Báo cáo khoa học: Overexpression of human histone methylase MLL1 upon exposure to a food contaminant mycotoxin, deoxynivalenol docx

Overexpression of human histone methylase MLL1
upon exposure to a food contaminant mycotoxin,
deoxynivalenol
Khairul I. Ansari
1
, Imran Hussain
1
, Hriday K. Das
2
and Subhrangsu S. Mandal
1
1 Department of Chemistry and Biochemistry, The University of Texas at Arlington, TX, USA
2 Pharmacology & Neuroscience, University of North Texas Health Science Center, Fort Worth, TX, USA
Elucidating the regulatory network of proto-oncogenes
in normal healthy cells and under toxic stress is impor-
tant for understanding the mechanism of human dis-
eases [1–5]. Mixed lineage leukemias (MLLs) are a set
of evolutionary conserved genes that are often rear-
ranged and misregulated in acute lymphoblastic and
myeloid leukemias [1,2,6]. Humans encode several
MLL protein families, such as MLL1, MLL2, MLL3,
MLL4 and Set1 [1,7–14]. In general, they are master
regulators of homeobox (Hox) genes which are critical
for cell differentiation and development [1,2,15,16].
Because of their importance in gene regulation and dis-
ease, researchers have purified MLL proteins from
human cells and have demonstrated that MLLs posses
histone H3 lysine-4-specific methyl-transferase activities
and play a critical role in gene activation [9,17–20].
MLLs exist as multiprotein complexes inside cells with
several common protein subunits such as Ash2, Wdr5,

Rbbp5 and CGBP [1,9,10,19,21]. Recently, we affinity
purified several MLL complexes from human cells and
demonstrated that MLL1 plays critical roles in his-
tone H3 lysine-4 methylation and Hox gene regulation
[21]. We also demonstrated that downregulation of
MLL1 results in cell-cycle arrest in the G
2
⁄ M phase
indicating its critical role in cell-cycle progression [22].
Although recent discoveries of MLL-associated his-
tone H3 lysine-4-specific methyl-transferase activities
have shed significant light on the complex function of
MLLs in gene regulation, little is known about their
own regulation in normal cells or in cells under stress
[1]. However, it has been reported that certain chemo-
therapeutic stresses result in MLL rearrangement and
misregulation, leading to the development of secondary
leukemias in humans [23,24]. These observations indi-
cated that MLL1 is stress-responsive gene. Herein, we
studied the effect of a potential carcinogenic mycotox-
Keywords
deoxynivalenol; mixed lineage leukemia;
MLL; mycotoxin; Sp1
Correspondence
S. S. Mandal, Department of Chemistry and
Biochemistry, The University of Texas at
Arlington, Arlington, TX 76019, USA
Fax: +1 817 272 3808
Tel: +1 817 272 3804
E-mail:

(Received 2 February 2009, revised 29
March 2009, accepted 7 April 2009)
doi:10.1111/j.1742-4658.2009.07055.x
Mixed lineage leukemias (MLLs) are histone-methylating enzymes with
critical roles in gene expression, epigenetics and cancer. Although MLLs
are important gene regulators little is known about their own regulation.
Herein, to understand the effects of toxic stress on MLL gene regulation,
we treated human cells with a common food contaminant mycotoxin,
deoxynivalenol (DON). Our results demonstrate that MLLs and Hox genes
are overexpressed upon exposure to DON. Studies using specific inhibitors
demonstrated that Src kinase families are involved in upstream events in
DON-mediated upregulation of MLL1. Sequence analysis demonstrated
that the MLL1 promoter contains multiple Sp1-binding sites and impor-
tantly, the binding of Sp1 is enriched in the MLL1 promoter upon expo-
sure to DON. Moreover, antisense-mediated knockdown of Sp1 diminished
DON-induced MLL1 upregulation. These results demonstrated that MLL1
gene expression is sensitive to toxic stress and Sp1 plays crucial roles in the
stress-induced upregulation of MLL1.
Abbreviations
ChIP, chromatin immunoprecipitation; DON, deoxynivalenol; Hox, homeobox; MLL, mixed lineage leukemia.
FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3299
in, deoxynivalenol (DON) on the regulation of MLL1.
Notably, DON is a toxin produced by pathogenic
fungi during the infection of cereal crops and is often
linked with various acute and chronic human diseases,
including cancer [25–27]. Herein, we report that MLL1
and its target Hox genes are upregulated upon expo-
sure to DON and transcription factor Sp1 plays criti-
cal roles in the DON-mediated upregulation of MLL1.
Results

