Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Creation of a new eye lens crystallin (Gambeta) through
structure-guided mutagenic grafting of the surface of bB2
crystallin onto the hydrophobic core of cB crystallin
Divya Kapoor
1
, Balvinder Singh
2
, Karthikeyan Subramanian
1
and Purnananda Guptasarma
1
1 Division of Protein Science & Engineering, Institute of Microbial Technology, Chandigarh 160 036, Council of Scientific & Industrial
Research, New Delhi, India
2 Division of Bioinformatics, Institute of Microbial Technology, Chandigarh 160 036, Council of Scientific & Industrial Research, New Delhi,
India
We have developed a novel protein engineering tech-
nique that we hope will facilitate the rational dissecting
out and independent re-assembly of the various struc-
tural features and residue-packing schemes used in nat-
ure to build the interiors and surfaces of various
structurally homologous b sheet-based proteins.
Recently, we provided a ‘proof-of-principle’ demon-
stration of this technique [1], which we call ‘protein
surface grafting’, by using it to notionally segregate
and re-assort the structural stability features of one
b sheet-based thermophile enzyme (a Cel12A cellulase)
with the functional features of a structurally related
mesophile enzyme (another Cel12A cellulase), to
produce a variant enzyme bearing a still-functioning,
transplanted active surface derived from the mesophile
enzyme, but resembling the thermophile enzyme in

most other respects [1]. The successful creation of such
a meso-active, thermo-stable enzyme encouraged us to
explore the workability of our surface grafting
approach further, to extend it from grafting of ‘active
surfaces’ to grafting of ‘whole-protein surfaces’ or
‘whole-protein interiors’.
Keywords
beta sheet remodeling; lens structural
proteins; protein engineering; protein folding
and stability; protein surface grafting
Correspondence
P. Guptasarma, Division of Protein Science
& Engineering, Institute of Microbial
Technology, Chandigarh 160 036, Council of
Scientific & Industrial Research, New Delhi,
India
Fax: +91 172 2690585
Tel: +91 172 2636680, ext. 3301
E-mail:
(Received 14 February 2009, revised 2 April
2009, accepted 14 April 2009)
doi:10.1111/j.1742-4658.2009.07059.x
The degree of conservation of three-dimensional folds in protein superfami-
lies is greater than that of amino acid sequences. Therefore, very different
groups of residues (and schemes of residue packing) can be found displayed
upon similar structural scaffolds. We have previously demonstrated the
workability of a protein engineering-based method for rational mixing of the
interior features of an all-beta enzyme with the substrate-binding and
catalytic (surface) features of another enzyme whose sequence is not similar
but which is structurally homologous to the first enzyme. Here, we extend

this method to whole-protein surfaces and interiors. We show how two all-
beta Greek key proteins, bB2 crystallin and cB crystallin, can be recombined
to produce a new protein through rational transplantation of the entire sur-
face of bB2 crystallin upon the structure of cB crystallin, without altering
the latter’s interior. This new protein, Gambeta, consists of 61 residues pos-
sessing the same identity at structurally equivalent positions in bB2- and cB
crystallin, 91 surface residues unique to bB2 crystallin, and 27 interior
residues unique to cB crystallin. Gambeta displays a mixture of the struc-
tural ⁄ biochemical characteristics, surface features and colligative properties
of its progenitor crystallins. It also displays optical properties common to
both progenitor crystallins (i.e. retention of transparency at high concentra-
tions, as well as high refractivity). The folding of a protein with such a
‘patchwork’ residue ancestry suggests that interior ⁄ surface transplants
involving all-beta proteins are a feasible engineering strategy.
Abbreviation
Gdm.HCl, guanidinium hydrochloride
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3341
Briefly, in our approach, candidate proteins that can
be subjected to surface grafting are required to fulfil
two structural criteria: firstly, the donor and recipient
proteins must have polypeptide backbones that can be
structurally superimposed (to within an RMSD
£ 2.0 A
˚
); secondly, the surface areas subjected to graft-
ing must predominantly be b sheet-based structures,
and associated loop structures, with very little or no
helical content. The reason for the latter criterion is
that, within any strand participating in a multi-
stranded sheet on a protein’s surface, alternating resi-

dues face away from the sheet in opposite directions.
The sheet itself (described by the strand backbones
and hydrogen bonds) thus acts like a separator that
physically separates two distinct groups of mutually
interacting residues that have already evolved to pack
independently of each other – one facing the solvent,
and the other facing the protein’s interior. It is our
contention that when the backbone atoms of two
structurally homologous all-beta proteins are superim-
posable (despite poor sequence homology), the two
proteins appear to have somehow evolved very differ-
ent residue–residue packing schemes for ‘surface’ and
‘interior’ residues within the b sheet(s) under consider-
ation, compatible with the same set of backbone atom
coordinates. This compatibility automatically generates
scope for the success of mutation-based replacement of
one entire set of residues with a completely different
set of analogous residues from a structurally homolo-
gous protein. This is what we call grafting.
It is necessary to note that, although the compatibil-
ity of the ‘original’ and ‘replacement’ sets of residues
with the same set of backbone atom coordinates defi-
nitely presages, or even predicts, success in grafting, it
does not automatically guarantee success because of
uncertainties involved with respect to the mechanisms
of chain folding. A b sheet can bring together strands
that are widely separated in the primary sequence.
Therefore, residues constituting the solvent-exposed
surface of a b sheet are generally non-contiguous and
are sourced from all over the protein’s sequence.

Large-scale mutagenic replacements of surface residues
can conceivably affect the mechanisms by which chains
achieve their folded three-dimensional (native) struc-
tures; indeed, as is widely appreciated, sometimes even
a single mutation can drastically affect folding, unless
compensating mutations occur elsewhere in the pro-
tein, and there is no gainsaying that sufficient numbers
of mutually compensating mutations would be made in
a surface grafting experiment involving tens or hun-
dreds of residues undergoing replacement. Therefore,
theoretical verification of packing compatibility does
not prove that folding will lead to the desired
structure(s). It is necessary to perform the experiment,
and see whether this indeed occurs.
Our grafting approach – successfully demonstrated
here using the whole surfaces of two structurally
homologous proteins – involves the performance of five
systematic steps that combine structural (bioinformat-
ics) analyses with genetic engineering and protein bio-
chemistry: (a) superimposition of the polypeptide
backbones of any two significantly structurally homolo-
gous all-beta proteins; (b) identification of all pairs of
residues located at structurally analogous positions in
the two proteins; (c) segregation of such pairs of resi-
dues into separate sets, i.e. those contributing atoms to
the surface, and those contributing to the hydrophobic
interior; (d) site-directed replacement of residues consti-
tuting the surface of one protein by analogous residues
occurring in the other protein; and (e) expression,
purification and characterization of the mutant.

