Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

Identification of an osteopontin-like protein in fish
associated with mineral formation
2
Vera G. Fonseca*, Vincent Laize
´
*, Marta S. Valente and M. Leonor Cancela
Centro de Cie
ˆ
ncias do Mar (CCMAR), Universidade do Algarve, Faro, Portugal
Fish, by sharing with mammals a large number of impor-
tant characteristics (e.g. organ systems, developmental
and physiological mechanisms), has become a suitable
model organism to study vertebrate physiological pro-
cesses, particularly skeletal development and tissue min-
eralization [1–3]. While intensively studied in mammals
for decades, mechanisms of bone formation and skeleto-
genesis have been under scrutiny in fish only in the past
few years. Consequently, genetic resources, tools and
methods that may be used towards the study of tissue
mineralization are limited in fish. In an effort to develop
that aspect, numerous studies have been carried out
recently in a number of fish species, including several
freshwater fish (e.g. zebrafish, goldfish, Nile tilapia and
common carp) and one marine fish (gilthead seabream).
The latter is among the most important marine species
grown in European farms, and because hatchery-reared
seabream larvae develop high levels of skeletal malfor-
mations [4–6], it has become the focus of recent studies
related to skeletogenesis. As a result,
4
(a) various genes

involved in seabream ossification have been cloned
(e.g. osteocalcin, matrix Gla protein, osteonectin, bone
morphogenetic protein 2, alkaline phosphatase) [7–11]
(V. Laize
´
& M. Leonor Cancela, unpublished results)
5
,
Keywords
bone-derived cell line; gilthead seabream
Sparus aurata (Teleostei); osteopontin;
subtractive library; tissue mineralization
Correspondence
M. Leonor Cancela, Centro de Cie
ˆ
ncias do
Mar (CCMAR), Universidade do Algarve,
Campus de Gambelas, 8005-139 Faro,
Portugal
Fax: +351 289800069
Tel: +351 289800971
E-mail:
Website: />web/
*These authors contributed equally to this
work
(Received 11 April 2007, revised 21 June
2007, accepted 2 July 2007)
doi:10.1111/j.1742-4658.2007.05972.x
Fish has been recently recognized as a suitable vertebrate model and repre-
sents a promising alternative to mammals for studying mechanisms of tis-

sue mineralization and unravelling specific questions related to vertebrate
bone formation. The recently developed Sparus aurata (gilthead seabream)
osteoblast-like cell line VSa16 was used to construct a cDNA subtractive
library aimed at the identification of genes associated with fish tissue min-
eralization. Suppression subtractive hybridization, combined with mirror
orientation selection, identified 194 cDNA clones representing 20 different
genes up-regulated during the mineralization of the VSa16 extracellular
matrix. One of these genes accounted for 69% of the total number of
clones obtained and was later identified as the
3
S. aurata osteopontin-like
gene. The 2138-bp full-length S. aurata osteopontin-like cDNA was shown
to encode a 374 amino-acid protein containing domains and motifs charac-
teristic of osteopontins, such as an integrin receptor-binding RGD motif, a
negatively charged domain and numerous post-translational modifications
(e.g. phosphorylations and glycosylations). The common origin of mamma-
lian osteopontin and fish osteopontin-like proteins was indicated through
an in silico analysis of available sequences showing similar gene and protein
structures and was further demonstrated by their specific expression in min-
eralized tissues and cell cultures. Accordingly, and given its proven associa-
tion with mineral formation and its characteristic protein domains, we
propose that the fish osteopontin-like protein may play a role in hard tissue
mineralization, in a manner similar to osteopontin in higher vertebrates.
Abbreviations
1
Asp, aspartic acid; ECM, extracellular matrix; EST, expressed sequence tag; Gly, glycine; Glu, glutamic acid; MOS, mirror orientation
selection; OP-L, osteopontin-like; SaOP-L, Sparus aurata osteopontin-like; Ser, serine; SSH, suppression subtractive hybridization.
4428 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS
(b) cell lines representing different bone-related cell types
have been obtained [12], (c) expressed sequence tag

(EST)
6
collections have been developed [13,14], (d) DNA
microarrays have been built [13,14] and (e) a radiation
hybrid panel has been developed for seabream [15].
The present study aimed to identify fish genes
involved in the mineralization of the extracellular matrix
of a seabream osteoblast-like cell line [12] using a
subtractive cloning approach. A cDNA subtractive
library was first constructed using the suppression sub-
tractive hybridization technique (SSH) [16], then impro-
ved using the mirror orientation selection (MOS) in
order to eliminate false positives [17]. This approach
allowed the identification of 194 cDNA clones represent-
ing 20 different up-regulated osteoblast-related genes.
Results
Up-regulated genes during mineralization of
VSa16 osteoblast-like cells
VSa16 cells were cultured for 3 weeks under control
or mineralizing conditions then stained using the von
Kossa method to demonstrate extracellular matrix
(ECM)
7
mineralization of treated cells (results not
shown). Two cDNA libraries were constructed using
RNA extracted from control or treated cells, then sub-
tracted (mineralization minus control), enriched and
normalized according to the MOS method. A total of
1600 bacterial clones containing fragments of up-regu-
lated cDNAs inserted into pGEM-T Easy were screened

in situ. From these, 194 were confirmed to be differen-
tially expressed
8
and cDNA fragments corresponding to
each clone were sequenced and identified by similarity
search using blast facilities at the National Center for
Biotechnology Information. Sequence analysis identi-
fied 20 different cDNAs (Table 1), encoding different
classes of proteins involved in a wide range of cell
mechanisms, including regulation of ECM mineraliza-
tion (n ¼ 1), cellular metabolism (n ¼ 8) and cell orga-
nization and biogenesis (n ¼ 2). The remaining genes
(n ¼ 9) were found to encode proteins with unknown
function. Up-regulated expression of these 20 genes
was confirmed by reverse northern analysis (results not
shown). Interestingly, the most up-regulated gene was
also the most represented (69% of all occurrences, rep-
resented by three different fragments later shown to be
part of the same cDNA). This gene (i.e. the fragments
obtained from SSH) exhibited the highest similarity
with fish osteopontin-like (OP-L)
9
genes (e.g. those of
rainbow and brook trouts) and, to a lesser extent, with
mammalian osteopontin genes, and was consequently
termed Sparus aurata osteopontin-like (SaOP-L) gene
10
.
Cloning and reconstruction of OP-L sequences
Specific PCR primers (Table 2) were designed according