DON induces expression of MLL
To understand the effects of mycotoxic stress on MLL
expression, we treated cultured human cells
(H358 cells) with varying concentrations of DON (up
to 33 lm) for 7.5 h. We isolated RNA from the treated
and untreated control cells and subjected it to RT-
PCR with primers specific to MLL1 and Set1. As seen
in Fig. 1A,B, treatment with DON induced two- to
five-fold overexpression of MLL1 and Set1 in a con-
centration-dependent manner. MLL1 overexpression
by DON was more dramatic (8.3-fold) at the protein
level (lane 4, Fig. 1C,D). The decrease in expression of
MLL1 and Set1 at 10 h or longer (Fig. 1C,D) is likely
caused by cell death induced by DON. Because MLL1
is upregulated upon exposure to DON, we analyzed
the expression of several other proteins (such as
Rbbp5, Wdr5 and Ash2) known to interact with
MLL1 [9,21]. We also analyzed the effect of DON on
expression of some MLL1 target Hox genes (HoxA2,
HoxA7, HoxB1, HoxB7, etc.). Importantly, similar to
MLL1, Rbbp5 and Wdr5 were overexpressed upon
treatment with DON, whereas Ash2 was not affected
significantly (Fig. 2). Similarly, HoxA7, HoxA2 and
HoxB1 were overexpressed, whereas HoxB7 was down-
regulated upon exposure to DON (Fig. 2 and data not
shown). The upregulation of MLL1, its several inter-
Incubation
time (h)
1 2 3 4 5 6
0 2.5 5 7.5 10 15

β -actin
MLL1
Set1
0
2
4
6
8
10
MLL1 Set1
0 h
2.5 h
5 h
7.5 h
10 h
15 h
o t e v i t a l e r ( e s a e r c n i d l o F
) l o r t n o c
o t e v i t a l e r ( e s a e r c n i d l o F
) l o r t n o c
1
2
3
4
5
6
MLL1
Set
1
0.33 µM

3.3 µM
33 µM
β -actin
MLL1
Set1
1 2 3 4 5 6 7 8
0 0.33 3.3 33
DON (µ
M)
AC
B D
Fig. 1. DON-induced expression of MLL1
and Set1. (A) Human lung cancer cells
(H358) were treated with varying concentra-
tions (0–33 l
M) of DON for 7.5 h. Total RNA
was subjected to RT-PCR analysis with
primers specific to b-actin (control), MLL
1
and Set1. Each experiment was duplicated
for accuracy. (B) Quantification of MLL
1 and
Set1 expression as seen in (A). Bars indi-
cate SEM. (C) Total protein extracts from
DON (3.3 l
M DON for various time points)
treated H358 cells were analyzed by wes-
tern blot using anti-actin (control), anti-MLL
1
and anti-Set1 Ig. (D) Quantification of

expressed proteins as seen in (C) relative
to actin.
Water DON
1 2 3 4 5 6 7 8
β -actin
Rbbp5
Ash2
Wdr5
HoxA7
HoxB7
o t e v i t a l e r ( e s a e r c n i d l o F
)
l
o
r t n
o c
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
4.0
5
p b
b
R
5 r d

W
2 h s A
7 A x o H
7 B
x o H
A B
Fig. 2. DON-induced expression of MLL1-int-
eracting and target genes (A). Human lung
cancer cells (H358) were treated with 3.3 l
M
DON for 7.5 h. Total RNA was subjected to
RT-PCR analysis with primers specific
for b-actin (control), Rbbp5, WDR5, Ash2,
HoxA7 and HoxB7. Lanes 1–4, untreated
control; lanes 5–8, treated with DON (B).
Quantification of gene expression level as
seen in (A). Bars indicate SEM.
MLL1 misregulation by deoxynivalenol K. I. Ansari et al.
3300 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS
acting proteins or selected target Hox genes upon
exposure to DON indicated that expression of these
proteins is sensitive to toxic stress.
Notably, we analyzed the effects of DON on cell
growth and determined the cytotoxicity (IC
50
) towards
H358 cells using a 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyl-tetrazolium bromideassay, as described previ-
ously [28]. Upon treatment with 3.3 lm DON, up to 5,
47 and 68% of H358 cells were killed at 7.5, 24 and

72 h post treatment, respectively. The IC
50
value is
determined to be 1 lm. These results demonstrated
that DON is significantly cytotoxic towards human
cells.
Src kinase inhibitor suppressed the DON-induced
upregulation of MLL1
To understand potential mechanism of DON-mediated
upregulation of MLL1 and Hox genes, we examined
the involvement of different DON-responsive signaling
pathways. Because DON is known to induce ribotoxic
stress that instigates various signaling cascades, includ-
ing MAP ⁄ Src kinases [29–33], we initially examined
whether inhibition of MAP ⁄ Src kinase activation had
any effect on DON-induced upregulation of MLL1.
We treated cells with a Src kianse inhibitor (PP2) or a
MAP kinase inhibitor (PD98059) and then exposed the
cells to DON. As expected, MLL1 was upregulated
upon treatment with DON (lanes 1 and 4–7, Fig. 3).
However, upon treatment with PP2, DON-induced
expression of MLL1 and HoxA7 was suppressed in a
concentration-dependent manner at both the mRNA
and protein levels (compare lanes 4–7 with lane 1,
Fig. 3A,B). These results indicated that Src kinases
play a critical role in regulating upstream events that
lead to MLL1 and HoxA7 upregulation by DON.
Notably, PP2 has no significant effect on DON-
induced expression of Set1, Rbbp5, Ash2 and Wdr5
(data not shown) suggesting the involvement of alter-