For our ‘whole-surface’ grafting experiment, we
selected two b sheet-rich proteins sharing extensive
structural homology: the vertebrate bovine lens struc-
tural proteins bB2 crystallin [2] and cB crystallin [3].
The proteins are of different lengths: cB crystallin is 174
residues long, while bB2 crystallin is 201 residues long
in its full-length form, but only approximately 175 or
177 residues long in its truncated form, depending on
exactly how its N- and C-terminal extensions have been
removed, or truncated. In comparing the amino acid
sequence of cB crystallin with that of the equivalent
(truncated) form of bB2 crystallin consisting of only the
core domain structures without the terminal extensions,
61 residues with the same identity (approximately 35%)
are used at structurally equivalent positions in the two
proteins, while another 22 residues of similar nature
(approximately 12%) are used at other structurally
equivalent positions, bringing the total homology to
47%. Thus, over half the residues used by the two pro-
teins at structurally equivalent positions are different
with respect to both their identity and their nature.
Both bB2 (Protein Data Bank accession 2BB2) [2]
and cB (Protein Data Bank accession 1AMM) [3] con-
sist of two double Greek key domains. Each of these
domains, approximately 80–85 residues long, consists
of two interacting Greek key motifs, each approxi-
mately 40 amino acids long. As already mentioned,
bB2 has N- and C-terminal sequences that extend
beyond the core two-domain motif. The inter-domain
linkers joining the N- and C-terminal domains in the

two proteins are very different from each other in
structure, as well as sequence, with the linker in cB
being bent into a V-shape that allows the two domains
to interact intramolecularly (such that the protein is a
monomer), while the linker in bB2 is extended (causing
Creation of a new protein through ‘surface grafting’ D. Kapoor et al.
3342 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS
the protein to form a homodimer in which the N- and
C-terminal domains of two different chains interact
like the two domains of cB).
Both proteins belong to a superfamily of proteins
displaying limited sequence homology but high struc-
tural homology [4]. Here, we show that a ‘recombined’
amino acid sequence created through residue altera-
tions in cB crystallin, involving (a) substitution of
some residues with analogous residues from bB2 crys-
tallin, (b) insertion of certain bB2 residues with no
analogs in cB, and (c) deletions of other cB residues,
leads to formation of a soluble protein that displays
many of the structural stability characteristics of cB
crystallin and most of the surface characteristics of
bB2 crystallin. In addition, this new protein, which we
call Gambeta, displays certain characteristics that are
not seen in either of its progenitors. Our results also
shed some light on the evolution of monomeric versus
multimeric structural arrangements in the bc crystallin
superfamily.
Results and discussion
Using the cB crystallin sequence as a template, many
substitution mutations were first made in silico to

replace the surface residues of cB crystallin with struc-
turally analogous bB2 residues. Certain bB2 surface res-
idues, including those constituting the solvent-exposed
inter-domain linker, have no counterparts in cB; conse-
quently, these were inserted into the cB sequence. Fur-
ther, certain cB surface residues were deleted, as these
have no structurally analogous residues in bB2. Details
of the above changes are given in Table S1. A new syn-
thetic gene incorporating all the above changes was
expressed in Escherichia coli. The amino acid sequence
of the protein product of this gene, named ‘Gambeta’,
is defined in column 9 of Table S1, and also shown in
the top part of Fig. 1, which displays the amino acid
sequence of Gambeta in a structure-based sequence
alignment with the amino acid sequences of its progeni-
tor crystallins, cB and bB2. Figure 1 also provides
Fig. 1. The surface ⁄ interior transplant. (Top) The green font represents residues that are not present in the progenitors, Structure-based
sequence alignment showing N- and C-terminally truncated bB2 crystallin (Protein Data Bank accession 2BB2) in blue, cB crystallin (Protein Data
Bank accession 1AMM) in red ⁄ orange, and Gambeta crystallin in a combination of blue (for b B2-derived residues) and red ⁄ orange (for
cB-derived residues). The inter-domain linker region separating the two double Greek key domains is marked. Residues presenting side chains
to the aqueous solvent are highlighted by green shading of structurally equivalent positions in all three sequences. Of the surface regions sub-
jected to transplantation, those involving contiguous residues are mainly from loops separating b strands, while single surface residues flanked
by core ⁄ interior residues are from strands. (Bottom) Schematic diagram showing the relationship of Gambeta to its two progenitors. The surface
is shown in green for all three proteins, and the notional boundary separating the surface from other regions is shown in white. Residues of bB2
are shown in blue, while those of cB are shown in red ⁄ orange. In Gambeta, colors denote the origins of the residues from the two progenitors.
D. Kapoor et al. Creation of a new protein through ‘surface grafting’
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3343
details about which residues occur upon the surfaces of
bB2 and cB. Furthermore, the bottom part of Fig. 1
shows a schematic representation of the transplanta-

tion. This part of the figure emphasizes the conceptual
point that our construction of a new protein, using a
synthetic gene encoding surface residues carefully
selected from bB2, and interior residues sourced from
cB, may be viewed as a ‘surface transplantation’ experi-
ment or an ‘interior transplantation’ experiment,
depending on one’s perspective.
Expression of Gambeta and
confirmation of its identity
Gambeta was overexpressed from a synthetic gene
cloned between the NdeI and XhoI restriction sites of
the expression vector pET-23a, with a C-terminal 6xHis
affinity tag, in E. coli strain BL21-DE3pLysS. The
DNA sequence and sequencing chromatograms of the
synthetic gene are shown in Fig. S1A,B. Figure S2A
shows the overexpression levels of several Gambeta-
expressing clones, showing similar yields of 100–
110 mgÆL
)1
of culture. After confirmation of the
sequence of the encoding gene by DNA sequencing, we
selected the clone shown in lane 2 of Fig. S2A for pro-
tein production. Gambeta was expressed and purified
by Ni-nitrilotriacetic acid immobilised metal affinity
chromatography (IMAC) chromatography under non-
denaturing conditions. Figure S2B shows a representa-
tive purification profile of Gambeta from a 1 L culture,
involving elution of bound protein by 250 mm imidaz-
ole, which was later removed by dialysis against 20 mm
Tris pH 8.0. Figure S2C shows that the purified protein