to the three nonoverlapping cDNA fragments obtained
Table 1. Genes up-regulated during the mineralization of VSa16 cells.
29
Biological process
a
Gene name Occurrence
BLASTX
Species E-value
Development
Regulation of ECM mineralization Osteopontin-like ⁄ Spp1 133
b
Fish 2e-08
Cellular process
Cellular metabolism
Coenzyme metabolism Short-chain dehydrogenase 31
c
Insect 2e-19
Nucleic acid metabolism Cartilage intermediate layer protein-like 2 Fish 3e-12
Electron transport Cytochrome c oxidase subunit I 3 Fish E < e-100
Cytochrome c oxidase subunit VIb 1 Fish 1e-08
Protein modification Ubiquitin-conjugating enzyme E2 2 Fish 4e-17
Protein synthesis Ribosomal protein L23a 1 Fish 2e-39
DNA transposition Transposase-like 1 Fish 4e-01
Glucose metabolism Glucose-6-phosphate-1-dehydrogenase 1 Fish 7e-69
Cell organization and biogenesis
Cytoskeleton organization Transgelin-like 2 Fish 4e-03
Regulation of cell growth S100-like calcium-binding protein 1 Fish 7e-08
Unknown
Unknown 1–9 1–4 E > 1
a

According to the definition of the Gene Ontology database at .
b
Three different fragments corresponding to
different regions of osteopontin-like cDNA were identified (occurrence ¼ 2, 8 and 123 clones).
c
Two different fragments corresponding to
different regions of short-chain dehydrogenase cDNA were identified (occurrence ¼ 20 and 11 clones).
V. G. Fonseca et al. Fish osteopontin is associated with mineralization
FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4429
from SSH (a, b and c in Fig. 1A) and used in a combi-
nation of RACE and standard PCR amplifications to
amplify overlapping fragments (d, e and f in Fig. 1A).
A 2138-bp sequence corresponding to the full-length
cDNA of SaOP protein (GenBank accession number
AY651247) was finally reconstructed (Fig. 1A,B). An
ATG initiation codon was found at position 130 with
an in-frame stop codon at position 1254, generating a
1125-bp open reading frame that encoded a 374 amino-
acid peptide. Analysis of the primary sequence of the
protein demonstrated various domains, motifs and post-
translational modifications, including (a) a 16 amino-
acid transmembrane signal peptide at the N-terminus
for protein secretion, (b) an integrin receptor-binding
RGD motif [arginine (Arg) 178–glycine(Gly)179–
aspartic acid(Asp)180], suggesting a role of SaOP-L in
cell adhesion, (c) a negatively charged domain rich in
Asp and glutamic acid (Glu) residues (Asp109–Glu136)
and (d) 64 putative serine (Ser) and threonine phos-
phorylated residues located in the target sequence of
mammary gland casein kinase [S ⁄ T-X-E ⁄ S(P) ⁄ D] and

casein kinase II (S-X-X-E ⁄ S(P) ⁄ D), two enzymes
responsible for most phosphorylations in human osteo-
pontin [18]. Searching online public databases (e.g.
GenBank at and Ensembl
at ) using blast revealed
numerous ESTs or genomic clones with high similarity
to OP-L proteins. The analysis, clustering and assem-
bly of these sequences permitted the reconstruction of
three new OP-L sequences (two cDNAs and one gene;
see supplementary Fig. S1), all of fish origin.
A total of seven complete OP-L sequences (three
previously annotated, three reconstructed and one
cloned) have been collected for this study (Fig. 2).
Interestingly, searching GenBank and Ensembl
sequence databases using OP-L sequences identified
only bony fish sequences (Osteichthyes) and none from
mammals, birds or amphibians. Similarly, searching
sequence databases using annotated osteopontin
sequences identified only sequences from mammals,
birds and amphibians, and none from fish. The pair-
wise per cent identities among mammalian osteopontin
and fish OP-L protein sequences were  60% and
40%, respectively, whereas the identity between fish
and mammalian sequences was only 14% (Table 3),
further confirming the weak similarity existing between
the two proteins at the amino acid level.
Comparison of osteopontin and OP-L sequences
Despite their weak sequence similarity, we hypothe-
sized that fish OP-L protein could be orthologous to
mammalian osteopontin. To test this hypothesis and

to determine whether osteopontin and OP-L protein
have retained the same function in the course of evolu-
tion, the gene and peptide structures of both proteins
were investigated. Annotated osteopontin sequences
were collected from GenBank and Ensembl sequence
databases (seven sequences from mammals and two
from birds; Fig. 2) and compared with OP-L
sequences
11
. The gene structure
11
(Fig. 3A) was highly
similar, exhibiting the same pattern of exon distribu-
tion (four to five small exons at the 5¢ end and two lar-
ger
12
exons at the 3¢ end; note that fish exons 3 and 4
have probably merged to generate exon 3 in birds and
mammals) and an identical pattern of intron insertion:
all occurred between two different codons (phase 0).
Analysis of the protein primary structure (Fig. 3B and
Table 4) identified several conserved features, including
(a) similar size, molecular weight, isoelectric point and
hydropathicity, (b)
13
a similar occurrence for most repre-
sented residues (Asp, Glu and Ser), (c) the presence of
numerous, possibly phosphorylated, O- and N-glycosy-
lated residues throughout the protein (d) and similar
domains (N-terminal negatively charged domain),

