL
system (Santa Cruz Biotechnology Inc.).
RNA preparation and RT-PCR
Total RNAs were extracted from HEK293 and HT22 cells
using Trizol reagent (Invitrogen). The reverse transcription
reaction was performed at 42 °C for 1 h in a total volume
of 10 lL containing 800 ng RNA, 10 units of avian myelo-
blastosis virus reverse transcriptase (Intron Biotechnology
Inc., Seoul, Korea) and 100 pmol of oligo(dT) primers. The
resulting cDNA was used as a template for PCR using
0.2 units of ExTaq according to the manufacturer’s recom-

mendations (Takara Biotechnology Inc., Seoul, Korea).
PCR conditions were as follows: denaturation at 95 °C for
3 min, followed by 30 cycles of denaturation at 98 °C for
10 s, annealing at 55 °C for 30 s and extension at 72 °C
for 40 s, and concluding with a final extension at 72 °C for
10 min. The PCR products were separated on a 2% aga-
rose gel and visualized by ethidium bromide staining. The
primers used in PCR were 5¢-CCTGATCCATGGGCTA
AGAA-3¢ (transferrin forward primer), 5¢-CGACCGGAA
CAAACAAAAGT-3¢ (transferring reverse primer), 5¢-GA
GTCAACGGATTTGGTCGT-3¢ (GAPDH forward pri-
mer) and 5¢-TTGATTTTGGAGGGATCTCG-3¢ (GAPDH
reverse primer). The expression level of GAPDH was used
as an internal control.
Electrophoretic mobility shift assays (EMSA)
GST–CP2 fusion proteins and GST proteins were expressed
in Escherichia coli strain BL21. Fusion proteins were puri-
fied using glutathione–Sepharose (GE Healthcare, Piscata-
way, NJ, USA), and their concentration was determined
by the Bradford assay using Bio-Rad protein assay kit
(Bio-Rad, CA, USA) according to the manufacturer’s
instruction. Single-stranded complementary oligonucleotides
were annealed and end-labeled with [c-
32
P]ATP using T4
polynucleotide kinase. The DNA sequences of the oligonu-
cleotides corresponding to the conserved CP2 element in
the proximal transferrin promoter at positions )63 to )24
are 5¢-TTATTCCATTCCCGGCCTGGGCGGGCTGGGC
GCAATCTTT-3¢ (sense) and 5¢-AAAGATTGCGCCCAG

CCCGCCCAGGCCGGGAATGGAATAA-3¢ (antisense).
EMSA was performed with 40 or 80 ng of GST or GST-
fused CP2 protein in binding buffer (100 mm Tris ⁄ HCl, pH
7.5, 10 mm EDTA, 1 m KCl, 1 mm dithiothreitol, 50%
glycerol and 100 ngÆlL
)1
BSA). For competition or
supershift assays, the indicated unlabeled oligonucleotide
competitor or CP2 antibody (2 lL) was added 30 min prior
to addition of radiolabeled probe. After addition of the
radiolabeled probe, the samples were incubated for 30 min
at 30 °C and loaded on a 5% native polyacrylamide gel in
1 · Tris ⁄ acetate ⁄ EDTA (TAE) buffer, electrophoresed,
dried and exposed to X-ray film.
Chromatin immunoprecipitation (ChIP)
ChIP was performed according to the instructions provided
by Upstate Biotechnology, Inc. (Lake Placid, NY). Briefly,
HT22 cells treated or untreated with 100 nm Ab
1–42
or
20 lm Ab
25–35
. Twelve hours after Ab treatment, cells were
cross-linked with 1% formaldehyde in medium for 15 min
Regulation of transferrin expression by CP2 S M. Jang et al.
4062 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS
at 37 °C. Cells were then washed with ice-cold NaCl ⁄ P
i
and
resuspended in 200 lL of SDS sample buffer containing a