has an intact mass of 21 746 Da, which is only 148 Da
less than the mass of 21 894 Da expected for the 188
amino acid residue Gambeta chain; this error is well
within the permitted range of errors for mass measure-
ments using MALDI-TOF mass spectrometry in the
linear mode. The identity of the protein was further
confirmed by MALDI-TOF-based peptide mass finger-
printing, with 1–2 Da accuracy, involving detection of
the masses of trypsinolytic peptides in the mass range of
500–5000 Da. Peptides detected by peptide mass finger-
printing provided a very high coverage (83%) of the
sequence of the C-terminally 6xHis-tagged form of
Gambeta, as shown in Fig. S2D, confirming that the
protein produced and purified was indeed Gambeta.
Gambeta is a dimer like bB2
It is known that cB crystallin is a monomer whereas
bB2 crystallin is a homodimer [5]. To determine the
quaternary structural characteristics of Gambeta, the
protein was subjected to gel filtration chromatography
on an analytical Superdex-200 SMART column as
shown in Fig. 2A (the column’s calibration profile is
shown in Fig. S3). For comparison, control samples of
bB2 and cB crystallin were also chromatographed
under identical experimental conditions. Gambeta was
found to elute predominantly at approximately
1.66 mL from this column of 2.4 mL bed volume, with
a minor fraction of the population also seen to elute
as a soluble aggregate at the void volume (0.9 mL).
The elution of Gambeta at 1.66 mL indicates that it is
a dimer, with a hydrodynamic volume similar to that

of the bB2 control, which elutes at approximately
1.70 mL. The bB2 control and Gambeta were pro-
duced in the truncated form, without the N- and
C-terminal extensions that normally exist in bB2. Oth-
ers who have similarly produced bB2 without exten-
sions have also observed that bB2 exists in a
predominantly dimeric state; however, reports suggest
that there is usually an accompanying minority popu-
lation of tetrameric bB2 present with the dimeric pop-
ulation [4,5]. We did not find any evidence of a
minority tetrameric population, either with the bB2
control or with Gambeta. This could be due to the fact
that the C-terminal affinity tag used to produce Gamb-
eta and its progenitor controls acts like bB2’s natural
C-terminal extension, sterically inhibiting further asso-
ciations once a dimeric state has formed. In this
context, it is important to note that previous studies
with truncated bB2 used no affinity tags, but instead
used naturally occurring histidines in bB2’s sequence
for metal affinity-based purification. In any case, the
important point to note is that the control cB crystal-
lin protein elutes at 1.85 mL, as a monomer, despite
being identical to bB2 and Gambeta with respect to its
C-terminal affinity tag, indicating that Gambeta’s
dimerization is due to its possessing the inter-domain
linker peptide and surface features of bB2 crystallin.
Gambeta’s structural
⁄
biochemical
characteristics are derived partly from

bB2 and partly from cB
Figure 2B shows that the CD spectrum of Gambeta
has a typical negative band maximum at 216–218 nm,
with a mean residue ellipticity of about )9000 degressÆ
cm
2
Ædmol
)1
. The shape of Gambeta’s spectrum resem-
bles that of the spectra of bB2 and cB, which are also
shown in Fig. 2B. While this indicates that Gambeta is
a folded all-beta protein like both of its progenitors,
Gambeta also appears to have a higher b sheet content
than both bB2 and cB, suggesting that it is somewhat
more folded than its progenitors. Figure 2C,D shows
Creation of a new protein through ‘surface grafting’ D. Kapoor et al.
3344 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS
the guanidinium hydrochloride (Gdm.HCl)-induced
and urea-induced denaturation transition curves for
Gambeta, bB2 and cB, as plots of changes in the mean
residue ellipticity at 216 nm with increasing concentra-
tions of denaturant. For Gambeta, data are omitted
for concentrations between 0.3 and 1.75 m Gdm.HCl,
because the protein showed precipitation at these dena-
turant concentrations (this behavior is discussed
below). Neither of the control progenitor proteins
showed this behavior. Although different initial mean
residue ellipticities are involved in all three cases, it is
clear from these transitions that Gambeta’s unfolding
closely parallels that of bB2, rather than that of cB

crystallin. Although c B shows great resistance to urea-
mediated unfolding (as reported previously [7]), at least
over the time scale of an overnight incubation (approx-
imately 12 h), both Gambeta and bB2 showed some
unfolding in urea, with similar profiles of partial
unfolding.
The wavelengths of maximal fluorescence emission
(
em
k
max
) and the emission intensities of tryptophan
residues tend to be acutely sensitive to the polarity of
their environment within a protein. The
em
k
max
of a
solvent-exposed tryptophan is usually approximately
352–353 nm, while that of a buried tryptophan tends
to be blue-shifted to a lower wavelength, to a degree
that is dependent on the extent of burial [6]. There are
four tryptophan residues in cB, all of which lie buried
within its structural core [3]. In contrast, only three of
these tryptophans are conserved at structurally equiva-
lent positions in bB2, and there are two additional
tryptophans on its surface [2]. As the core of Gambeta
is derived from cB and its surface is derived from bB2,
it inherits all four of the cB tryptophans together with
both of the bB2 surface tryptophans, making six

tryptophans in all. Figure 3A shows the fluorescence
emission spectra of all three proteins, obtained at
matched concentrations. Although Gambeta, bB2 and
AB
C
D
Fig. 2. Quaternary and secondary structure ⁄ stability of purified Gambeta and its progenitors. (A) Gel filtration elution profiles on an analytical
Superdex-200 SMART column. (B) Far-UV CD spectra. (C) Changes in mean residue ellipticity at 216 nm following overnight incubation in
various molarities of Gdm.HCl. (D) Changes in mean residue ellipticity at 216 nm following overnight incubation in various molarities of urea.
D. Kapoor et al. Creation of a new protein through ‘surface grafting’
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3345
cB have six, five and four tryptophans, respectively,
cB shows the most intense emission, followed by
Gambeta and bB2, in that order. This indicates that
the tryptophans of Gambeta and bB2 are quenched by
their local structural environments compared with
the cB tryptophans. The
em
k
max
of bB2 is between the
em
k
max
values of Gambeta and cB, and the shape of its
fluorescence emission envelope is quite distinct from
those of Gambeta and cB. All three proteins display
em
k
max