motifs (integrin receptor-binding RGD motif) and pro-
teolytic cleavage sites (thrombin). Altogether, these
observations point
14
towards a common ancestral origin
of osteopontin and OP-L genes and proteins.
Table 2. PCR primers used to clone Sparus aurata osteopontin-like
(SaOP) full-length cDNA and analyze its gene expression.
Primer Sequence (5¢) to 3¢)
SaOP1-F01 CGCTCCAGCCGCTGAACTCCTGAAGC
SaOP2-F02 CCACCCCTCAGCCCATCGACCCTACC
SaOP3-F03 GGCGGGACCTGACACCACCACTGACA
SaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGG
SaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCA
SaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAA
SaRPL27a-FW AAGAGGAACACAACTCACTGCCCCAC
SaRPL27a-RV GCTTGCCTTTGCCCAGAACTTTGTAG
Fig. 1. SaOP-L full-length cDNA. (A) cDNA fragments obtained from the subtractive library (a, b and c) and amplified by PCR (d, e and f). (B)
SaOP-L reconstructed cDNA and deduced amino acid sequences (bold). The light grey box indicates the N-terminal signal peptide, the dark
grey box indicates the negatively charged region and the black box indicates the RGD motif. Putative phosphorylation located in the target
sequence of the mammary gland casein kinase and casein kinase II are indicated by
32
circles (serine) or squares (threonine). The SaOP-L
cDNA sequence can be retrieved from GenBank using accession number AY651247.
Fish osteopontin is associated with mineralization V. G. Fonseca et al.
4430 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS
A
B
V. G. Fonseca et al. Fish osteopontin is associated with mineralization
FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4431

Expression patterns of the SaOP gene
Expression of the SaOP-L gene was strongly induced
in osteoblast-like VSa16 and chondrocyte-like VSa13
cells after 4 weeks of mineralization (Fig. 4), suggest-
ing a role of OP-L protein
15
in the process of in vitro
mineralization. In addition, this observation indicated
that OP-L gene expression was not limited to osteo-
blasts but was associated, in both cases, with the min-
eralization process. Expression of the SaOP-L gene
was further investigated in the course of VSa16 ECM
mineralization (data not shown) and shown to be
rapidly and strongly up-regulated during this period
while severely repressed in cells cultured under normal
conditions, thus providing additional evidence for a
role of OP-L protein
16
in the process of fish bone miner-
alization.
Expression of the SaOP-L gene was then investi-
gated during S. aurata development using RNA pre-
pared from embryos, larvae and juvenile fish. Gene
expression was detected early in development, with a
net increase observed
17
10 days after hatching (
17
Fig. 5),
concomitant with the progressive increase known to

occur, both in number and size, of calcified skeletal
structures throughout fish development.
Finally, distribution of the SaOP-L transcript was
investigated in a number of adult tissues, including cal-
cified, mixed (partially calcified) and noncalcified tis-
sues. The SaOP-L gene was expressed in all calcified
and partially calcified tissues, with the highest levels
detected in teeth, bone-dentary and branchial arches
(Fig. 6), while absent or barely detectable in soft tis-
sues (i.e. brain, skeletal muscle, heart, aorta, adipose
tissue, intestine, kidney, ovary, testis, pancreas, spleen,
stomach, liver, gills, urinary bladder, gall bladder,
swim bladder; results not shown). This result demon-
strated the specific expression of the SaOP-L gene
in mineralized tissues, and further confirmed data
obtained in vitro with S. aurata bone-derived cell lines.
Discussion
This work identified, through a subtractive cloning
approach, 20 different transcripts up-regulated in min-
eralized cultures of seabream bone-derived cells. Even
though almost all genes obtained were new with
respect to the seabream gene pool, some have already
been given specific functions in other vertebrates, par-
ticularly in mammals. However, genes usually associ-
ated with osteoblast function (e.g. tissue nonspecific
alkaline phosphatase, type I collagen, osteonectin,
osteocalcin, etc.) have not been identified through this
subtractive approach. The reasons why these genes
were not uncovered during our study could be that (a)
the screening of 1600 bacterial clones was insufficient

(therefore more clones should be screened) or (b) the
Ostariophysi
Tetraodontiformes
Acanthopterygii
ProtacanthopterygiiOsteichthyes
Perciformes
Mammalia
Rodentia
Lagomorpha
Bovinae
Caprinae
Bovidae
Suidae
Actiodactyla
Primates
Aves
Vertebrates
Gasterosteiformes
Scientific name (common name) Acronym Accession
Rattus norvegicus (Norway rat)
RnOP AAA41765
Mus musculus (house mouse)
MmOP AAM53974
Ovis aries (sheep)
OaOP AAD38388
Bos taurus (domestic cattle)
BtOP AAX62809
Sus scrofa (pig)
SsOP CAA34594
Homo sapiens (human)

HsOP AAA86886
Oryctolagus cuniculus (European rabbit)
OcOP BAA03980
Gallus gallus (chicken)
GgOP AAA18584
Coturnix japonica (Japanese quail)
CjOP AAF63330
Danio rerio (zebrafish)
DrOP-L AAT39545
Pimephales promelas (fathead minnow)
PpOP-L
Reconstructed
a
Oncorhynchus mykiss (rainbow trout)
OmOP-L AAG35656
Salvelinus fontinalis (brook trout)
SfOP-L AAG49534
Tetraodon nigroviridis (green pufferfish)
TnOP-L
Reconstructed
a
Sparus aurata (gilthead seabream)
SaOP-L AAV65951
Gasterosteus aculeatus (three spined stickleback)
GaOP-L
Reconstructed
a
Fig. 2. Osteopontin and osteopontin-like sequences used in this study and taxonomy of represented species. Taxonomic data were
retrieved December 20, 2005 from the Integrated Taxonomic Information System at . a, see the supplementary
Fig. S1.

Fish osteopontin is associated with mineralization V. G. Fonseca et al.
4432 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS
MOS technique, used to reduce the number of back-
ground clones, might have decreased cDNA species
diversity in the subtracted library, as already seen in
other studies (Ricardo
18
B. Leite, CCMAR, University
of Algarve, Portugal, personal communication). Alter-
natively, some of these genes may be represented by
cDNA fragments whose identity was not unraveled
through sequence comparison. From the analysis of
clone abundance in the SSH library, the SaOP-L gene
was clearly the most highly expressed and was the
focus of this work.
Fish OP-L protein is probably orthologous to
mammalian osteopontin
The most abundant and up-regulated gene obtained
from the subtractive approach was termed OP-L, in
agreement to its similarity with annotated trout [19]
sequences and the proposed affiliation of these
sequences with mammalian osteopontin. The in silico
analysis of available sequences (annotated, cloned
and reconstructed) clearly demonstrated the overall
conservation of both gene (i.e. similar pattern for
exon size and identical phase of intron insertion) and
protein (i.e. an acidic Asp-rich domain, an RGD
motif, a thrombin cleavage site and numerous puta-
tive phosphorylated residues) structures between fish
OP-L and mammalian osteopontin proteins; we there-