nate pathways. Because MLL1 induction was sup-
pressed by Src kinase inhibitor (PP2), we examined
whether MAP kinases are also involved in DON-medi-
ated MLL1 upregulation. However, application of
PD98059 did not have any significant effect on DON-
induced upregulation of MLL1, indicating no involve-
ment of MAP kianses in this process (Fig. 3C).
Sp1 plays a critical role in DON-induced MLL1
upregulation
To understand the mechanism of MLL1 upregulation
by DON, we analyzed the MLL1 promoter for the
presence of various cis-elements recognized by specific
transcription factors (such as Sp1, AP2), particularly
those known to be activated by mycotoxins [27,29–36].
Interestingly, we found the presence of multiple Sp1-
binding sites in the MLL1 promoter ()3000 to
+500 nucleotide region; Fig. 4). To investigate possi-
ble role of Sp1 in MLL1 gene regulation, we knocked
down Sp1 in H358 cells by using Sp1-specific antisense
and then analyzed the expression of MLL1 in the
absence and presence of DON (3.3 lm). As seen in
Fig. 5A,B, treatment with Sp1 antisense effectively
knocked down Sp1 expression at both the mRNA and
the protein level (compare lanes 1 with 3). Upon
knockdown of Sp1, the basal level of MLL1 expression
was not significantly affected at the mRNA or the
PP2 (µM)
DON (3.3 µ
M)
+ + –

– –
–
+ + + +
1 2 3 4 5 6 7
β -actin
MLL1
HoxA7
Ash2
10 0.1 1 10 25
A

+ +
+ +
PP2 (µ
M)
10 0.1 1 10 25
β -actin
MLL1
Ash2
DON (3.3 µ
M)
1 2 3 4 5 6 7
–
–
–
+ –
B
PD89059 (µM)
DON (3.3 µ
M)

+ + + + +
1 2 3 4 5 6 7
β -actin
MLL1
–
–
– –
25 1 5 25 50
C
Fig. 3. Effect of DON on expression of MLL1 and HoxA7 genes in
presence of MAP ⁄ Src kinase inhibitor PP2 and PD98059.
H358 cells were treated 0.1, 1, 10 and 25 l
M PP2 and 1, 5, 25 and
50 l
M PD98059 for 1 h prior to treatment with 3.3 lM DON for an
additional 7.5 h. (A). RT-PCR analysis of RNA extract from cells
treated with PP2 with primers specific to b-actin (control), MLL1,
Ash2 and HoxA7. (B) Western blot of the total proteins extract of
the cells treated with PP2 with antibodies specific for b-actin, MLL
1
and Ash2. (C) RT-PCR analysis of RNA extract from cells treated
with PD98059 with primers specific to b-actin (control) and MLL1.
Each experiment was performed in duplicate.
K. I. Ansari et al. MLL1 misregulation by deoxynivalenol
FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3301
protein level (Fig. 5A,B, lanes 1 and 3). Interestingly,
however, DON-induced upregulation of MLL1
(mRNA and protein level) was suppressed to almost
normal levels under an Sp1 knocked down environ-
ment (Fig. 5A,B, lanes 2 and 4). These results indi-

cated that Sp1 is critical for MLL1 regulation,
especially in presence of DON.
Because the MLL1 promoter contains multiple Sp1-
binding sites and our results demonstrated that Sp1 is
critical in regulating MLL1 on exposure to DON, we
hypothesized that DON modulates binding of Sp1 to
the MLL1 promoter. To confirm our hypothesis, we
treated H358 cells with 3.3 lm DON and subjected
them to chromatin immunoprecipitation (ChIP) using
anti-Sp1 Ig (Fig. 5C,D). In parallel, we also performed
ChIP with an unrelated antibody (actin antiserum).
The immunoprecipitated DNA fragments were PCR
amplified using primers specific for MLL1 promoter
regions R1 ()497 to )593), R2 ()5to )105), MLL1-
ORF (as control) and b-actin-ORF (a second unre-
lated control). Our results demonstrated that no Sp1
was bound to the ORF region of actin in either the
absence or presence of DON (Fig. 5C, upper, lanes
5 and 6). Similarly, Sp1 binding was not enriched in
the MLL1-ORF region in the presence of DON
(MLL1-ORF; Fig. 5C, lanes 5 and 6). Interestingly,
however, the binding of Sp1 was significantly enriched
in the Sp1-binding sites of the MLL1 promoter regions
R1 and R2 in the presence of DON, although more
enrichment was observed in the R2 region (closer to
the transcription start site) (Fig. 5C,D, lanes 5 and 6).
ChIP analysis showed no binding of b-actin to the
MLL1 promoters and ORF region, irrespective of the
presence or absence of DON (Fig. 5C, lanes 3 and 4).
These results demonstrated that binding and enrich-

ment of Sp1 to the MLL1 promoter regions (R1 and
R2) in the presence of DON is specific and this dem-
onstrates that Sp1 is crucial for transcriptional activa-
tion of MLL1 under DON treatment.
Furthermore, because phosphorylation of Sp1 is well
known to be associated with toxic stress, we analyzed
the state of Sp1 phosphorylation upon DON exposure
[33,37]. We performed immunoprecipitation of Sp1
using anti-Sp1 Ig (nonphosphorylated) from DON-
treated and untreated cells. We analyzed the immuno-
precipitates by western blot using both anti-Sp1 Ig
(nonphosphorylated) and anti-phosphotyrosine Ig that
recognize tyrosine-phosphorylated proteins. Interest-
ingly, upon DON treatment, the protein level of Sp1
was not significantly affected, although, the level of
tyrosine-phosphorylated Sp1
was increased (Fig. 5E).
These results indicated that DON induces phosphory-
lation of Sp1 and this might be linked with MLL1
upregulation.
Discussion
Because MLLs are proto-oncogenes and are known to
be rearranged or misregulated under chemotherapeutic
stress, leading to secondary leukemias [23,24], elucidat-
ing the stress responsive regulatory mechanism of
MLL is important. Herein, our studies showed that
exposure to mycotoxin DON-induced expression of
MLL1, several MLL interacting proteins and MLL
target Hox genes. Notably, MLL1 exists as a multipro-
tein complex inside the cell with subunits like Ash2,