values below 335 nm (Gambeta at appro-
ximately 335 nm, bB2 at approximately 331 nm, and
cB at approximately 325 nm), indicating that Gambeta
has an extremely well-folded structure in which the six
aromatic tryptophan residues are protected from
the aqueous solvent as effectively as those in bB2 and
cB.
That the aromatic residues of all three proteins exist
in largely immobile environments, in association with
chiral structural elements, is also evident from the fact
that they display near-UV CD spectra that show
marked spectral features (Fig. 3B). Although near-UV
CD spectra are merely spectral signatures that cannot
be interpreted further, it is noteworthy that the spec-
trum of Gambeta resembles that of bB2 much more
than it resembles that of cB, at least in terms of inten-
sity. The same spectral features are seen in all three
proteins, indicating that Gambeta has folded into a
structure that is similar to that of its progenitors. The
reason that Gambeta’s spectrum is more like that of
bB2 could be that Gambeta derives five of its six
tryptophans from bB2 (including three that are buried
at equivalent structural positions in bB2 and cB, and
two that exist only in bB2), with only one tryptophan
sourced solely from cB.
We further examined the denaturant-induced
unfolding transitions of Gambeta and its progenitor
controls by monitoring changes in fluorescence emis-
sion and plotting variations in both emission intensity
and

em
k
max
values with denaturant concentration. We
noted above that precipitation of Gambeta between
0.3 and 1.75 m Gdm.HCl interferes with CD-based
monitoring of unfolding. Such precipitation does not
interfere with fluorescence-based monitoring of
em
k
max
values during unfolding (which are independent of
protein concentration), but can affect emission intensi-
ties. This is because precipitation can affect protein
concentrations and therefore intensities, whereas fluo-
rescence emission wavelength maxima are not sensitive
to scattering of light if the
em
k
max
is sufficiently dis-
placed from the wavelength of excitation (in nm), as
this prevents the Rayleigh and Raman scatter from
contaminating the emission spectrum. The data for
the Gdm.HCl- and urea-induced transitions are shown
in Fig. 4A,B, which show actual protein emission
intensities at 370 nm as a function of denaturant
concentrations. At 370 nm, shifting of the protein’s
emission spectrum towards longer wavelengths
(accompanying exposure of buried tryptophan resi-

dues) causes emission intensities to rise progressively
with unfolding. All three proteins show changes in
emission intensity at 370 nm with increasing denatur-
ant concentration, although, as already mentioned,
urea does not cause unfolding of cB. The unfolding
of Gambeta by Gdm.HCl appears to be considerably
less cooperative than that of its progenitors, whereas,
with urea, unfolding of both Gambeta and bB2
appears not to be very cooperative. In Fig. 4A, no
intensity data for Gambeta at 370 nm are presented
for Gdm.HCl concentrations between 0.3 and 1.75 m;
this is because of the precipitation of Gambeta seen
at these concentrations of Gdm.HCl, which is reversed
at higher concentrations of the denaturant.
A
B
Fig. 3. Tertiary structural features of purified Gambeta and its two
progenitors. (A) Fluorescence emission spectra. (B) Near-UV CD
spectra.
Creation of a new protein through ‘surface grafting’ D. Kapoor et al.
3346 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS
The data showing the changes in
em
k
max
with the
two denaturants are shown in Fig. S4A,B. As for the
changes in emission intensities, the unfolding transition
of Gambeta is far less cooperative than the unfolding
transitions of bB2 and cB, both of which show more

or less cooperative unfolding transitions. The concen-
tration at which half the population is unfolded (C
m
)
of Gdm.HCl is far lower for Gambeta than for cB,
but considerably higher than the C
m
of unfolding of
bB2. With urea, Gambeta unfolded entirely non-
cooperatively over the entire range of urea concentra-
tions used. Thus, although Gambeta unfolds to the
same extent that bB2 unfolds (i.e. fully), bB2’s unfold-
ing was completed in a sharp cooperative transition
between 1.0 and 2.5 m urea, whereas Gambeta’s
unfolding occurs slowly and in a monotonic fashion
between 0 and 7.0 m urea. Gambeta appears to have
derived its relative resistance to unfolding by urea
from cB, which shows hardly any unfolding even upon
overnight incubation in 7.0 m urea.
We also monitored the unfolding transition by
examining changes in the ratio of emission intensities
at 320 and 370 nm with denaturant concentration, to
see whether there is any inhomogeneity of behaviour
with respect to the relative exposure of tryptophans in
various parts of Gambeta and its control progenitors
during denaturant-mediated unfolding. The data are
presented in Fig. S4C,D. Gambeta’s unfolding is
clearly seen to be biphasic in the presence of Gdm.HCl
or urea. Although the same is not seen clearly in the
Gdm.HCl-induced denaturation profiles of the two

progenitors, the intensity ratio data in Fig. S4C
indicate that cB shows very subtle unfolding. Such
unfolding involves two phases spanning the same range
of concentrations over which Gambeta shows this
behavior in the urea-induced denaturation data in
Fig. S4D. It is possible that the two phases of
Gambeta unfolding seen in Fig. S4C,D relate to
independent unfolding of the two domains, which
could be related to the fact that the protein shows
non-cooperativity of unfolding.
To explore the reversibility of the unfolding transi-
tions, far-UV CD spectra of all three proteins were
obtained after removal of 6 m Gdm.HCl or 7 m urea
by dialysis. The data are presented in Figs S5 and S6,
together with spectra of protein unexposed to denatur-
ant. The data show that both Gambeta and bB2 dis-
play poor refolding, through dialysis, from the
completely unfolded state achieved through overnight
incubation in 7 m urea, while cB remains unaffected
by the treatment. In contrast, all three proteins refold
poorly from the completely unfolded states achieved
through overnight incubation in 6 m Gdm.HCl.
In summary, the far-UV CD transitions in
Fig. 2C,D as well as the
em
k
max
value and intensity
ratio transitions indicate that Gambeta is unfolded
non-cooperatively by urea. It is interesting that all six

tryptophans of Gambeta become exposed to the aque-
ous solvent even though the secondary structure of
Gambeta does not fully unravel in the presence of
these denaturants.
Binding of Gambeta to the
calcium-mimic dye Stains-all is
intermediate to that of bB2 and cB
Figure 5A shows CD spectra induced in the otherwise
achiral (and therefore non-dichroic) dye Stains-all in
the presence of Gambeta, bB2 and cB crystallin. The
dye Stains-all binding simulates calcium-binding in a
A
B
Fig. 4. Chemical denaturation of Gambeta and its two progenitors.
(A) Fluorescence emission intensities at 370 nm as a function of
Gdm.HCl concentration. (B) Fluorescence emission intensities at
370 nm as a function of urea concentration.
D. Kapoor et al. Creation of a new protein through ‘surface grafting’
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3347
protein, and both bB2 and cB crystallin are reported
to bind to this dye [8,9]. Figure 5A shows that, for
equivalent concentrations of protein and Stains-all, the
strength of the approximately 650 nm negative band
(known as the J band) induced in Stains-all by its
binding to Gambeta is intermediate to that of bB2 and
cB crystallins. As with the other crystallins, Gambeta
also shows a positive band in the region of 670–
700 nm at higher concentrations of dye to protein
(Fig. S7); the control spectrum with the dye alone is
close enough to the zero line to be indistinguishable.