fore concluded that the fish protein is probably the
ortholog
19
of mammalian osteopontin. The weak simi-
larity observed at the amino acid level indicates
20
that
both proteins have diverged significantly during evo-
lution and might have developed distinct functions.
By using similar evidence
21
(e.g. from sequence compari-
son) but a more restricted set of sequences, Kawasaki
and colleagues have drawn a similar conclusion
concerning zebrafish NOP ⁄ OP-L and mammalian
SPP1 ⁄ OP proteins [20] and have proposed that OP-L
protein
22
and osteopontin may have a similar cellular
role (i.e. as a modulator of hydroxyapatite crystalliza-
tion) but a distinct function because of the differences
observed in their amino acid content in acidic clus-
ters. The gene expression pattern further supports the
idea that OP-L protein
23
and osteopontin are indeed
orthologs: they are both strongly expressed in calcified
tissues (bone and calcified cartilage) and up-regulated
during the mineralization process [21,22]. These
data, combined with the absence of data describing

Table 3. Pairwise per cent identities among osteopontin and osteopontin-like protein sequences. Light grey, mammals; dark grey, fish;
white, birds. Bt, Bos taurus (domestic cattle); Cj, Coturnix japonica (Japanese quail); Dr, Danio rerio (zebrafish); Ga, Gasterosteus aculeatus
(three spined stickleback); Gg, Gallus gallus (chicken); Hs, Homo sapiens (human); Mm, Mus musculus (house mouse); Oa, Ovis aries
(sheep); Oc, Oryctolagus cuniculus (European rabbit); Om, Onchorynchus mykiss (rainbow trout); Pp, Pimephales promelas (fathead min-
now); Rn, Rattus norvegicus (Norway rat); Sa, Sparus aurata (gilthead seabream); Sf, Salvenilus fontinalis (brook trout); Ss, Sus scrofa (pig);
Tn, Tetraodon nigroviridis (spotted green pufferfish). Diagonal values in black boxes represent the sequence length.
Rn 317

Mammals Birds Fish %
Mm 79 294 60 ± 11
Oa 48 50 278

23 ± 01
91 ± 00
Bt 49 51 92 278

14 ± 02
10 ± 01
40 ± 16
Mammals
Birds
Fish
Ss 54 54 63 66 303
Hs 61 63 59 62 68 314
Oc 55 56 51 52 60 68 314
Gg 22 22 25 25 23 23 23 264
Cj 22 21 25 24 21 22 22 91 264
Dr 14 14 13 13 14 14 15 10 9 305
Pp 14 14 12 12 13 13 14 9 9 74 297
Om 17 16 15 15 15 16 14 11 11 35 35 347

Sf 17 16 15 15 15 17 16 11 11 37 37 89 359
Tn 11 11 11 10 11 12 12 8 8 24 23 31 30 330
Sa 17 16 13 13 15 17 16 10 10 33 35 38 40 49 374
Ga 17 15 12 12 14 15 15 9 8 33 34 36 36 43 57 323
% Rn Mm Oa Bt Ss Hs Oc Gg Cj Dr Pp Om Sf Tn Sa Ga
V. G. Fonseca et al. Fish osteopontin is associated with mineralization
FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4433
osteopontin in fish or an OP-L protein in mammals,
favor the assumption that OP-L protein is indeed the
fish equivalent of mammalian osteopontin.
OP-L protein plays a role in the process
of mineralization
Osteopontin is a multifaceted protein [23–25], which
has been associated in mammals with multiple phy-
siological and pathological processes, in particular
mineralization [26–28], and is ubiquitously expressed
in adult mammalian organisms [29–32]. In this study,
OP-L gene expression was detected in calcified tis-
sues or in tissues showing some degree of mineral
accumulation, but not in soft tissues. Previous find-
ings in adult brook trout [19] have shown some
expression of an
24
OP-L gene in soft tissues (mainly
in testis and ovulatory ovary, and to a lesser extent
in kidney, gills and skin), but this has not been
25
investigated in calcified tissues. Differences in tissue
distribution of OP-L gene expression observed when
comparing trout and seabream results (a comparison

limited to soft tissues) may be explained by the
recent genome duplication event that specifically
affected Salmonids [9,33] and probably not Sparids.
If the brook trout genome has two copies of the
OP-L gene, as seen for other mineralization-related
genes (e.g. osteonectin), it would be expected that
the two isoforms show different patterns of tissue
distribution and ⁄ or regulation, a common feature
associated with gene duplication. However, we can-
not rule out the fact that differences in gene expres-
sion in soft tissues could be related to different
Table 4. Selected features of osteopontin (mammals) and osteo-
pontin-like (fish) proteins. CKII, casein kinase II; MGCK, mammary
gland casein kinase. Asn, asparginine; Asp, aspartic acid
30
; Glu,
glutamic acid; Thr, threonine.
Features
Mammals
(n ¼ 7)
Fish
(n ¼ 7)
Size (amino acids) 300 ± 17 334 ± 28
Molecular mass (kDa)
a
33.4 ± 2.0 35.2 ± 2.6
pI
a
4.4 ± 0.1 3.9 ± 0.1
Hydropathicity

a,b
)1.14 ± 0.08 )0.84 ± 0.08
Asp+Glu+Ser (%) 39 ± 2 39 ± 2
MGCK ⁄ CKII phosphorylation sites 40 ± 2 53 ± 7
N-glycosylated residues (Asn)
c
1±1 1±1
O-glycosylated residues (Thr)
d
7±3 23±6
RGD adhesion motif 1 1
Thrombin cleavage
e
11
f
Negatively charged domain 1 1
a
Predicted using PROTPARAM at .
b
GRAVY
(grand average of hydropathicity).
c
Predicted using NETNGLYC at
.
d
Predicted using NETOGLYC at http://www.
cbs.dtu.dk.
e
Predicted using PEPTIDECUTTER at asy.
org.