Wdr5 and Rbbp5, and MLL1 executes its histone
methyl-transferase activity and regulates target Hox
genes in the context of the multiprotein complex
[1,9,10]. Therefore, because MLL1 and several Hox
genes (HoxA7, HoxA2, etc.) were overexpressed upon
exposure to DON, we anticipated that MLL-interact-
ing proteins might be upregulated in a similar fashion.
However, our results demonstrated that although
several MLL1-interacting proteins such as Wdr5 and
Rbb5 were upregulated upon exposure to DON,
Ash2 expression was not significantly affected. These
observations suggest that Ash2 is a unique component
of MLLs and may have other distinct functions that
are yet to be revealed. It is also possible that Ash2 is
normally distributed in different protein complexes
which may be redistributed (without being induced)
under stress to compensate for the higher expression of
MLL1. This aspect needs further investigation for
complete understanding. Similarly, although the MLL1
Fig. 4. Sp1-binding sites in the MLL1 promoter. MLL1 gene pro-
moter (from )3000 to +500 bp) sequence was analyzed for pres-
ence of Sp
1-binding sites (GGGCGG, GGCGGG, CCCGCC and
CCGCCC) using promoter screening tool. Puta-
tive Sp
1 Binding sites are underlined. Transcription start site (ATG)
is shown as +1.
MLL1 misregulation by deoxynivalenol K. I. Ansari et al.
3302 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS
target genes HoxA7, HoxA2 and HoxB1, along with

MLL1, were upregulated upon exposure to DON, we
observed that HoxB7 expression decreased. These
results suggested that the mechanism of regulation,
especially in presence of DON, is different for HoxB7
(as well as HoxA2 and HoxB1) and HoxA7, although
they are all targets of MLL1 in normal circumstances
(without DON). Nevertheless, our results showing the
DON-induced upregulation of MLL1 and related pro-
teins indicated that MLL1 and its associated genes are
sensitive to toxic stress.
The effect of DON is very well studied in plants
[38,39]. In mammalian cells, DON induces oxidative
stress, activates MAP ⁄ Src kinases and induces inflam-
mation and oxidative stress-responsive genes such as
interleukins and cyclooxygenase [32,36,40–42]. Using
RT-PCR analysis, we also observed that interleukin-
8 and cyclooxygenase are overexpressed in H358 cells
upon exposure to DON, indicating the induction of
oxidative stress in human cells, as reported earlier
(data not shown) [36,41]. Furthermore, using Src
kinase inhibitor (PP2), we demonstrated that DON-
induced MLL1 and HoxA7 gene upregulation were
alleviated in the presence of PP2. These observations
demonstrated that Src kinases are involved in
upstream events in DON-mediated upregulation of
MLL1 and HoxA7. Notably, our results demonstrated
that application of PP2 has no significant effect on the
DON-induced upregulation of other proteins such as
Set1, Wdr5 and Rbbp5 (data not shown), suggesting
the involvement of alternate pathways in the regulation

of these genes.
Our sequence analysis demonstrated that the MLL1
promoter contains multiple binding sites for Sp1, a
123 45 6
Water DON Water DON Water DON
Input Actin Sp1
Anti-serum
MLL1
( ORF )
MLL1
( R1 )
(R2)
β -actin
1 2 3 4
Water DON Water DON
Scramble
antisense
28S
rRNA
Sp1
MLL1
Sp1
antisense
1 2 3 4
Water DON Water DON
S
cramble
antisense
β -actin
Sp1

MLL1
S
p1
antisense
Sp1
Sp1-p
0 0.33 3.3 33
DON
(µ
M)
0.0
0.2
0.4
0.6
0.8
1.0
Actin Sp1 Actin Sp1 Actin Sp1 Actin Sp1
Actin (ORF) MLL (ORF) MLL1 (R1) MLL1 (R2)
Wate r
DON
o t e v i t a l e r ( t n e m
t i u r c e r d l o F
) t u p n
i
ChIP anti-sera
Target DNA region
A B
C E
D
Fig. 5. Effect of knockdown of Sp1 on

DON-induced upregulation of MLL1.
H358 cells were treated with Sp
1-specific
phosphorothioate antisense for 48 h fol-
lowed by treatment with 3.3 l
M DON for
7.5 h. (A) RT-PCR analysis of Sp
1 and MLL1
using specific primers. 28S rRNA was used
a quantitative control. (B) Total protein was
analyzed by western blot using anti-actin
(control), anti-Sp
1 and anti-MLL1 Ig. (C)
DON-induced recruitment of Sp
1 in the
MLL
1 promoter. H358 cells treated with
3.3 l
M DON for 7.5 h were subjected to
ChIP assay using Sp
1 and actin antibodies.
Actin ChIP was used as a nonspecific anti-
body control. ChIP DNA fragments were
PCR amplified using primer specific to dif-
ferent Sp
1-binding sites in the MLL1 promot-
ers. b-actin (ORF): PCR-amplified ‘+712 to
+1011’ of b-actin (unrelated control); MLL
1
(ORF): PCR-amplified ‘+3190 to +3380’ of

