Báo cáo khoa học: The C-terminus of viral vascular endothelial growth factor-E partially blocks binding to VEGF receptor-1 docx

The C-terminus of viral vascular endothelial growth
factor-E partially blocks binding to VEGF receptor-1
Marie K. Inder, Lyn M. Wise, Stephen B. Fleming and Andrew A. Mercer
Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand
Members of the vascular endothelial growth factor
(VEGF) family of molecules have emerged as major
regulators of new blood vessel formation during vascu-
logenesis and angiogenesis [1–3]. These proteins have
critical roles during embryogenesis and in normal adult
tissues, during wound healing and in pathological con-
ditions such as tumor formation. Currently, the mam-
malian VEGF family includes VEGF-A, VEGF-B,
VEGF-C, VEGF-D and placenta growth factor.
VEGF family members exert their biological activity
via a family of tyrosine kinase receptors, VEGF recep-
tor (VEGFR)-1, VEGFR-2 and VEGFR-3 [4–6].
VEGFR-1 is bound by VEGF-A, VEGF-B and pla-
centa growth factor and is primarily expressed on
endothelial and hematopoietic cells and may have a
role in monocyte recruitment and pro-inflammatory
gene expression. VEGFR-2 is bound by VEGF-A,
VEGF-C and VEGF-D and is the primary signaling
receptor of VEGF-induced endothelial cell mitogenesis,
angiogenesis and vascular permeability. VEGFR-3
regulates formation of the lymphatic vasculature via
VEGF-C and VEGF-D.
We, and others [7–16], have characterized a group of
viral-derived VEGFs, collectively designated VEGF-E,
which are encoded by members of the genus Parapox-
virus, namely Orf virus (ORFV), Pseudocowpoxvirus
(PCPV), Parapoxvirus of red deer in New Zealand

(PVNZ) and bovine papular stomatitis virus (BPSV).
These viruses infect specific ungulates and can readily
infect humans [17,18], and the resulting lesions in the
skin demonstrate extensive vascular dilation, dermal
edema and endothelial cell proliferation [17,19–21].
Viral VEGF proteins differ from mammalian VEGF
family members in that they specifically bind and acti-
vate VEGFR-2 and in general show little or no affinity
for VEGFR-1 [8,9,11–16]. The absence of VEGFR-1
binding is surprising given that the structural predic-
tions for viral VEGFs are very similar to that of
Keywords
Orf virus; Parapoxvirus; vascular endothelial
growth factor; VEGF-E; vascular endothelial
growth factor receptor
Correspondence
L. M. Wise, Virus Research Unit,
Department of Microbiology and
Immunology, University of Otago,
PO Box 56, Dunedin, New Zealand
Fax: +64 3 479 7744
Tel: +64 3 479 7723
E-mail:
(Received 12 August 2007, revised
24 October 2007, accepted 12 November
2007)
doi:10.1111/j.1742-4658.2007.06189.x
Vascular endothelial growth factor (VEGF) family members play impor-
tant roles in embryonic development and angiogenesis during wound
healing and in pathological conditions such as tumor formation. Parapox-