f
Except in the predicted sequence of Gasterosteus aculeatus
osteopontin-like (GaOP-L)
31
.
Control
Control
Relative SaOP-L
gene expression
SaOP-L
SaRPL27a
VSa13
VSa13
VSa16
VSa16
Mineral.
Mineral.
Control
Control
Mineral.
Mineral.
N.D.
N.D.
N.D.
N.D.
Control
Mineralization
1
0
2

3
4
5
Fig. 4. Relative SaOP-L gene expression in VSa16 and VSa13 cells
cultured under control or mineralizing conditions. Top panel, SaOP-L
and SaRPL27a signals after autoradiography; bottom panel, SaOP-L
relative gene expression normalized with RPL27a. ND, not
detected.
Human
Chicken
Bovine
Mouse
Zebrafish
Tetraodon
200 bp
A
B
SP
RGD
RGD
E-, D-rich
MP
SP
D-rich
MP
OP
OP
-
-
like

like
Fish
Fish
OP
OP
Mammals
Mammals
Thrombin
Thrombin
cleavage
cleavage
N
N
O
O
Negatively
Negatively
-
-
charged
charged
cluster
cluster
O
O
N
N
N
N
0000

00000
00000
00000
0
00000 0
00000 0
Fig. 3. Osteopontin and osteopontin-like gene and protein struc-
ture. (A) Structural organization of osteopontin-like (tetraodon and
zebrafish) and osteopontin (chicken, bovine, mouse and human)
coding sequences at the gene level. Grey boxes indicate exons (or
part of exons) representing the coding sequence, starting from the
translation initiation codon and ending at the translation termination
codon. The phase of intron insertion is indicated in
33
black triangles
and is defined according to Patthy [50]. (B) Structural organization
of osteopontin-like (fish) and osteopontin (mammals) proteins. MP,
mature peptide; N and O, predicted N- and O-linked glycosylations,
respectively; SP, signal peptide.
Fish osteopontin is associated with mineralization V. G. Fonseca et al.
4434 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS
developmental or physiological stages of the speci-
mens used in both studies, as evidenced by the regu-
lation of OP-L gene expression in brook trout ovary
during ovulation [19].
The comparison of fish OP-L protein with mamma-
lian osteopontin expression patterns indicates that both
proteins may play a similar role in calcified tissues and
gonads, for example in bone remodeling by mediating
osteoclast attachment to the mineralized bone matrix

during resorption [23,34–36] and ⁄ or in matrix minera-
lization by regulating calcium phosphate crystal
deposition [26,37–39], and in gonads by preventing
calcium-containing-crystal aggregation
26
[40,41]. The
restricted tissue distribution of the OP-L gene tran-
script also indicates that fish protein may be less pleio-
tropic than that from mammals. Finally, the massive
up-regulation of OP-L gene expression during in vitro
mineralization of VSa16 (osteoblast-like) and VSa13
(chondrocyte-like) ECM is highly suggestive of a role
of the OP-L protein in mineralization, which is likely
to be relevant based on the highly significant induction
observed, and further emphasizes the importance of
fish as a model to understand osteopontin function.
The pattern of developmental expression found for
osteopontin is consistent with its involvement in the
early mechanisms of ossification, which start in
S. aurata at early larval stages and are continuous
until 70–90 days after hatching [42–44]. In addition,
the later OP-L gene expression detected in fish
27
130 days after hatching could also be related to ongo-
ing bone remodeling, which occurs at a later stage
during skeletal development ⁄ growth.
In conclusion, our results indicate that OP-L protein
is probably the fish ortholog to mammalian osteopon-
tin, and is likely to play a role in the mineralization
process under physiological conditions.

Experimental procedures
Materials
Tissue culture medium (DMEM), fetal bovine serum, anti-
biotics (penicillin and streptomycin), antimycotics (fungi-
zone), trypsin-EDTA and l-glutamine were purchased from
Invitrogen (Carlsbad, CA, USA). Tissue culture plates were
purchased from Sarstedt (Nu
¨
mbrecht, Germany). All other
reagents were purchased from Sigma-Aldrich (St Louis,
MO, USA), unless otherwise stated.
0
1
2
3
4
5
6
7
8
9
10
U/E851210141824 3 6 1020374861677582130
Cells Hours post
fertilization
Days post hatching
SaOP-L relative gene expression
Maternal De novo transcription
Fig. 5. Relative SaOP-L gene expression
during development. Values are the mean of

three independent real-time PCR experi-
ments. SaOP-L relative gene expression
was normalized with RPL27a. U ⁄ E, unfertil-
ized eggs.
0
1
2
3
4
5
6
7
8
9
10
TE Bd Bv Bs Bo SC BA CA Fso Fsp SK E TO
Calcified Mixed
SaOP-L relative gene expression
Fig. 6. Relative SaOP-L gene expression in adult tissues. Values
are the mean of three independent real-time PCR experiments.
SaOP-L relative gene expression was normalized with RPL27a. BA,
branchial arch; Bd, bone-dentary; Bo, bone-opercula; Bs, bone-skull;
Bv, bone-vertebra; CA, cartilage; E, eye; Fso, fin-soft rays; Fsp, fin-
spiny rays; SC, scale; SK, skin; TE, teeth; TO, tongue.
V. G. Fonseca et al. Fish osteopontin is associated with mineralization
FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4435
Cell culture and extracellular matrix
mineralization
S. aurata VSa16 and VSa13 bone-derived cells were cul-
tured and maintained as described by Pombinho and col-

leagues [12]. Briefly, cells were routinely grown in DMEM
supplemented with 10% fetal bovine serum, 1% penicil-
lin ⁄ streptomycin, 1% fungizone and 2 mml-glutamine, and
incubated at 33 °C in a 10% CO
2
humidified atmosphere.
ECM mineralization was induced by supplementing the cul-
ture medium with 50 lgÆ mL
)1
of l-ascorbic acid, 10 mm
b-glycerophosphate and 4 mm CaCl
2
. Mineral deposition
was detected using the von Kossa staining method and
observed under an Axiovert 25 inverted microscope (Zeiss,
Go
¨
ttingen, Germany) equipped with phase contrast.
Subtracted cDNA library construction
and cloning
Total RNA was isolated from cultured cells, as described
by Chomczynski & Sacchi [45], and poly(A+) RNA was
extracted using the Oligotex Mini kit (Qiagen, Hilden, Ger-
many). SSH was carried out using 2 lg of poly(A+) RNA
and the PCR-Select cDNA Subtraction kit (Clontech, Palo
Alto, CA, USA) following the manufacturer’s protocol.
Subtraction was obtained using cDNAs prepared from min-
eralized cells as the tester sample and cDNAs prepared
from control cells as the driver sample. To normalize and
eliminate false-positive cDNA clones, SSH was combined