MLL
1 gene (control); MLL1 (R1 and R2)
PCR-amplified ‘)497 to )593’ and ‘)5to
)105’ of the MLL
1 promoter. (D) Quantifica-
tion of Sp
1 recruitment as seen in (C). (E)
Western blot analysis of phosphorylated Sp
1
upon DON treatment. H358 cells were trea-
ted 0–33 l
M DON for 7.5 h. The whole-cell
extracts were immunoprecipitated with anti-
Sp
1 Ig. The Sp1 immunoprecipitate was ana-
lyzed by western blot using both anti-Sp
1
and anti-phosphotyrosine Ig.
K. I. Ansari et al. MLL1 misregulation by deoxynivalenol
FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3303
transcription factor that is well known to be activated
and phosphorylated under stress [29,33,34,36,43]. The
literature relating to mycotoxin-mediated activation of
Sp1 and our results showing the presence of multiple
Sp1-binding sites in the MLL1 promoter, prompted us
to hypothesize that Sp1 plays a critical role in the reg-
ulation of MLL1, especially under mycotoxic stress
[33,37,43]. Our studies demonstrated that antisense-
mediated knockdown of Sp1 suppressed the effects of
DON on upregulation of MLL1. In addition, the level

of Sp1 is enriched in the Sp1-binding regions of the
MLL1 promoter upon exposure to DON. These results
demonstrated that Sp1 acts a mediator in translating
the effects of DON on MLL1 gene upregulation.
Notably, cells respond to stress by activating signaling
pathways that regulate defense responsive genes
[36,38,39]. An early step in the stress response includes
phosphorylation of the MAP ⁄ Src kinases leading to
their activation [36]. Sp1 and other Sp1 family mem-
bers are differentially acetylated, phosphorylated
and ⁄ or glycosylated, and bind variants of a GC-rich
box in promoter of target genes. Because the MLL1
promoter contains multiple Sp1-binding sites and is
regulated by Sp1, as well as the Src family of kinases
on DON treatment, we hypothesized that Sp1 is likely
phosphorylated and recruited to the MLL1 promoter,
resulting in its upregulation. Our studies demonstrated
that Sp1 is phosphorylated upon exposure to DON.
Although, at this point we could not directly analyze
recruitment of the phosphorylated Sp1 into the MLL1
promoter because of the unavailability of the phospho-
Sp1-specific antibody, the increased recruitment of the
Sp1 in the MLL1 promoter may be linked with phos-
phorylation of Sp1.
In conclusion, we demonstrated that MLL1, several
MLL-associated proteins and Hox genes are upregulat-
ed upon exposure to mycotoxin DON via involvement
of Src kinase activation. The transcription factor Sp1
plays critical role in upregulating MLL1 gene expres-
sion under mycotoxic stress. Although further analysis

is needed to understand the detailed mechanism of
MLL gene (and other DON-responsive genes) regula-
tion in normal cell or under stress, our studies estab-
lished a novel link between MLL gene regulation, the
stress response and DON, and revealed critical stress-
responsive MLL1 gene regulatory pathways. Although,
the mechanism is not clear, MLL is well known to be
rearranged and misregulated in various cancers and it
is likely that different types of stresses cause MLL mis-
regulation and rearrangement. As exposure to DON
induces upregulation of MLL1, we hypothesize that
this may be one of the possible mechanism by which
DON exerts is carcinogenic action in human cells.
Experimental procedures
Cell culture and treatments with DON
Human cells (H358, a lung cancer, ATCC) were grown on
RPMI media supplemented with 10% fetal bovine serum,
l-glutamine (1%) and penicillin ⁄ streptomycin (0.1%)
(Sigma, St Louis, MO, USA). For the toxin treatment, cells
were grown to 80% confluence and treated with varying
concentrations of DON (Sigma) for different times, as
needed. Total RNA and proteins were isolated from the
treated and untreated cells and subjected to RT-PCR and
western blot analysis. For the RT-PCR analysis, each
experiment was performed in two to four replicates in par-
allel. For the western blot analysis, proteins from replicate
experiments were pulled together prior to SDS ⁄ PAGE.
Preparation of RNA, nuclear proteins and
whole-cell extract
DON-treated and untreated cells were harvested by centrifu-