viruses express a new member of the VEGF family which is a functional
mitogen that specifically activates VEGF receptor (VEGFR)-2 but not
VEGFR-1. In this study, we show that deletion from the viral VEGF of a
unique C-terminal region increases both VEGFR-1 binding and VEGFR-
1-mediated monocyte migration. Enzymatic removal of O-linked glycosyla-
tion from the C-terminus also increased VEGFR-1 binding and migration
of THP-1 monocytes indicating that both the C-terminal residues and
O-linked sugars contribute to blocking viral VEGF binding to VEGFR-1.
The data suggest that conservation of the C-terminal residues throughout
the viral VEGF subfamily may represent a means of reducing the immuno-
stimulatory activities associated with VEGFR-1 activation while maintain-
ing the ability to induce angiogenesis via VEGFR-2.
Abbreviations
BPSV, bovine papular stomatitis virus; ORFV, Orf virus; PCPV, Pseudocowpoxvirus; PVNZ, Parapoxvirus of red deer in New Zealand;
SA-HRP, streptavidin-peroxidase; VEGF, vascular endothelial growth factor; VEGFR, VEGF receptor.
FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS 207
VEGF-A [10,22], and that viral VEGFs conserve many
residues shown to be vital for VEGF-A binding to
VEGFR-1 [23,24]. Although domain-exchange studies
with a viral VEGF identified loop regions that are
essential for VEGFR-2 binding [25], a structural basis
for the inability of viral VEGF to bind VEGFR-1 has
not yet been determined. There are, however, a
number of structural features that may influence the
specificity of viral VEGFs, including a C-terminal
Pro ⁄ Thr-rich sequence, encoding potential O-linked
glycosylation sites, that is unique to and highly con-
served among the viral VEGFs [8,10,13–16]. In this
study, we examined the role of the C-terminal region
of the VEGF encoded by ORFV strain NZ2

(ORFV
NZ2
VEGF) in the receptor-binding specificity
and biological activities of the viral VEGFs.
Results
Amino acid sequence comparisons
Comparison of the predicted amino acid sequences
of the viral VEGFs from ORFV strains NZ2
(ORFV
NZ2
VEGF) and NZ7 (ORFV
NZ7
VEGF), BPSV
strain V660 (BPSV
V660
VEGF), PCPV strain VR634
(PCPV
VR634
VEGF) and PVNZ strain RD86
(PVNZ
RD86
VEGF) revealed a Thr ⁄ Pro rich C-termi-
nus, containing putative O-linked glycosylation sites
(Fig. 1A) that is not found in VEGF-A or other
VEGF family members [10]. To examine the role of
this conserved C-terminus in the unique receptor speci-
ficity and biological activities of viral VEGFs, we
constructed a mutant of ORFV
NZ2
VEGF in which

the 16 C-terminal residues were deleted, designated
ORFV
NZ2
VEGF-DC (Fig. 1B). We also constructed a
mutant in which the heparin-binding domain of
VEGF-A was replaced with the 16 C-terminal residues
of ORFV
NZ2
VEGF, designated VEGF-A-NZ2C
(Fig. 1B).
Production and glycosylation state of VEGF
mutants
VEGF-A-NZ2C and ORFV
NZ2
VEGF-DC were
expressed with a FLAG octapeptide at the C-terminus
and then purified. SDS ⁄ PAGE under reducing condi-
tions followed by silver staining revealed bands at
 26–28 and 19–20 kDa, for VEGF-A-NZ2C and
ORFV
NZ2
VEGF-DC, respectively (Fig. 2). Deglycosy-
lation treatment with N-glycosidase reduced the
monomeric size of VEGF-A-NZ2C and ORFV
NZ2
-
VEGF-DC by 2–4 kDa (Fig. 2), which was similar
to that seen for VEGF-A and ORFV
NZ2
VEGF,

indicating that each contained N-linked glycosylation.
Further treatment with sialidase and O-glycosidase
reduced VEGF-A-NZ2C and ORFV
NZ2
VEGF by
another 2–4 kDa, although no size shift was observed
for VEGF-A and ORFV
NZ2
VEGF-DC (Fig. 2). The
absence of O-linked glycosylation on ORFV
NZ2
VEGF-
DC supports the prediction that ORFV
NZ2
VEGF
contains an O-linked glycosylation site in the 16
C-terminal residues (Fig. 1). The observation that the
addition of the 16 C-terminal residues to VEGF-A-
NZ2C are associated with the gain of O-linked glyco-
sylation also supports this prediction (Fig. 1).
Deletion of the C-terminus of ORFV
NZ2
VEGF
increases its affinity for VEGFR-1 and VEGFR-2
To investigate the role of the ORFV
NZ2
VEGF C-ter-
minus in receptor specificity, we tested the ability of
the VEGF mutants to bind immobilized dimeric Ig
fusion proteins containing the extracellular domains of