with the MOS technique, as described by Rebrikov and
colleagues [17]. Secondary PCR products obtained from the
forward subtracted SSH were inserted into the pGEM-T
Easy vector (Promega, Madison, WI, USA) and the result-
ing plasmids were transformed into DH5a competent cells.
Positive bacterial clones were selected on Luria–Bertani
agar plates containing ampicillin (100 l gÆmL
)1
), X-Gal
(80 lgÆmL
)1
) and isopropyl thio-b-d-galactoside (IPTG)
(0.5 mm) then grown for 20 h at 37 °C in 96-well plates,
each well containing 100 lL of Luria–Bertani supplemented
with ampicillin.
In situ differential screening
Adaptor-free cDNAs from forward and reverse subtrac-
tions were radiolabeled according to the Clontech protocol
PT1117-1 with [
32
P]dCTP[aP] (3000 CiÆmL
)1
; Amersham
Biosciences, Piscataway, NJ, USA) using the Rediprime II
kit (Amersham Biosciences) and purified from unincorpo-
rated radionucleotides using Microspin S-200 HR columns
(Amersham Biosciences). Bacterial clones were blotted onto
Hybond-XL nylon membranes (Amersham Biosciences), as
described by Fonseca and colleagues [46]. Membranes were
hybridized overnight at 42 °C in ULTRAhyb solution

(Ambion, Austin, TX, USA) using probes prepared from
forward or reverse subtractions, and washed twice (5 min
each wash) in low-stringency solution [2 · NaCl ⁄ Cit, 0.1%
SDS (1 · NaCl ⁄ Cit is 0.15 m NaCl and 15 mm sodium
citrate), pH 7.0] and 2 · 15 min in high-stringency solution
(0.1 · NaCl ⁄ Cit, 0.1% SDS) at 55 °C. Membranes were then
exposed to a Kodak XAR film (Amersham Biosciences).
DNA sequencing and identification
DNA from selected clones was sequenced (Macrogen, Seoul,
South Korea) and compared with sequences in the GenBank
database using blastx and tblastx facilities at the National
Center for Biotechnology Information
28
(NCBI, Rockville
Pike, Bethesda, MD, USA, ).
Reverse northern blot analysis
DNA from selected clones was PCR amplified using NP1
and NP2R primers (Clontech) and blotted in quadruplicate
onto Hybond-XL nylon membranes using the Multi-Print
manual arrayer (V & P Scientific, San Diego, CA, USA).
DNA was cross-linked to the membrane for 3–4 min under
UV and for 2 h at 80 °C. Membranes were probed, as
described above, with radiolabeled VSa16 poly(A+) RNA
(from either control or mineralized samples). Signal inten-
sity was estimated by densitometric methods using quan-
tity one software (Bio-Rad, Hercules, CA, USA). The
relative expression of each gene was normalized with
S. aurata ribosomal protein L27a (SaRPL27a, GenBank
accession number AY188520) signals.
Northern blot analysis

Ten micrograms of total RNA was fractionated on a 1.2%
formaldehyde-agarose gel and transferred onto a Hybond-
XL nylon membrane by capillary blotting using
10 · NaCl ⁄ Cit. Membranes were probed, as described
above, using radiolabeled S. aurata OP-L (GenBank acces-
sion number AY651247) or SaRPL27a probes, and the sig-
nal intensity was determined by densitometric methods
using quantity one software (Bio-Rad). Relative OP-L
gene expression was normalized with SaRPL27a signals.
PCR, RACE-PCR and cDNA cloning
All PCRs were performed using a 1 : 50 dilution of the
VSa16 library constructed from poly(A+) RNA (control
and mineralized) using the Marathon cDNA Amplification
kit (Clontech). Amplification of the 5¢- and 3¢-RACE-PCR
products was performed using the Advantage cDNA poly-
merase mix (Clontech) and AP1 ⁄ AP2 primers combined
with specific primers designed according to S. aurata OP-L
cDNA fragments previously obtained (Table 2). PCR frag-
ments were size-fractionated by agarose-gel electrophoresis,
Fish osteopontin is associated with mineralization V. G. Fonseca et al.
4436 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS
purified and inserted into the pGEM-T Easy vector. DNA
inserts were sequenced and identified as described above.
Analysis of gene expression by quantitative
real-time PCR
Real-time PCR assays were performed using the iCycler
PCR system and software to quantify nucleic acids (Bio-
Rad). Total RNA (1 lg) was reverse-transcribed at 37 °C
for 1 h using the Moloney-murine leukemia virus
(M-MLV) reverse transcriptase (Invitrogen), RNase Out

(Invitrogen) and specific reverse primers SaOPreal-RV and
SaRPL27a-RV for OP-L and ribosomal protein L27a
cDNAs. The reaction mixture, containing 1 · iQ SYBR
Green I mix (Bio-Rad), 0.4 lm forward and reverse primers
and 100 ng of reverse-transcribed RNA, was subjected to
the following PCR conditions: 4 min at 95 °C, and 55
cycles of 30 s at 95 °C and 45 s at 68 °C. RPL27a relative
gene expression was used to normalize OP-L gene expres-
sion levels. Fragments of 153 bp for OP-L cDNA and
160 bp for RPL27a cDNA were amplified using the primer
sets SaOPreal-FW ⁄ SaOPreal-RV and SaRPL27a-FW ⁄
SaRPL27a-RV, respectively.
Protein sequence analysis
Signal peptide, and O- and N-linked glycosylation sites,
were predicted using signalp 3.0 [47], netnglyc 1.0 and
netoglyc 3.1 [48] facilities at .
Protein domains were identified using InterProScan facili-
ties at . Percentage protein identity
was calculated using the Sequence Manipulation Suite [49]
available at .
Acknowledgements
Authors thank Marta S. Rafael from the CCMAR,
University of Algarve, Faro, Portugal, for her techni-
cal help in the course of gene identification. The
authors are also grateful to Ricardo B. Leite and
Dr Paulo J. Gavaia for data on the MOS technique
and fish skeletogenesis, respectively. VGF was partially
supported by CCMAR funding. This work was par-
tially supported by grants POCTI ⁄ BCI ⁄ 48748⁄ 2002
from the Portuguese Science and Technology Founda-