protease inhibitor mixture. The suspension was sonicated
three times for 10 s each with a 1 min cooling period on
ice, and 1% of each sample was retained as the input frac-
tion. The chromatin solution was pre-cleared with 20 lLof
protein A–agarose beads blocked with sonicated salmon
sperm DNA for 30 min at 4 °C. The beads were removed,
and the solution was immunoprecipitated overnight with
5 lg of the CP2 antibody at 4 °C, followed by incubation
with 40 lL of protein A–agarose beads for an additional
1 h at 4 ° C. Normal rabbit IgG was used as a negative con-
trol. The immune complexes were eluted with 100 lLof
elution buffer (1% SDS and 0.1 m NaHCO
3
), and formal-
dehyde cross-links were reversed by heating at 65 °C for
6 h. Proteinase K was added to the reaction mixtures,
which were incubated at 45 °C for 1 h. Immunoprecipitated
DNA and control input DNA was purified using the phe-
nol ⁄ chloroform extraction method, and then analyzed
by semi-quantitative PCR using the human transferrin
promoter-specific primers 5¢-CGCGATGACAATGGCTG
CATTGTG-3¢ (forward) and 5¢-TGAGCAGCGAGCACA
GTCGGACTC-3¢ (reverse). The PCR conditions were
95 °C for 3 min, then 98 °C for 10 s, 62 °C for 30 s and
72 °C for 50 s for 35 cycles.
Statistical analysis
Statistical analysis of variances between two experimental
groups was performed using Tukey’s post hoc comparison
test with Statistical Package for the Social Sciences (SPSS)
version 11.5. All experiments were repeated at least three

times. Differences are considered significant at P < 0.01.
Acknowledgements
This work was supported by the Mid-career
Researcher Program through National Research Foun-
dation of Korea grants funded by the Korean govern-
ment (grant numbers 2009-0079913 and 2010-0000409).
This work was supported by the Seoul R&BD
Program (grant number 10543) and the BK21 Program.
References
1 Albert MS (1996) Cognitive and neurobiologic markers
of early Alzheimer disease. Proc Natl Acad Sci USA 93,
13547–13551.
2 Selkoe DJ (1999) Translating cell biology into therapeu-
tic advances in Alzheimer’s disease. Nature 399, A23–
A31.
3 Lovestone S, Reynolds CH, Latimer D, Davis DR,
Anderton BH, Gallo JM, Hanger D, Mulot S,
Marquardt B, Stabel S et al. (1994) Alzheimer’s
disease-like phosphorylation of the microtubule-
associated protein tau by glycogen synthase kinase-3
in transfected mammalian cells. Curr Biol 4, 1077–
1086.
4 Litersky JM & Johnson GV (1992) Phosphorylation by
cAMP-dependent protein kinase inhibits the degrada-
tion of tau by calpain. J Biol Chem 267, 1563–1568.
5 Feijoo C, Campbell DG, Jakes R, Goedert M &
Cuenda A (2005) Evidence that phosphorylation of the
microtubule-associated protein Tau by SAPK4 ⁄ p38delta
at Thr50 promotes microtubule assembly. J Cell Sci
118, 397–408.

6 Anderton BH, Brion JP, Couck AM, Davis DR, Gallo
JM, Hanger DP, Ladhani K, Latimer DA, Lewis C,
Lovestone S et al. (1995) Modulation of PHF-like tau
phosphorylation in cultured neurones and transfected
cells. Neurobiol Aging 16 , 389–397. discussion 398–402.
7 Sperber BR, Leight S, Goedert M & Lee VM (1995)
Glycogen synthase kinase-3b phosphorylates tau protein
at multiple sites in intact cells. Neurosci Lett 197,
149–153.
8 Nunomura A, Perry G, Aliev G, Hirai K, Takeda A,
Balraj EK, Jones PK, Ghanbari H, Wataya T,
Shimohama S et al. (2001) Oxidative damage is the
earliest event in Alzheimer disease. J Neuropathol Exp
Neurol 60, 759–767.
9 Markesbery WR (1997) Oxidative stress hypothesis in
Alzheimer’s disease. Free Radic Biol Med 23, 134–147.
10 Smith MA, Rottkamp CA, Nunomura A, Raina AK &
Perry G (2000) Oxidative stress in Alzheimer’s disease.
Biochim Biophys Acta 1502, 139–144.
11 Smith CD, Carney JM, Starke-Reed PE, Oliver CN,
Stadtman ER, Floyd RA & Markesbery WR (1991)
Excess brain protein oxidation and enzyme dysfunction
in normal aging and in Alzheimer disease. Proc Natl
Acad Sci USA 88, 10540–10543.
12 Smith MA, Richey Harris PL, Sayre LM, Beckman JS
& Perry G (1997) Widespread peroxynitrite-mediated
damage in Alzheimer’s disease. J Neurosci 17, 2653–
2657.
13 Gabbita SP, Lovell MA & Markesbery WR (1998)
Increased nuclear DNA oxidation in the brain in