Although, in our experiment, all three proteins show
the J band at approximately 650 nm, the reported
wavelength for Stains-all bound to full-length bB2 is
closer to 660 nm [8,9]. As our spectra in Fig. 5A are
the first spectra ever reported for Stains-all binding to
truncated bB2, the three spectra shown must be com-
pared only with each other and not with other reports
in the literature.
Gambeta precipitates upon heating like
cB does
There have been no reports that bovine bB2 crystallin
precipitates upon heating. In contrast, cB is reported to
precipitate upon heating, and the nature of its thermal
aggregates has also been studied [10]. It is known that
there is a partial melting of structure that leads to
aggregation in the temperature range 65–80 °C, with
actual structural unfolding (as discerned by differential
scanning calorimetry) occurring largely above 85 °C,
when aggregation is prevented from occurring [7].
Figure 5B shows the responses of Gambeta and its con-
trol progenitor proteins to heating. The behavior of
Gambeta is entirely like that of cB, in that there is a
dramatic change in mean residue ellipticity at 216 nm
upon heating, which leads to the mean residue elliptic-
ity quickly being reduced to zero because the protein
precipitates and disappears from the light path.
A
B
CD
Fig. 5. Further characterization of Gambeta and its progenitors. (A) CD spectra of the 650 nm J band induced in the calcium-mimic dye,

Stains-all upon protein binding. (B) Temperature-induced changes in mean residue ellipticity at 216 nm (owing to thermal unfolding, aggrega-
tion or precipitation). (C) Changes in refractive index (n
D
) with increasing protein concentration. (D) Scattering (turbidity) shown by a
0.1 mgÆmL
)1
Gambeta solution at 600 nm as a function of increasing Gdm.HCl concentration.
Creation of a new protein through ‘surface grafting’ D. Kapoor et al.
3348 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS
However, although the thermal precipitation is like that
of cB, the temperature at which the thermal precipita-
tion occurs is actually much closer to the temperature
at which bB2 (which is quite thermostable) displays a
very minor partial unfolding transition, without either
undergoing complete thermal unfolding or thermal pre-
cipitation. When the respective cuvettes were removed
from the Peltier-controlled chamber of the CD spec-
trometer after heating and cooling, all the protein was
found to have formed visible aggregates in the case of
Gambeta and the cB control, but no precipitates what-
soever were visible in the case of the bB2 control.
Gambeta shows cold precipitation like
its progenitors
Cold precipitation is defined as a tendency to precipi-
tate out of solution at low temperatures in a concen-
tration-dependent fashion. Cold precipitation is one of
the most defining characteristics of cB crystallin. In a
concentration-dependent manner, with greater precipi-
tation seen at higher protein concentrations, cB precip-
itates visibly out of aqueous solution upon cooling to

temperatures below 10 °C [11,12]. What is especially
interesting about this cold precipitation is that it is
fully reversible, i.e. the solution clears when the tem-
perature is returned room temperature, with no appar-
ent change in the protein’s characteristics, suggesting
that no profound structural change is involved in the
phenomenon. In contrast to this behavior of cB (and
all other c isoforms, which show reversible cold
precipitation), mouse cN crystallin has been reported
to show irreversible cold precipitation [13]. No other
crystallin, including full-length bB2 crystallin, has been
reported to show such precipitation.
Gambeta was found to readily precipitate out of
solution in the refrigerator, in a concentration-depen-
dent manner, over a period of hours, for all concentra-
tions exceeding 10–12 mgÆmL
)1
. However, unlike the
reversible cold precipitation shown by cB crystallin,
the cold precipitation of Gambeta was found to be
irreversible, in that no re-dissolution of the protein
could be detected upon return to room temperature.
Interestingly, whereas full-length bB2 has never been
reported to show cold precipitation, our truncated bB2
control showed cold precipitation at these concentra-
tions just like the cB control and Gambeta samples.
Interestingly, the cold precipitation of N- and C-termi-
nally truncated bB2 was also found to be irreversible,
like that of Gambeta, explaining where this irrevers-
ibility comes from. It is possible that others who have

worked with truncated bB2 have not made this obser-
vation previously because they have not used protein
concentrations high enough for the phenomenon to
manifest itself; even cB and the other c crystallins are
known to show cold precipitation only at concentra-
tions exceeding 10–15 mgÆmL
)1
[11,12]. It is possible
that the N- and C-terminal extensions of full-length
bB2 (which protect it from associating beyond the
dimeric state) somehow also protect it from cold pre-
cipitation, and that we have removed this protection
by truncating Gambeta and bB2. It may be recalled
that we truncated these two proteins in order to allow
proper comparison with cB, as cB lacks these terminal
extensions.
Gambeta is soluble at ultra-high
concentrations like other lens crystallins
The crystallins are special proteins, in that they exist in
the fiber cells of the vertebrate ocular lens at concentra-
tions in excess of 100 mgÆmL
)1
; in the center of a lens,
crystallin concentrations can even reach 500–
600 mgÆmL
)1
[14]. The crystallins in the lens remain
soluble at such high concentrations, and form clear
solutions of high refractive index that help the lens to
focus light onto the retina [15]. There is a natural gradi-

ent of crystallin concentrations in the lens, increasing
from the periphery to the center. This is associated with
a corresponding gradient of refractive index that helps
the lens to correct for spherical aberration by bending
light to lesser and lesser extents as the periphery is
approached, to compensate for shape changes.
As Gambeta is derived from two progenitor crystal-
lins, we examined whether it is soluble at high concen-
trations, and also whether it generates highly refractive
solutions. We were able to concentrate Gambeta to
approximately 280 mgÆmL
)1
, with no evidence of pre-
cipitation or aggregation. Figure 5C shows the mea-
sured change in the refractive index for yellow light
(n
D
) against Gambeta concentration, together with
similar plots for the control bB2 and cB crystallins,
over the concentration range of 0–50 mgÆmL
)1
. The
plot shows that Gambeta possesses the most important
properties of any crystallin, i.e. high solubility and the
ability to form clear and transparent solutions of high
refractive index. Furthermore, the slope of the increase
in refractive index with protein concentration was
highest for cB crystallin, followed by Gambeta and
bB2 crystallin.
Gambeta precipitates at intermediate