tion (FCT) and GOCE-CT-2004-505403 (Marine
Genomics Europe) from the European Commission
under the 6th Framework Program.
References
1 Gavaia PJ, Sarasquete C & Cancela ML (2000)
Detection of mineralized structures in early stages of
development of marine Teleostei using a modified alcian
blue-alizarin red-double staining technique for bone and
cartilage. Biotech Histochem 75, 79–84.
2 Nissen RM, Amsterdam A & Hopkins N (2006) A
zebrafish screen for craniofacial mutants identifies wdr68
as a highly conserved gene required for endothelin-1
expression. BMC Dev Biol 6, 28.
3 Fisher S, Jagadeeswaran P & Halpern ME (2003)
Radiographic analysis of zebrafish skeletal defects. Dev
Biol 264, 64–76.
4 Andrades JA, Becerra J & Fernandez-Llebrez P (1996)
Skeletal deformities in larval, juvenile and adult stages
of cultured gilthead sea bream (Sparus aurata L.).
Aquaculture 141, 1–11.
5 Carrillo J, Koumoundouros G, Divanach P & Martinez
J (2001) Morphological malformations of the lateral line
in reared gilthead sea bream (Sparus aurata L 1758).
Aquaculture 192, 281–290.
6 Koumoundouros G, Oran G, Divanach P, Stefanakis S
& Kentouri M (1997) The opercular complex deformity
in intensive gilthead sea bream (Sparus aurata L.) larvi-
culture. Moment of apparition and description. Aqua-
culture 156, 165–177.
7 Pinto JP, Ohresser MCP & Cancela ML (2001) Cloning

of the bone Gla protein gene from the teleost fish
Sparus aurata. Evidence for overall conservation in gene
organization and bone-specific expression from fish to
man. Gene 270, 77–91.
8 Pinto JP, Conceic¸ a
˜
o N, Gavaia PJ & Cancela ML
(2003) Matrix Gla protein gene expression and protein
accumulation colocalize with cartilage distribution
during development of the teleost fish Sparus aurata.
Bone 32, 201–210.
9 Laize
´
V, Pombinho AR & Cancela ML (2005) Charac-
terization of Sparus aurata osteonectin cDNA and
in silico analysis of protein conserved features: Evidence
for more than one osteonectin in Salmonidae. Biochimie
87, 411–420.
10 Cancela ML, Williamson MK & Price PA (1995) Amino
acid sequence of bone Gla protein from the african
clawed toad Xenopus laevis and the fish Sparus aurata.
Int J Pept Protein Res 46, 419–423.
11 Simes DC, Williamson MK, Ortiz-Delgado JB, Viegas
CSB, Price PA & Cancela ML (2003) Purification of
matrix Gla protein from a marine teleost fish, Argyroso-
mus regius: Calcified cartilage and not bone as the pri-
mary site of MGP accumulation in fish. J Bone Miner
Res 18, 244–259.
12 Pombinho AR, Laize
´

V, Molha DM, Marques SMP &
Cancela ML (2004) Development of two bone-derived
cell lines from the marine teleost Sparus aurata; evidence
for extracellular matrix mineralization and cell-type-spe-
cific expression of matrix Gla protein and osteocalcin.
Cell Tissue Res 315, 393–406.
13 Sarropoulou E, Kotoulas G, Power DM & Geisler R
(2005) Gene expression profiling of gilthead sea bream
V. G. Fonseca et al. Fish osteopontin is associated with mineralization
FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4437
during early development and detection of stress-related
genes by the application of cDNA microarray technol-
ogy. Physiol Genomics 23, 182–191.
14 Sarropoulou E, Power DM, Magoulas A, Geisler R &
Kotoulas G (2005) Comparative analysis and character-
ization of expressed sequence tags in gilthead sea bream
(Sparus aurata) liver and embryos. Aquaculture 243,
69–81.
15 Senger F, Priat C, Hitte C, Sarropoulou E, Franch R,
Geisler R, Bargelloni L, Power D & Galibert F (2006)
The first radiation hybrid map of a perch-like fish:
The gilthead seabream (Sparus aurata L). Genomics 87,
793–800.
16 Diatchenko L, Lau YF, Campbell AP, Chenchik A,
Moqadam F, Huang B, Lukyanov S, Lukyanov K,
Gurskaya N, Sverdlov ED et al. (1996) Suppression
subtractive hybridization: a method for generating dif-
ferentially regulated or tissue-specific cDNA probes and
libraries. Proc Natl Acad Sci USA 93, 6025–6030.
17 Rebrikov DV, Britanova OV, Gurskaya NG, Lukyanov

KA, Tarabykin VS & Lukyanov SA (2000) Mirror Ori-
entation Selection (MOS): a method for eliminating
false positive clones from libraries generated by suppres-
sion subtractive libraries. Nucleic Acids Res 28, 1–4.
18 Christensen B, Nielsen MS, Haselmann KF, Petersen
TE & Sorensen ES (2005) Post-translationally modified
residues of native human osteopontin are located in
clusters: identification of 36 phosphorylation and five
O-glycosylation sites and their biological implications.
Biochem J 390, 285–292.
19 Bobe J & Goetz FW (2001) A novel osteopontin-like
protein is expressed in the trout ovary during ovulation.
FEBS Lett 489, 119–124.
20 Kawasaki K, Suzuki T & Weiss KM (2004) Genetic
basis for the evolution of vertebrate mineralized tissue.
Proc Natl Acad Sci USA 101, 11356–11361.
21 Cowles EA, DeRome ME, Pastizzo G, Brailey LL &
Gronowicz GA (1998) Mineralization and the expres-
sion of matrix proteins during in vivo bone development.
Calcif Tissue Int 62, 74–82.
22 Sommer B, Bickel M, Hofstetter W & Wetterwald A
(1996) Expression of matrix proteins during the develop-
ment of mineralized tissues. Bone 19, 371–380.
23 Giachelli CM & Steitz S (2000) Osteopontin: a versatile
regulator of inflammation and biomineralization.
Matrix Biol 19, 615–622.
24 Denhardt DT & Guo X (1993) Osteopontin: a protein
with diverse functions. FASEB J 7, 1475–1482.
25 Chabas D (2005) L’oste
´