human VEGFR-1 or VEGFR-2 using a receptor-bind-
ing ELISA.
VEGF-A and VEGF-A-NZ2C demonstrated signifi-
cant levels of binding to VEGFR-1 compared with
A
B
Fig. 1. Sequence comparison of the parapoxviral VEGF C-termini
and schematic representation of ORFV
NZ2
VEGF, VEGF-A and
mutants. (A) The C-terminal amino acid sequences of ORFV
NZ2-
VEGF, BPSV
V660
VEGF, PCPV
VR364
VEGF, ORFV
NZ7
VEGF and
PVNZ
RD86
VEGF are shown [8,10,13,14]. Predicted O-linked glyco-
sylation sites are shaded gray [37]. (B) Schematic representation of
ORFV
NZ2
VEGF, VEGF-A and mutants. ORFV
NZ2
VEGF-DCisa
mutant of ORFV
NZ2

VEGF in which the 16 C-terminal (C-term) amino
acids have been deleted. VEGF-A-NZ2C is a mutant of VEGF-A in
which the heparin-binding domain (HBD) has been replaced with
the 16 C-terminal amino acids from ORFV
NZ2
VEGF. All proteins are
FLAG (F)-tagged at the C-terminus for detection and purification.
The locations of the conserved N-linked glycosylation site (N) and
the variable loop regions (L1–3) are indicated by dashes and light
gray boxes, respectively.
Role of viral VEGF’s C-terminus in VEGFR binding M. K. Inder et al.
208 FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS
mock-purified protein at all of the concentrations
tested (‡ 0.1 lgÆmL
)1
, P £ 0.05; Fig. 3A). As reported
previously [15,16], ORFV
NZ2
VEGF did not bind
VEGFR-1 at any concentration tested (Fig. 3A). By
contrast, ORFV
NZ2
VEGF-DC showed significant levels
of binding to VEGFR-1 from a concentration of
3.3 lgÆmL
)1
(P £ 0.05; Fig. 3A).
VEGF-A and VEGF-A-NZ2C demonstrated signifi-
cant levels of binding to VEGFR-2 compared with
mock-purified protein at all of the concentrations tested

(‡ 0.1 lgÆmL
)1
, P £ 0.05; Fig. 3B). ORFV
NZ2
VEGF
and ORFV
NZ2
VEGF-DC also showed significant bind-
ing to VEGFR-2 from a concentration of 0.4 lgÆmL
)1
(P £ 0.05; Fig. 3B). No significant differences in
binding to VEGFR-2 were observed at any concen-
tration between VEGF-A and VEGF-A-NZ2C or
ORFV
NZ2
VEGF and ORFV
NZ2
VEGF-DC(P £ 0.05;
Fig. 3B).
To further examine the receptor specificity of the
VEGF mutants, we tested their ability to inhibit
VEGF-A bind the dimerized Ig fusion proteins con-
taining the extracellular domains of human VEGFR-1
or VEGFR-2 under soluble binding conditions using a
competitive displacement ELISA [8,13].
Preincubation of soluble VEGF-A or VEGF-A-
NZ2C with VEGFR-1 significantly inhibited the
binding of the receptor to immobilized VEGF-A at
all concentrations tested (‡ 0.4 lgÆmL
)1

, P £ 0.05),
whereas ORFV
NZ2
VEGF did not significantly
inhibit VEGFR-1 binding to VEGF-A at any con-
centration tested (Fig. 3C). ORFV
NZ2
VEGF-DC did,
however, inhibit binding of VEGFR-1 to VEGF-A
from a concentration of 1.1 lgÆmL
)1
(P £ 0.05;
Fig. 3C).
Preincubation of soluble VEGF-A, VEGF-A-NZ2C,
ORFV
NZ2
VEGF or ORFV
NZ2
VEGF-DC significantly
inhibited the binding of VEGFR-2 to immobilized
VEGF-A at all concentrations tested (‡ 0.2 lgÆmL
)1
,
P £ 0.05; Fig. 3D). ORFV
NZ2
VEGF-DC was, however,
significantly more potent than ORFV
NZ2
VEGF from a
concentration of 0.6 lgÆmL