concentrations of Gdm.HCl
As noted above, far-UV CD data for Gambeta could
not be collected between 0.3 and 1.75 m Gdm.HCl,
D. Kapoor et al. Creation of a new protein through ‘surface grafting’
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3349
because Gambeta shows a tendency to precipitate. This
precipitation frustrates any attempts to examine
whether or not the homodimeric form of Gambeta can
be dissociated into folded monomers by low concentra-
tions of the denaturant. The precipitation is visible
within a few tens of minutes after addition of the
Gdm.HCl. We wished to examine whether this
precipitation is an equilibrium phenomenon, showing a
specific concentration-dependent trend, or a non-
equilibrium phenomenon like most forms of protein
aggregation. We wish to point out what is a prima facie
reason to believe that this may be an equilibrium
phenomenon. In the CD data presented in Fig. 2C, the
data points prior to 0.3 m Gdm.HCl and after 1.75 m
Gdm.HCl show continuity; it may be argued that this
would not have been the case if the precipitation were a
non-equilibrium phenomenon. However, we wished to
examine this further by monitoring the extent of
precipitation in various concentrations of Gdm.HCl.
Overnight incubation would allow sufficient time for a
non-equilibrium phenomenon to precipitate most or all
of the protein over the entire relevant range of
Gdm.HCl concentrations, creating discontinuity in the
data.
To explore this further, we measured and plotted

the turbidity (A
600
) of solutions of 0.1 mgÆmL
)1
Gambeta incubated overnight in the presence of
various concentrations of Gdm.HCl, as shown in
Fig. 5D. The data reveal a Gaussian distribution of
turbidity with increasing Gdm.HCl concentration, with
a peak at approximately 1 m Gdm.HCl and no discon-
tinuity, indicating that phenomenon is an equilibrium
one. A search of the biochemical literature showed
that another protein, rusticyanin, also shows similar
precipitation behavior in the presence of a certain
range of concentrations of Gdm.HCl [16]. We have
not yet characterized these precipitates further, but we
describe this precipitation behavior to emphasize that
this is one aspect of Gambeta that is not directly
attributable to either of its progenitors.
Experimental procedures
Design of Gambeta
As the geometries of the arrangement of domains are
different in the two proteins, the N-terminal domains of bB2
and cB crystallin were superimposed separately from the
C-terminal domains of the two proteins using LSQMAN
software [17]. This showed that the backbone atoms of the
N-terminal domains can be superimposed with an RMSD of
0.9 A
˚
, while those of the C-terminal domains can be
superimposed with an RMSD of 1.05 A

˚
. The residues at
structurally analogous positions in the two proteins identi-
fied by LSQMAN are listed in columns 2 and 3 of Table S1.
For the two domains, backbone atoms of a total of 150
residues can be seen to be superimposed with individual
RMSD values £ 2.00 A
˚
, while eight more residues superim-
pose with individual RMSD values of 2.00–3.00 A
˚
. Details
of structurally analogous residues are given in column 4 of
Table S1, with RMSD values in column 5. We used a combi-
nation of visual and software analysis by AreaImol, as
implemented in CCP4 [18], to assess the solvent accessibility
of each residue, to identify residues contributing atoms to
the formation of the surface in each protein. Details of
specific residue pairs contributing to surface formation are
given in column 6 of Table S1. Of these surface residues,
some are conserved and so there was no need to alter these
during surface grafting. Details of conserved residues are
given in column 7 of Table S1. Column 8 in Table S1 list the
action taken, i.e. whether the residue in cB was (a) mutated
and replaced with the structurally analogous residue occur-
ring in bB2, (b) left unaltered, or (c) deleted, or (d) whether
a specific residue from bB2 had to be inserted to create a
bB2-derived surface in Gambeta, while conserving the
hydrophobic core of cB. Mutations were inserted in silico
into a gene encoding the sequence of c crystallin, and the

sequence of this gene was optimized for expression in E. coli
using gene designer dna 2.0 software. This approach
differs considerably from another very interesting approach
that also uses cB crystallin’s structural scaffold to generate
libraries of crystallins with novel binding properties [19], as
our approach is rational while the library approach is
combinatorial, and our approach also results in a folded
structure despite making a much larger number of changes.
Gene synthesis and cloning
A gene with a sequence designed as described above (shown
in Fig. S1) was produced through contract synthesis by
Ocimum Biosolutions (Hyderabad, India) in a pUC-19
( plasmid.
The gene was amplified from this plasmid by PCR using for-
ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT
CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT-
TATACTATCCTCGAGCCACTGCATATCACGGATAC
GACGC-3¢. The forward primer incorporated an NdeI site
and the reverse primer incorporated an XhoI site (both
underlined) to allow digestion and cloning of this amplicon
between the NdeI and XhoI sites of the expression vector
pET-23a, enabling expression with an N-terminal methionine
and a C-terminal extension incorporating 6xHis residues and
two other residues (Leu and Glu) from the XhoI site placed
immediately upstream of the stop codon. The pET-23a
plasmid incorporating the clone was transformed into the
XL1-Blue strain for making of plasmid stocks and sequenc-
ing, and into the BL21(DE3)pLysS strain for expression.
Creation of a new protein through ‘surface grafting’ D. Kapoor et al.
3350 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS

Production of C-terminally affinity-tagged cB and
truncated bB2 controls
Clones of bovine cB cDNA in pET-17b and bovine bB2
cDNA in pET-21a were kindly provided by Dr Yogendra
Sharma [Centre for Cellular and Molecular Biology
(CCMB), Hyderabad, India], and these were modified as
described below to produce affinity-tagged cB and bB2
clones of lengths equivalent to each other and to Gambeta.
We amplified the cDNA for cB using forward primer
5¢-ACTTATACTACT
CATATGGGGAAGATCACTTTTT
ACG-3¢ and reverse primer 5¢-ACTTATACTATC
CTCG
AGATAAAAATCCATCACCCG-3¢, and digested this with
restriction enzymes NdeI and XhoI for subcloning into pET-
23a and production in BL21DE3pLysS. The product has a
methionine at the N-terminus, derived from the NdeI restric-
tion site. It also has a C-terminal 6xHis tag with the
sequence LEHHHHHH derived from the vector, with
the residues L and E deriving from the XhoI restriction site.
Likewise, we also amplified the cDNA for bB2 using for-
ward primer 5¢-ACTTATACTACTCATATGCTCAACCC
CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC
TATC
CTCGAGCCACTGCATGTCCCGG-3¢, to produce
an amplicon lacking the N- and C-terminal extensions of the
full-length protein but including restriction sites for NdeI
and XhoI. After digestion and insertion into pET-23a, this
amplicon retains nucleotides encoding the residues L and N
at the N-terminal end of the truncated bB2, and the residues