opontine, une mole
´
cule aux mul-
tiples facettes. Me
´
decine ⁄ Sciences 21, 832–838.
26 Beck GR, Zerler B & Moran B (2000) Phosphate is a
specific signal for induction of osteopontin gene expres-
sion. Proc Natl Acad Sci USA 97, 8352–8357.
27 Boskey A (2003) Bone mineral crystal size. Osteoporos
Int 14, 16–21.
28 Huang W, Carlsen B, Rudkin G, Berry M, Ishida K,
Yamaguchi DT & Millera TA (2004) Osteopontin is
a negative regulator of proliferation and differentiation
in MC3T3-E1 pre-osteoblastic cells. Bone 34, 799–808.
29 Yoon K, Buenaga R & Rodan GA (1987) Tissue speci-
ficity and developmental expression of rat osteopontin.
Biochem Biophys Res Commun 148, 1129–1136.
30 Craig AM & Denhardt DT (1991) The murine gene
encoding secreted phosphoprotein 1 (osteopontin): pro-
moter structure, activity, and induction in vivo by estro-
gen and progesterone. Gene 100, 163–171.
31 Kerr JM, Fisher LW, Termine JD & Young MF (1991)
The cDNA cloning and RNA distribution of bovine
osteopontin. Gene 108, 237–243.
32 Nomura S, Wills AJ, Edwards DR, Heath JK & Hogan
BL (1988) Developmental expression of 2ar (osteopon-
tin) and SPARC (osteonectin) RNA as revealed by
in situ hybridization. J Cell Biol 106, 441–450.
33 Allendorf FW & Thorgaard GH (1984) Tetraploidy and

the evolution of salmonid fishes. In Evolutionary
Genetics of Fishes (Turner BJ, ed.), pp. 1–46. Plenum
Press, New York, NY.
34 Shapses SA, Cifuentes M, Spevak L, Chowdhury H,
Brittingham J, Boskey AL & Denhardt DT (2003)
Osteopontin facilitates bone resorption, decreasing bone
mineral crystallinity and content during calcium defi-
ciency. Calcif Tissue Int 73, 86–92.
35 Denhardt DT & Noda M (1998) Osteopontin expression
and function: Role in bone remodeling. J Cell Biochem
72, 92–102.
36 Reinholt FP, Hultenby K, Oldberg A & Heinegard D
(1990) Osteopontin - a possible anchor of osteoclast to
bone. Proc Natl Acad Sci USA 87, 4473–4475.
37 Gericke A, Qin C, Spevak L, Fujimoto Y, Butler WT,
Sorensen ES & Boskey AL (2005) Importance of
phosphorylation for osteopontin regulation of biominer-
alization. Calcif Tissue Int 77, 45–54.
38 Ito S, Saito T & Amano K (2004) In vitro apatite induc-
tion by osteopontin: interfacial energy for hydroxyapa-
tite nucleation on osteopontin. J Biomed Mater Res 69,
11–16.
39 Pampena DA, Robertson KA, Litvinova O, Lajoie G,
Goldberg HA & Hunter GK (2004) Inhibition of
hydroxyapatite formation by osteopontin phospho-
peptides. Biochem J 378, 1083–1087.
40 Luedtke CC, McKee MD, Cyr DG, Gregory M,
Kaartinen MT, Mui J & Hermo L (2002) Osteopontin
expression and regulation in the testis, efferent
ducts, and epididymis of rats during postnatal

development through to adulthood. Biol Reprod 66,
1437–1448.
41 Brunswig-Spickenheier B & Mukhopadhyay AK (2003)
Expression of osteopontin (OPN) mRNA in bovine
ovarian follicles and corpora lutea. Reprod Dom Anim
38, 175–181.
Fish osteopontin is associated with mineralization V. G. Fonseca et al.
4438 FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS
42 Faustino M & Power DM (1999) Development of the
pectoral, pelvic, dorsal and anal fins in cultured sea
bream. J Fish Biol 54, 1094–1110.
43 Faustino M & Power DM (1998) Development of osteo-
logical structures in the sea bream: vertebral column
and caudal fin complex. J Fish Biol 52, 11–22.
44 Faustino M & Power DM (2001) Osteologic develop-
ment of the viscerocranial skeleton in sea bream: alter-
native ossification strategies in teleost fish. J Fish Biol
58, 537–572.
45 Chomczynski P & Sacchi N (1987) Single-step method
of RNA isolation by acid guanidinium thiocyanate
phenol chloroform extraction. Anal Biochem 162, 156–
159.
46 Fonseca VG, Lago-Lesto
´
n A, Laize
´
V & Cancela ML
(2005) Rapid identification of differentially expressed
genes by in situ screening of bacteria. Mol Biotechnol
30, 163–166.

47 Bendtsen JD, Nielsen H, von Heijne G & Brunak S
(2004) Improved prediction of signal peptides: SignalP
3.0. J Mol Biol 340, 783–795.
48 Julenius K, Molgaard A, Gupta R & Brunak S (2005)
Prediction, conservation analysis, and structural charac-
terization of mammalian mucin-type O-glycosylation
sites. Glycobiology 15, 153–164.
49 Stothard P (2000) The sequence manipulation suite:
JavaScript programs for analyzing and formatting
protein and DNA sequences. Biotechniques 28, 1102–
1104.
50 Patthy L (1987) Intron-dependent evolution: preferred
types of exons and introns. FEBS Lett 214, 1–7.
Supplementary material
The following supplementary material is available
online:
Fig. S1. Reconstructed osteopontin-like sequences used
in this study.
This material is available as part of the online article
from
Please note: Blackwell Publishing is not responsible
for the content or functionality of any supplementary
materials supplied by the authors. Any queries (other
than missing material) should be directed to the corre-
sponding author for the article.
V. G. Fonseca et al. Fish osteopontin is associated with mineralization
FEBS Journal 274 (2007) 4428–4439 ª 2007 The Authors Journal compilation ª 2007 FEBS 4439