gation at 500 g, resuspended in diethyl pyrocarbonate-
treated buffer A (20 mm Tris ⁄ HCl, pH 7.9, 1.5 mm MgCl
2
,
10 mm KCl, 0.5 mm dithiothreitol and 0.2 mm phenyl-
methanesulfonyl fluoride), incubated on ice for 10 min and
then centrifuged at 3500 g for 5 min. The supernatant
containing the cytoplasmic extracts was subjected to phenol–
chloroform extraction followed by LiCl precipitation of
cytoplasmic mRNA by incubating overnight at )80 °C. The
mRNA was washed with diethyl pyrocarbonate treated 70%
EtOH, air dried and resuspended in diethyl pyrocarbonate-
treated water. Nuclear proteins extracts were prepared from
the nuclear pellets, as descried previously [21,22]. For prepa-
ration of whole-cell protein extracts cells were incubated in
whole cells extract buffer (50 mm Tris ⁄ HCl pH 8.0, 150 mm
NaCl, 5 mm EDTA, NP-40, 0.2 mm phenylmethanesulfonyl
fluoride, 1 · protease inhibitors) for 20 min on ice. The
whole cell extract was separated from histone protein by
centrifugation at 12 000 g for 10 min.
RT-PCR and western blots
Reverse transcription reactions were performed in a total
volume of 25 lL containing 1 lg of total RNA, 2.4 lm of
oligo-dT, 100 U of MMLV reverse transcriptase (Promega,
Madison, WI, USA), 1 · first strand buffer (Promega),
100 lm dNTPs, 1 mm dithiothreitol and 20 U of RNaseOut
(Invitrogen, Carlsbad, CA, USA). This cDNA (1 lL) was
used for PCR with primer pairs listed in Table 1. Each of the
experiments was performed in two replicates for three times.
The normality of the data was analyzed by using t-test and

analyses of the variants (ANOVA) were performed at 5%
level of significance.
Equivalent amount of proteins were analyzed in
SDS ⁄ PAGE and subjected to western blot analysis with
MLL1 misregulation by deoxynivalenol K. I. Ansari et al.
3304 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS
specific antibodies. MLL1, MLL2, Set1, Ash2 and Rbbp5,
antibodies were purchased from Bethyl laboratory (Mont-
gomery, TX, USA).
Immunoprecipitation and western blotting of Sp1
and phosphorylated Sp-1
For western blot analysis of the Sp1 expression, equivalent
amounts of whole-cell extract (DON-treated and untreated)
were separated in 8% SDS ⁄ PAGE and subjected to western
blot analysis using anti-Sp 1 Ig (Upstate, Waltham, MA,
USA). For the analysis of DON-induced phosphorylation of
Sp1, we performed immunoprecipitation of Sp1 from the
whole-cell protein extract using anti-Sp1 Ig, as described ear-
lier [21]. The Sp1 immunoprecipitates were electrophoresed
in 8% SDS ⁄ PAGE and subjected to western blot using both
anti-Sp1 (nonphosphorylated) and anti-phosphotyrosine Ig
(Upstate) that recognize tyrosine phosphorylated proteins.
Antisense-mediated knockdown of Sp1
The Sp1 antisense (5¢-CTGAATATTAGGCATCACTCC
AGG-3¢) was transfected into H358 cells using Maxfect
transfection reagent (MoleculA). In brief, H358 cells were
grown to 60% confluence, washed twice with fetal bovine
serum-free RPMI media and then incubated with transfec-
tion reagent–antisense complex for 5 h in serum-free RPMI
prior to the addition of complete growth medium (with 10%

serum). Cells were then incubated for 48 h followed by treat-
ment with 3.3 lm DON for 7.5 h. Cells were then harvested
for RNA, nuclear protein extraction or ChIP analysis. A
scramble antisense without any sequence homology with Sp1
(5¢-CGTTTGTCCCTCCAGCATCT-3¢) was used as control.
ChIP experiment
The ChIP assay was performed using H358 cells and anti-
Sp1 mAb (Bethyl lab) using EZ ChipÔ chromatin immuno-
precipitation kit (Upstate) as described previously [21,22].
Immunoprecipitated DNA obtained from the ChIP was
PCR amplified with different primers (specific to Sp1 rich
sites in MLL1 promoter, Table 1).
Acknowledgements
This work was supported by grants from Texas
Advanced Research Program (00365-0009-2006) and
American Heart Association (SM 0765160Y). We also
thank Saoni Mandal and other Mandal lab members
for critical discussions.
References
1 Ansari KI, Mishra BP & Mandal SS (2009) MLL his-
tone methylases in gene expression, hormone signaling
and cell cycle. Front Biosci 14, 3483–3495.
2 Hess JL (2004) MLL: a histone methyltransferase
disrupted in leukemia. Trends Mol Med 10, 500–507.
3 Bhaumik SR, Smith E & Shilatifard A (2007) Covalent
modifications of histones during development and
disease pathogenesis. Nat Struct Mol Biol 14, 1008–
1016.
4 Jana NR (2008) NSAIDs and apoptosis. Cell Mol Life
Sci 65, 1295–1301.