Q and W at the C-terminal end of truncated bB2, because
these four residues are present in the structure of full-length
bB2 , while the rest of the residues in the extensions give rise
to no detectable electron density in the crystal structure [3].
Although we have retained the C-terminal residues Q and W
from bB2 in the truncated bB2, as well as in Gambeta, we
did not incorporate the N-terminal residues L and N at
the N-terminus of Gambeta. This was because we made
Gambeta first, and omitted these two residues by an over-
sight; when we later made the bB2 control, we decided to
put these in also and see whether they make any significant
difference, with the intention of adding these to Gambeta
later if a great variation in behavior was seen between bB2
and Gambeta. However, as this was not the case, the Gamb-
eta variant incorporating L and N at the N-terminus was
not produced.
Protein expression and purification
Gambeta was expressed by growing transformed
BL21DE3pLysS cells in LB medium, using induction with
a final concentration of 1 mm isopropyl thio-b-d-galacto-
side at an absorbance of the culture at 600 nm of 0.6.
Cells were harvested after 4 h and lysed under non-dena-
turing conditions in 50 mm NaH
2
PO
4
containing 300 mm
NaCl and 10 mm imidazole, with sonication in the pres-
ence of lysozyme. The lysate was centrifuged at 12 000 g
for 1 h, and the supernatant was loaded onto an Ni-nitri-

lotriacetic acid column of 1.5 mL volume (Qiagen, Hilden,
Germany). The column was washed with two or three
bed volumes of buffer containing 50 mm imidazole.
Bound Gambeta was then eluted from the column using
10 mL of 250 mm imidazole. The first three 1.5 mL frac-
tions shown in the gel in Fig. 2B (> 98% purity) were
collected and pooled. The mean yield of Gambeta
exceeded 100 mg protein per litre of culture. Eluted pro-
tein was dialyzed against 20 mm Tris pH 8.0 to remove
the imidazole used for elution, and used directly for all
studies. The progenitors were purified by the same
method, with similar yields and purity.
Absorption spectroscopy and protein parameters
Concentrations of Gambeta in solution were estimated by
measurement of absorption at 280 nm on a Varian Cary
50 Bio UV-visible spectrophotometer (Varian, Palo Alto,
CA, USA), using a predicted molar extinction coefficient of
48 820 m
)1
Æcm
)1
(vector nti, Invitrogen, Carlsbad, CA,
USA) translating into an absorbance at 280 nm of 1.0 for a
concentration of 0.45 mgÆmL
)1
. This high absorbance is
due to the molecule’s six tryptophans. Gambeta was
designed to have 179 amino acids. However, the expressed
and purified polypeptide chain includes an extra residue
(methionine) at the N-terminus, and eight additional resi-

dues at the C-terminus (comprising six histidine residues
and two residues from the restriction site), such that the
total length of the protein studied was 188 amino acids.
The predicted molecular mass and isoelectric point of this
188-residue Gambeta protein are 21 893.73 Da and pI 6.58,
respectively. The molar extinction coefficients used for cB
and bB2 were 42 800 and 40 210 m
)1
Æcm
)1
, respectively.
The predicted molecular masses of cB and bB2 were
22 159.57 and 21 909.67 Da, respectively. The predicted
isoelectric points of cB and bB2 were 6.89 and 6.26,
respectively.
Intact protein mass spectrometry and tryptic
peptide mass fingerprinting
The identity of Gambeta was established by examination
of molecular mass using SDS–PAGE, as well as
MALDI-TOF-based mass spectrometry performed in the
linear mode using an Applied Biosystems Voyager DE-
STR mass spectrometer (Applied Biosystems, Foster City,
CA, USA), with sample ionization assisted by the matrix,
sinapinic acid. A different matrix, a-cyano-4-hydroxy
cinnamic acid (CHCA) was used for peptide mass finger-
printing of Gambeta on the same mass spectrometer,
using the instrument in the reflector mode with a suffi-
ciently high resolution offering sub-Dalton accuracy for
determination of the masses of tryptic peptides. A
total of 13 out of 20 expected tryptic peptides were

D. Kapoor et al. Creation of a new protein through ‘surface grafting’
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3351
detected, covering more than 80% of the sequence of
Gambeta. The diagnostic masses detected were all within
1 Da of the following expected masses: 3809.301,
2248.553, 2204.528, 1802.062, 1669.771, 1643.762,
1414.596, 1206.379, 1024.057, 841.876, 620.663 and
560.651 Da. Of these masses, only 3809.301 corresponds
to a missed trypsin cleavage (i.e. 334.434 + 3474.867
Da), whereas the remaining masses correspond to frag-
ments generated by complete digestion. The identities of
the control proteins were checked by simple determina-
tion of intact mass by mass spectrometry, and the masses
of both were found to be accurate within the permitted
range of error.
Circular dichroism spectroscopy and Stains-all
binding studies
Far-UV CD data were collected on a Jasco-810
spectropolarimeter (Jasco, Hachioji, Tokyo, Japan). The
concentrations of the protein samples used for far-UV
and near-UV CD studies were 0.1 and 1.0 mgÆmL
)1
,
respectively, using path lengths of 1 and 4 mm. Far-UV
CD spectra were scanned from 250 nm to approximately
195 nm at a rate of 50 nmÆmin
)1
, with averaging of three
scans in the absence or presence of CaCl
2

at various
concentrations. Near-UV spectra were scanned from 320
to 250 nm at a rate of 50 nmÆmin
)1
. To collect data at
high temperatures, the instrument’s Peltier-controlled
cuvette holder was used with 9 mm metal spacers for
heat transfer to 1 mm cuvettes. Contributions of the
buffer to the spectra were electronically subtracted, and
mean residual ellipticity was calculated and plotted
using the formula [h]=[h
obs
· 100 · mean residue
weight] ⁄ [concentration (mgÆmL
)1
) · path length (cm)]. For
measurement of the induced CD band (called the J band)
in the dye Stains-all (Sigma Chemical Co., St Louis, MO,
USA), upon its binding to Gambeta, a scan was
performed between 700 and 500 nm at a rate of 50 nmÆ
min
)1
, after Gambeta (0.08, 0.13 and 0.16 mgÆmL
)1
) had
been incubated for 1 h with Stains-all (16 lm)in
the presence of 2 mm Mops pH 7.2 and 30% ethylene
glycol.
Gel filtration chromatography
Gel filtration chromatography was performed on a

SMART chromatographic workstation (Pharmacia, GE
Healthcare Biosciences AB, Uppsala, Sweden), using an
analytical Superdex-200 column (Pharmacia) (bed volume
approximately 2.4 mL, void volume approximately 0.8 mL).
All Gambeta samples were 50 lL volume at a concentra-
tion of 0.1 mgÆmL
)1
. Column pre-equilibration was per-
formed using 20 mm Tris pH 8.0, and the elution was
performed using a flow rate of 0.1 mLÆmin
)1
.
Refractive index measurements
Measurements of refractive index (n
D
) were performed on a
Reichert ABBE Mark II digital refractometer (Reichert,
Depew, New York, NY, USA) using standard techniques.
Acknowledgements
D.K. thanks the Council of Scientific & Industrial
Research (New Delhi, India) for a doctoral research
fellowship. P.G. thanks the Council of Scientific &
Industrial Research, Indian National Science Academy
(INSA) and Department of Biotechnology, Govern-
ment of India (DBT) (New Delhi, India) for grants to
research protein folding, aggregation, stability and
engineering. We thank Dr Y. Sharma (CCMB, Hydera-
bad, India) for kindly providing us with clones of
bovine bB2 and cB cDNA for further modification
and use in our laboratory.