Alzheimer’s disease. J Neurochem 71, 2034–2040.
14 Barja G & Herrero A (2000) Oxidative damage to mito-
chondrial DNA is inversely related to maximum life
span in the heart and brain of mammals. FASEB J 14,
312–318.
15 Praprotnik D, Smith MA, Richey PL, Vinters HV &
Perry G (1996) Plasma membrane fragility in dystrophic
neurites in senile plaques of Alzheimer’s disease: an
index of oxidative stress. Acta Neuropathol 91
, 1–5.
16 Behl C, Davis JB, Lesley R & Schubert D (1994)
Hydrogen peroxide mediates amyloid b protein toxicity.
Cell 77, 817–827.
S M. Jang et al. Regulation of transferrin expression by CP2
FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4063
17 Misonou H, Morishima-Kawashima M & Ihara Y
(2000) Oxidative stress induces intracellular
accumulation of amyloid b-protein (Ab) in human
neuroblastoma cells. Biochemistry 39, 6951–6959.
18 Blass JP, Baker AC, Ko L & Black RS (1990)
Induction of Alzheimer antigens by an uncoupler of
oxidative phosphorylation. Arch Neurol 47, 864–869.
19 Lorenzo A & Yankner BA (1994) b-amyloid neurotox-
icity requires fibril formation and is inhibited by Congo
red. Proc Natl Acad Sci USA 91, 12243–12247.
20 Pike CJ, Burdick D, Walencewicz AJ, Glabe CG &
Cotman CW (1993) Neurodegeneration induced by
b-amyloid peptides in vitro: the role of peptide assembly
state. J Neurosci 13, 1676–1687.
21 Wardman P & Candeias LP (1996) Fenton chemistry:

an introduction. Radiat Res 145, 523–531.
22 Gutteridge JM (1994) Hydroxyl radicals, iron, oxidative
stress, and neurodegeneration. Ann NY Acad Sci 738,
201–213.
23 Smith MA, Harris PL, Sayre LM & Perry G (1997)
Iron accumulation in Alzheimer disease is a source of
redox-generated free radicals. Proc Natl Acad Sci USA
94, 9866–9868.
24 Chiueh CC (2001) Iron overload, oxidative stress, and
axonal dystrophy in brain disorders. Pediatr Neurol 25,
138–147.
25 Zecca L, Youdim MB, Riederer P, Connor JR &
Crichton RR (2004) Iron, brain ageing and neurodegen-
erative disorders. Nat Rev Neurosci 5, 863–873.
26 Connor JR, Menzies SL, St Martin SM & Mufson EJ
(1992) A histochemical study of iron, transferrin, and
ferritin in Alzheimer’s diseased brains. J Neurosci Res
31, 75–83.
27 Grundke-Iqbal I, Fleming J, Tung YC, Lassmann H,
Iqbal K & Joshi JG (1990) Ferritin is a component of
the neuritic (senile) plaque in Alzheimer dementia. Acta
Neuropathol 81, 105–110.
28 Barnhart KM, Kim CG, Banerji SS & Sheffery M
(1988) Identification and characterization of multiple
erythroid cell proteins that interact with the promoter
of the murine a-globin gene. Mol Cell Biol 8, 3215–
3226.
29 Kim CG, Swendeman SL, Barnhart KM & Sheffery M
(1990) Promoter elements and erythroid cell nuclear
factors that regulate a-globin gene transcription