5 Hampsey M & Reinberg D (2003) Tails of intrigue:
phosphorylation of RNA polymerase II mediates his-
tone methylation. Cell 113, 429–432.
6 Ayton PM & Cleary ML (2001) Molecular mechanisms
of leukemogenesis mediated by MLL fusion proteins.
Oncogene 20, 5695–5707.
7 Hughes CM, Rozenblatt-Rosen O, Milne TA, Copeland
TD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,
Bhattacharjee A, Biondi CA et al. (2004) Menin associ-
ates with a trithorax family histone methyltransferase
complex and with the hoxc8 locus. Mol Cell 13, 587–597.
8 Goo YH, Sohn YC, Kim DH, Kim SW, Kang MJ,
Jung DJ, Kwak E, Barlev NA, Berger SL, Chow VT
et al. (2003) Activating signal cointegrator 2 belongs
Table 1. Primers used for RT-PCR, chromatin immunoprecipitation and antisense experiments.
Primers Forward primer (5¢-to3¢ ) Reverse primer (5¢-to3¢)
b-actin AGAGCTACGAGCTGCCTGAC GTACTTGCGCTCAGGAGGAG
MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC
Set1 CTGACGAGATGGTCATCGAA CGATTTTCTGGGACTCG
Rbbp5 GCATCCATTTCCAGTGGAGT TGGTGACATCCACTTCCTCA
Ash2 CCTGAAGCAGACTCCCCATA AGCCCATGTCACTCATAGGG
HoxA7 TTCCACTTCAACCGCTACCT TTCATACATCGTCCTCCTCGT
Sp1 TCATACCAGGTGCAAACCAA GCTGGGAGTCAAGGTAGCTG
MLL1 (R1) CAGAGCTGGTTAGGCAGGTT CCCCGTGAAGTGAAGCAG
MLL1 (R2) TCGGGCTAACCCATCTTGTA GGGAGAGCAGCTTCCAGTAT
Sp1 antisense CTGAATATTAGGCATCACTCCAGG
a
a
Phosphorothioate antisense oligonucleotide.
K. I. Ansari et al. MLL1 misregulation by deoxynivalenol

FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3305
to a novel steady-state complex that contains a subset
of trithorax group proteins. Mol Cell Biol 23, 140–149.
9 Dou Y, Milne TA, Ruthenburg AJ, Lee S, Lee JW,
Verdine GL, Allis CD & Roeder RG (2006) Regulation
of MLL1 H3K4 methyltransferase activity by its core
components. Nat Struct Mol Biol 13, 713–719.
10 Crawford BD & Hess JL (2006) MLL core components
give the green light to histone methylation. ACS Chem
Biol 1, 495–498.
11 Takeda S, Chen DY, Westergard TD, Fisher JK,
Rubens JA, Sasagawa S, Kan JT, Korsmeyer SJ, Cheng
EH & Hsieh JJ (2006) Proteolysis of MLL family
proteins is essential for taspase1-orchestrated cell cycle
progression. Genes Dev 20, 2397–2409.
12 Glaser S, Schaft J, Lubitz S, Vintersten K, van derHo-
even F, Tufteland KR, Aasland R, Anastassiadis K,
Ang SL & Stewart AF (2006) Multiple epigenetic main-
tenance factors implicated by the loss of Mll2 in mouse
development. Development 133, 1423–1432.
13 Cho YW, Hong T, Hong S, Guo H, Yu H, Kim D,
Guszczynski T, Dressler GR, Copeland TD, Kalkum M
et al. (2007) PTIP associates with MLL3- and MLL4-
containing histone H3 lysine 4 methyltransferase com-
plex. J Biol Chem 282, 20395–20406.
14 Issaeva I, Zonis Y, Rozovskaia T, Orlovsky K, Croce
CM, Nakamura T, Mazo A, Eisenbach L & Canaani E
(2007) Knockdown of ALR (MLL2) reveals ALR target
genes and leads to alterations in cell adhesion and
growth. Mol Cell Biol 27, 1889–1903.

15 Lappin TR, Grier DG, Thompson A & Halliday HL
(2006) HOX genes: seductive science, mysterious mecha-
nisms. Ulster Med J 75, 23–31.
16 Guenther MG, Jenner RG, Chevalier B, Nakamura T,
Croce CM, Canaani E & Young RA (2005) Global and
Hox-specific roles for the MLL1 methyltransferase.
Proc Natl Acad Sci USA 102, 8603–8608.
17 Tenney K & Shilatifard A (2005) A COMPASS in
the voyage of defining the role of trithorax ⁄ MLL-con-
taining complexes: linking leukemogensis to covalent
modifications of chromatin. J Cell Biochem 95, 429–
436.
18 Sims RJ III & Reinberg D (2006) Histone H3 Lys 4
methylation: caught in a bind? Genes Dev 20, 2779–
2786.
19 Lee JS, Shukla A, Schneider J, Swanson SK, Washburn
MP, Florens L, Bhaumik SR & Shilatifard A (2007)
Histone crosstalk between H2B monoubiquitination
and H3 methylation mediated by COMPASS. Cell 131,
1084–1096.
20 Capotosti F, Hsieh JJ & Herr W (2007) Species selectiv-
ity of mixed-lineage leukemia ⁄ trithorax and HCF prote-
olytic maturation pathways. Mol Cell Biol 27,
7063–7072.
21 Ansari KI, Mishra BP & Mandal SS (2008) Human
CpG binding protein interacts with MLL1, MLL2 and
hSet1 and regulates Hox gene expression. Biochim Bio-
phys Acta 1779, 66–73.
22 Mishra BP, Ansari KI & Mandal SS (2009) Dynamic
association of MLL1, H3K4 trimethylation with chro-