References
1 Kapoor D, Kumar V, Chandrayan SK, Ahmed S, Shar-
ma S, Datt M, Singh B, Karthikeyan S & Guptasarma
P (2008) Replacement of the active surface of a thermo-
phile protein by that of a homologous mesophile pro-
tein through structure-guided ‘protein surface grafting’.
Biochim Biophys Acta 1784, 1771–1776.
2 Bax B, Lapatto R, Nalini V, Driessen H, Lindlay PF,
Mahadevan D, Blundell TL & Slingsby C (1990) X-ray
analysis of bB2 crystallin and evolution of oligomeric
lens proteins. Nature 347, 776–780.
3 Wistow G, Turnell B, Summers L, Slingsby C, Moss D,
Miller L, Lindley P & Blundell T (1983) X-ray analysis
of the eye lens protein c-II crystallin at 1.9 A
˚
resolu-
tion. J Mol Biol 170, 175–202.
4 Trinkl S, Glockschuber R & Jaenicke R (1994) Dimer-
ization of bB2-crystallin: the role of the linker peptide
and the N- and C-terminal extensions. Protein Sci 3,
1392–1400.
5 Mayr EM, Jaenicke R & Glockshuber R (1994)
Domain interactions and connecting peptides in lens
crystallins. J Mol Biol 235, 84–88.
6 Schmid FX (1989) Spectral methods of characterizing
protein conformation and conformational changes. In
Protein Structure: A Practical Approach (Creighton TE,
ed.), pp.251–285. IRL Press, Oxford.
7 Mandal K, Chakrabarti B, Thomson J & Siezen RJ
(1987) Structure and stability of c-crystallins. J Biol

Chem 262, 8096–8102.
8 Jobby MK & Sharma Y (2007) Calcium-binding to lens
bB2- and bA3-crystallins suggests that all b-crystallins
are calcium-binding proteins. FEBS J 274, 4135–4147.
Creation of a new protein through ‘surface grafting’ D. Kapoor et al.
3352 FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS
9 Rajini B, Shridas P, Sundari CS, Muralidhar D,
Chandani S, Thomas F & Sharma Y (2001) Calcium
binding properties of c-crystallin. J Biol Chem 276,
38464–38471.
10 Kundu B, Shukla A & Guptasarma P (2003) Peptide
scanning-based identification of regions of c-II crystallin
involved in thermal aggregation: evidence of the
involvement of structurally-analogous helix-containing
loops from the two double Greek key domains of the
molecule. Arch Biochem Biophys 410, 69–75.
11 Siezen RJ, Fisch MR, Slingsby C & Benedek GB (1985)
Opacification of gamma-crystallin solutions from calf
lens in relation to cold cataract formation. Proc Natl
Acad Sci USA 82, 1701–1705.
12 Broide ML, Berland CR, Pande J, Ogun OO &
Benedek GB (1991) Binary-liquid phase separation of
lens protein solutions. Proc Natl Acad Sci USA 88,
5660–5664.
13 Wistow G, Wyatt K, David L, Gao C, Bateman O,
Bernstein S, Tomarev S, Segovia L, Slingsby C &
Vihtelic T (2005) cN-crystallin and the evolution of the
bc-crystallin superfamily in vertebrates. FEBS J 272,
2276–2291.
14 Harding JJ & Crabbe MJC (1984) The lens: develop-

ment, proteins, metabolism and cataract. In The Eye.
Vol. 1B, 3rd edn. (Davson H, ed.), pp. 207–492.
Academic Press, London.
15 Delaye M & Tardieu A (1983) Short-range order of
crystallin proteins accounts for eye lens transparency.
Nature 302, 415–417.
16 Alcaraz LA & Donaire A (2004) Unfolding process of
rusticyanin: evidence of protein aggregation. Eur J Bio-
chem 271, 4284–4292.
17 Kleywegt GJ (1996) Use of non-crystallographic sym-
metry in protein structure refinement. Acta Crystallogr
D Biol Crystallogr 52, 842–857.
18 Lee B & Richards FM (1971) The interpretation of pro-
tein structures: estimation of static accessibility. J Mol
Biol 55, 379–400.
19 Ebersbach H, Fiedler E, Scheuermann T, Fiedler M,
Stubbs MT, Reimann C, Proetzel G, Rudolph R &
Fiedler U (2007) Affilin-novel binding molecules based
on human gamma-B-crystallin, an all beta-sheet protein.
J Mol Biol 372, 172–185.
Supporting information
The following supplementary material is available:
Fig. S1. DNA sequence of the custom-synthesized gene
encoding Gambeta and DNA sequencing chromato-
gram of the Gambeta gene cloned into pET-23a.
Fig. S2. Expression, purification and confirmation of
Gambeta’s identity.
Fig. S3. Calibration profile for the Superdex-200
SMART column.
Fig. S4. Tertiary structural stability of purified Gambe-

ta and its two progenitors under chemical denatur-
ation.
Fig. S5. Far-UV CD spectra of the two progenitor
crystallins and Gambeta prior to exposure to
Gdm.HCl, and after refolding.
Fig. S6. Far-UV CD spectra of the two progenitor
crystallins and Gambeta prior to exposure to urea,
and after refolding.
Fig. S7. CD spectra of the 650 nm J band induced in
the calcium-mimic dye Stains-all upon binding to
Gambeta.
Table S1. Details of the whole-surface transplant
involving bB2 crystallin and cB crystallin.
This supplementary material can be found in the
online version of this article.
Please note: Wiley-Blackwell is not responsible for
the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
D. Kapoor et al. Creation of a new protein through ‘surface grafting’
FEBS Journal 276 (2009) 3341–3353 ª 2009 The Authors Journal compilation ª 2009 FEBS 3353