in vitro. Mol Cell Biol 10, 5958–5966.
30 Lim LC, Fang L, Swendeman SL & Sheffery M (1993)
Characterization of the molecularly cloned murine
a-globin transcription factor CP2. J Biol Chem 268,
18008–18017.
31 Lambert JC, Goumidi L, Vrieze FW, Frigard B, Harris
JM, Cummings A, Coates J, Pasquier F, Cottel D,
Gaillac M et al. (2000) The transcriptional factor
LBP
-1c ⁄ CP2 ⁄ LSF gene on chromosome 12 is a genetic
determinant of Alzheimer’s disease. Hum Mol Genet 9,
2275–2280.
32 Aimi J, Qiu H, Williams J, Zalkin H & Dixon JE
(1990) De novo purine nucleotide biosynthesis: cloning
of human and avian cDNAs encoding the trifunctional
glycinamide ribonucleotide synthetase-aminoimidazole
ribonucleotide synthetase-glycinamide ribonucleotide
transformylase by functional complementation in
E. coli. Nucleic Acids Res 18, 6665–6672.
33 Banerjee D & Nandagopal K (2007) Potential interac-
tion between the GARS-AIRS-GART gene and
CP2 ⁄ LBP-1c ⁄ LSF transcription factor in Down
syndrome-related Alzheimer disease. Cell Mol
Neurobiol 27, 1117–1126.
34 Kaltschmidt B, Uherek M, Volk B, Baeuerle PA &
Kaltschmidt C (1997) Transcription factor NF-jBis
activated in primary neurons by amyloid b peptides and
in neurons surrounding early plaques from patients with
Alzheimer disease. Proc Natl Acad Sci USA 94, 2642–
2647.

35 Vukic V, Callaghan D, Walker D, Lue LF, Liu QY,
Couraud PO, Romero IA, Weksler B, Stanimirovic DB
& Zhang W (2009) Expression of inflammatory genes
induced by beta-amyloid peptides in human brain endo-
thelial cells and in Alzheimer’s brain is mediated by the
JNK-AP1 signaling pathway. Neurobiol Dis 34, 95–106.
36 Loeffler DA, Connor JR, Juneau PL, Snyder BS,
Kanaley L, DeMaggio AJ, Nguyen H, Brickman CM &
LeWitt PA (1995) Transferrin and iron in normal,
Alzheimer’s disease, and Parkinson’s disease brain
regions. J Neurochem 65, 710–724.
37 Kim HS, Kim EM, Lee JP, Park CH, Kim S, Seo JH,
Chang KA, Yu E, Jeong S-J, Chong YH et al. (2003)
C-terminal fragments of amyloid precursor protein exert
neurotoxicity by inducing glycogen synthase kinase-3b
expression. FASEB J 17, 1951–1953.
38 Olynyk JK, Gan E & Tan T (2009) Predicting iron
overload in hyperferritinemia. Clin Gastroenterol
Hepatol 7, 359–362.
39 Minopoli G, de Candia P, Bonetti A, Faraonio R,
Zambrano N & Russo T (2001) The b-amyloid precur-
sor protein functions as a cytosolic anchoring site that
prevents Fe65 nuclear translocation. J Biol Chem 276,
6545–6550.
40 Cao X & Sudhof TC (2001) A transcriptionally [correc-
tion of transcriptively] active complex of APP with
Fe65 and histone acetyltransferase Tip60. Science 293,
115–120.
41 Tamagno E, Guglielmotto M, Aragno M, Borghi R,
Autelli R, Giliberto L, Muraca G, Danni O, Zhu X,

Smith MA et al. (2008) Oxidative stress activates a posi-
tive feedback between the c- and b-secretase cleavages
of the b-amyloid precursor protein. J Neurochem 104
,
683–695.
Regulation of transferrin expression by CP2 S M. Jang et al.
4064 FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS
42 Shen C, Chen Y, Liu H, Zhang K, Zhang T, Lin A
& Jing N (2008) Hydrogen peroxide promotes Ab
production through JNK-dependent activation of
c-secretase. J Biol Chem 283, 17721–17730.
43 Quiroz-Baez R, Rojas E & Arias C (2009) Oxidative
stress promotes JNK-dependent amyloidogenic process-
ing of normally expressed human APP by differential
modification of a-, b- and c-secretase expression.
Neurochem Int 55, 662–670.
Supporting information
The following supplementary material is available:
Fig. S1. Amyloid precursor protein (APP) involvement
in CP2-mediated transcription.
Appendix S1. Cell viability assay.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.

S M. Jang et al. Regulation of transferrin expression by CP2
FEBS Journal 277 (2010) 4054–4065 ª 2010 The Authors Journal compilation ª 2010 FEBS 4065