matin and Hox gene expression during the cell cycle.
FEBS J 276, 1629–1640.
23 Libura J, Ward M, Solecka J & Richardson C (2008)
Etoposide-initiated MLL rearrangements detected at
high frequency in human primitive hematopoietic stem
cells with in vitro and in vivo long-term repopulating
potential.
Eur J Haematol 81, 185–195.
24 Moneypenny CG, Shao J, Song Y & Gallagher EP
(2006) MLL rearrangements are induced by low doses
of etoposide in human fetal hematopoietic stem cells.
Carcinogenesis 27, 874–881.
25 Richard JL (2007) Some major mycotoxins and their
mycotoxicoses – an overview. Int J Food Microbiol 119,
3–10.
26 Rotter BA, Prelusky DB & Pestka JJ (1996) Toxicology
of deoxynivalenol (vomitoxin). J Toxicol Environ Health
48, 1–34.
27 Pestka JJ & Smolinski AT (2005) Deoxynivalenol: toxi-
cology and potential effects on humans. J Toxicol Envi-
ron Health B Crit Rev 8, 39–69.
28 Ansari KI, Grant JD, Woldemariam GA, Kasiri S &
Mandal SS (2009) Iron(III)–salen complexes with less
DNA cleavage activity exhibit more efficient apoptosis
in MCF7 cells. Org Biomol Chem 7, 926–932.
29 Kinser S, Jia Q, Li M, Laughter A, Cornwell P, Corton
JC & Pestka J (2004) Gene expression profiling in
spleens of deoxynivalenol-exposed mice: immediate
early genes as primary targets. J Toxicol Environ Health
A 67, 1423–1441.

30 Pestka JJ (2008) Mechanisms of deoxynivalenol-induced
gene expression and apoptosis. Food Addit Contam Part
A Chem Anal Control Expo Risk Assess 25, 1128–1140.
31 Wong SS, Zhou HR & Pestka JJ (2002) Effects of
vomitoxin (deoxynivalenol) on the binding of transcrip-
tion factors AP-1, NF-kappaB, and NF-IL6 in
raw 264.7 macrophage cells. J Toxicol Environ Health A
65, 1161–1180.
32 Wong SS, Zhou HR, Marin-Martinez ML, Brooks K &
Pestka JJ (1998) Modulation of IL-1beta, IL-6 and
TNF-alpha secretion and mRNA expression by the
trichothecene vomitoxin in the RAW 264.7 murine
macrophage cell line. Food Chem Toxicol 36, 409–419.
33 Zhang Y, Dickman MB & Jones C (1999) The myco-
toxin fumonisin B1 transcriptionally activates the p21
promoter through a cis-acting element containing two
Sp1 binding sites. J Biol Chem 274, 12367–12371.
34 D’Addario M, Arora PD, Ellen RP & McCulloch CA
(2002) Interaction of p38 and Sp1 in a mechanical
force-induced, beta 1 integrin-mediated transcriptional
circuit that regulates the actin-binding protein filamin-
A. J Biol Chem 277, 47541–47550.
MLL1 misregulation by deoxynivalenol K. I. Ansari et al.
3306 FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS
35 Kuo L, Chang HC, Leu TH, Maa MC & Hung WC
(2006) Src oncogene activates MMP-2 expression via
the ERK ⁄ Sp1 pathway. J Cell Physiol 207, 729–734.
36 Zhou HR, Jia Q & Pestka JJ (2005) Ribotoxic stress
response to the trichothecene deoxynivalenol in the
macrophage involves the SRC family kinase Hck. Toxi-

col Sci 85, 916–926.
37 Ryu H, Lee J, Zaman K, Kubilis J, Ferrante RJ, Ross
BD, Neve R & Ratan RR (2003) Sp1 and Sp3 are oxi-
dative stress-inducible, antideath transcription factors in
cortical neurons. J Neurosci 23, 3597–3606.
38 Ansari KI, Walter S, Brennan JM, Lemmens M,
Kessans S, McGahern A, Egan D & Doohan FM
(2007) Retrotransposon and gene activation in wheat in
response to mycotoxigenic and non-mycotoxigenic-asso-
ciated Fusarium stress. Theor Appl Genet 114, 927–937.
39 Walter S, Brennan JM, Arunachalam C, Ansari KI,
Hu X, Khan MR, Trognitz F, Trognitz B, Leonard G,
Egan D et al. (2008) Components of the gene network
associated with genotype-dependent response of wheat
to the Fusarium mycotoxin deoxynivalenol. Funct Integr
Genomics 8, 421–427.
40 Gray JS & Pestka JJ (2007) Transcriptional regulation
of deoxynivalenol-induced IL-8 expression in human
monocytes. Toxicol Sci 99, 502–511.
41 Islam Z, Gray JS & Pestka JJ (2006) p38 Mitogen-acti-
vated protein kinase mediates IL-8 induction by the
ribotoxin deoxynivalenol in human monocytes. Toxicol
Appl Pharmacol 213, 235–244.
42 Moon Y & Pestka JJ (2003) Deoxynivalenol-induced
mitogen-activated protein kinase phosphorylation and
IL-6 expression in mice suppressed by fish oil. J Nutr
Biochem 14, 717–726.
43 Dynan WS & Tjian R (1983) The promoter-specific
transcription factor Sp1 binds to upstream sequences in
the SV40 early promoter. Cell 35, 79–87.

K. I. Ansari et al. MLL1 misregulation by deoxynivalenol
FEBS Journal 276 (2009) 3299–3307 ª 2009 The Authors Journal compilation ª 2009 FEBS 3307