)1
, whereas no significant
differences were observed between VEGF-A-NZ2C
and VEGF-A at any of the concentrations tested
(P £ 0.05; Fig. 3D).
The interactions of the VEGF mutants with VEG-
FR-1 and VEGFR-2 were further tested in bioassays
that detect receptor binding and cross-linking at the
cell surface. These assays made use of BaF3 cell lines
expressing chimeric receptors consisting of the extracel-
lular domain of either human VEGFR-1 or murine
VEGFR-2 and the transmembrane and cytoplasmic
domains of the erythropoietin receptor [26,27]. Binding
and cross-linking of the chimeric receptors induce cell
proliferation.
VEGF-A and VEGF-A-NZ2C stimulated significant
proliferation of cells expressing VEGFR-1 from the
lowest concentration tested (‡ 1.2 ngÆmL
)1
, P £ 0.05),
although ORFV
NZ2
VEGF did not induce cellular pro-
liferation (Fig. 3E). ORFV
NZ2
VEGF-DC stimulated
significant proliferation of cells expressing VEGFR-1
from a concentration of 11 ngÆmL
)1
(P £ 0.05;

Fig. 3E).
VEGF-A, VEGF-A-NZ2C, ORFV
NZ2
VEGF and
ORFV
NZ2
VEGF-DC were each able to stimulate sig-
nificant proliferation of cells expressing VEGFR-2, in
the presence of heparin, from a concentration of
0.8 ngÆmL
)1
(P £ 0.05; Fig. 3F). ORFV
NZ2
VEGF-DC
was, however, significantly more potent than
ORFV
NZ2
VEGF, VEGF-A and VEGF-A-NZ2C at all
concentrations tested (0.8–22 ngÆmL
)1
, P £ 0.05;
Fig. 3F).
In summary, ORFV
NZ2
VEGF-DC showed a signi-
ficant increase in VEGFR-1 binding compared
with ORFV
NZ2
VEGF in the three different assays
(Fig. 3A,C,E). In addition, a consistent, but not signifi-

cant, decrease was observed in VEGFR-1 binding
by VEGF-A-NZ2C compared with VEGF-A. No
Fig. 2. The C-terminus of ORFV
NZ2
VEGF has O-linked glycosyla-
tion. Purified VEGF-A, VEGF-A-NZ2C, ORFV
NZ2
VEGF and ORFV
NZ2-
VEGF-DC were analyzed before and after enzymatic removal of
N- and O-linked sugars. The proteins were resolved under reducing
conditions following treatment with the indicated combinations of
enzymes as described in Experimental procedures. Proteins were
visualized by western blotting using anti-FLAG Ig. Molecular mass
markers are indicated.
M. K. Inder et al. Role of viral VEGF’s C-terminus in VEGFR binding
FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS 209
consistent differences were noted in VEGFR-2 binding
between VEGF-A-NZ2C and VEGF-A (Fig. 3B,D,F).
ORFV
NZ2
VEGF-DC did, however, show a small, but
significant increase, in VEGFR-2 binding, compared
with ORFV
NZ2
VEGF, in two of the three assay sys-
tems (Fig. 3D,F).
Enzymatic removal of the O-linked glycosylation
of ORFV
NZ2

VEGF increases its affinity for
VEGFR-1 and VEGFR-2
To examine the role O-linked glycosylation might play
in the receptor specificity and biological activities of
Role of viral VEGF’s C-terminus in VEGFR binding M. K. Inder et al.
210 FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS
the viral VEGFs, ORFV
NZ2
VEGF was treated with
sialidase and O-glycosidase to remove the O-linked
glycosylation. The enzyme-treated protein, ORFV
NZ2
-
VEGF-DOglyc was then repurified and analyzed by
SDS ⁄ PAGE and western blotting which revealed
bands at  38–42 and 19–20 kDa, under nonreducing
and reducing conditions, respectively (Fig. 4A). N-Gly-
cosidase treatment reduced the monomeric size of
ORFV
NZ2
VEGF-DOglyc by 2–3 kDa (Fig. 4A), but
further treatment with sialidase and O-glycosidase did
not result in a size shift. These results confirm that
ORFV
NZ2
VEGF-DOglyc has retained its N-linked
glycosylation and the majority of the O-linked glyco-
sylation has been removed.
To investigate the role of that ORFV
NZ2

VEGF
O-linked glycosylation plays in receptor specificity we
tested the ability of ORFV
NZ2
VEGF-DOglyc to bind
and cross-link VEGFR-1 and VEGFR-2 in the BaF3
bioassays. Consistent with our previous results,
VEGF-A and ORFV
NZ2
VEGF-DC were able to stimu-
late significant proliferation of cells expressing VEG-
FR-1 from 1.2 and 11 ngÆmL
)1
, respectively (P £ 0.05),
whereas ORFV
NZ2
VEGF did not induce cellular pro-
liferation (Fig. 4B). ORFV
NZ2
VEGF-DOglyc was less
potent than ORFV
NZ2
VEGF-DC but did stimulate
significant proliferation of cells expressing VEGFR-1
at the highest concentration tested (100 ngÆmL
)1
,
P £ 0.05; Fig. 4B).
VEGF-A, ORFV
NZ2

VEGF, ORFV
NZ2
VEGF-DC
and ORFV
NZ2
VEGF-DOglyc were each able to sti-
mulate significant proliferation of cells expressing
VEGFR-2, in the presence of heparin, from a concen-
tration of 0.3 ngÆmL
)1
(P£ 0.05; Fig. 4C). ORFV
NZ2
-
VEGF-DC and ORFV
NZ2
VEGF-DOglyc were both
significantly more potent than VEGF-A and
ORFV
NZ2
VEGF at all concentrations tested (0.3–
7.4 ngÆmL
)1
, P £ 0.05; Fig. 4C).
Removal of the C-terminal residues or O-linked
glycosylation of ORFV
NZ2
VEGF increases its
recruitment of THP-1 monocytes
Previous studies have shown that mammalian VEGF
family members induce monocyte chemotaxis via their

interaction with VEGFR-1 [28–30]. Thus, using a Trans-
wellÒ assay (Corning Costar, Corning, NY, USA), we
examined the chemotactic response of THP-1 mono-
cytes to treatment with the VEGF mutants. The human
THP-1 monocytic cell line has previously been shown to
respond to VEGF family members in a manner similar
to human peripheral blood monocytes [29].
VEGF-A and VEGF-A-NZ2C were able to induce
significant migration of cells from a concentration of
4ngÆmL
)1
(P £ 0.05), whereas ORFV
NZ2
VEGF did
not induce cell migration (Fig. 5). ORFV
NZ2
VEGF-DC
and ORFV
NZ2
VEGF-DOglyc were also able to induce
significant migration of cells from a concentration of
20 ngÆmL
)1
(P £ 0.05; Fig. 5). Migration of THP-1
monocytes induced by VEGF-A, VEGF-A-NZ2C,
ORFV
NZ2
VEGF-DC and ORFV
NZ2
VEGF-DOglyc was

significantly inhibited by preincubation of the cells
with neutralizing antibody against VEGFR-1
(P £ 0.05) (Fig. 5).
The increase in monocyte migration induced by
ORFV
NZ2
VEGF-DC, compared with ORFV
NZ2
VEGF,
was consistent with its increase in VEGFR-1 binding
in the receptor-binding assays (Figs 3 and 4). In addi-
tion, the slight decrease in monocyte migration by
VEGF-A-NZ2C, compared with VEGF-A, was consis-
tent with its decrease in VEGFR-1 binding in the
receptor-binding assays (Fig. 3). By contrast, the
increase in monocyte migration induced by ORFV
NZ2
-
VEGF-DOglyc, compared with ORFV
NZ2
VEGF, was
greater than the increase in VEGFR-1 binding
observed in the receptor-binding assay (Fig. 4).
Fig. 3. Deletion of the C-terminus of ORFV
NZ2
VEGF increases binding to VEGFR-1 and VEGFR-2. Immobilized VEGFR-1–Ig (A) or VEGFR-2–
Ig (B) fusion protein was incubated for 2 h with increasing concentrations of soluble VEGF-A, VEGF-A-NZ2C, ORFV
NZ2
VEGF, ORFV
NZ2

VEGF-
DC or with medium alone. Bound VEGF protein was detected with horseradish peroxidase-conjugated M2 anti-FLAG Ig. Values are
expressed as a binding index, defined as the mean increase in absorbance ± SEM at 450 nm over the background (n = 2) and are represen-
tative of three separate experiments. Soluble VEGFR-1–Ig (C) or VEGFR-2–Ig (D) fusion protein was incubated for 2 h with increasing
concentrations of VEGF-A, VEGF-A-NZ2C, ORFV
NZ2
VEGF and ORFV
NZ2
VEGF-DC or with medium alone. The mixture was then added to
VEGF-A-coated wells to capture free VEGFR–Ig, which was detected with a biotinylated sheep anti-human Ig SA-HRP conjugate. The results
are presented as the percentage of the maximal absorbance of VEGFR–Ig bound. Values are expressed as mean ± SEM (n = 2) and are rep-
resentative of three separate experiments. The abilities of the VEGF mutants to bind and cross-link VEGFR-1 (E) or VEGFR-2 (F) were tested
using specific bioassay cell lines. Bioassay cells were washed and resuspended in dilutions of VEGF-A, VEGF-A-NZ2C, ORFV
NZ2
VEGF and
ORFV
NZ2
VEGF-DC, or with medium alone for 48 h at 37 °C. DNA synthesis was quantified by [
3
H]thymidine incorporation and b-counting.
Values were expressed as a proliferation index, defined as the mean increase in cell proliferation ± SEM over the background (n = 2) and
are representative of two separate experiments. An asterisk indicates a significant (P £ 0.05) difference from the background level recorded
when no growth factor was added. A cross indicates a significant (P £ 0.05) difference in receptor binding between ORFV
NZ2
VEGF-DC and
the equivalent concentration of ORFV
NZ2
VEGF.
M. K. Inder et al. Role of viral VEGF’s C-terminus in VEGFR binding
FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS 211

Discussion
In this study, we demonstrated a role for the highly
conserved O-glycosylated C-terminus in determining
the unique receptor-recognition profile and biological
activities of viral VEGFs. Complete removal of the
C-terminus of ORFV
NZ2
VEGF increased its binding
to VEGFR-1. In addition, enzymatic removal of the
O-linked glycosylation within the C-terminal region
improved the ability of ORFV
NZ2
VEGF to activate
VEGFR-1, but not to the same level as that of the
deletion mutant. These results indicate that the C-ter-
minal residues play a dominant role in preventing
ORFV
NZ2
VEGF recognition of VEGFR-1 and that
the O-linked sugars associated with the C-terminus
play a contributing role. Interestingly, a previous study
using Escherichia coli-expressed viral VEGF (strain
D1701), which would not have contained O-linked
glycosylation, reported minimal VEGFR-1 binding
[11,12]. The assay employed in this study directly mea-
sures binding and cross-linking of chimeric VEGFR-1
and may be more sensitive than the endothelial cell-
based assays used in the previous study.
Removal of the C-terminal residues from ORFV
NZ2

-
VEGF also appeared to slightly enhance signaling via
VEGFR-2, as measured in the BaF3 cell proliferation
assay (Fig. 3F). This suggests that the C-terminal
region of viral VEGF interferes with both VEGFR-1
and VEGFR-2 binding. This is consistent with previ-
ous studies, which have shown that the binding sites
for VEGFR-1 and VEGFR-2 overlap [23,31,32]. A
slight increase in VEGFR-2 binding by ORFV
NZ2
-
VEGF-DC was also seen in the competitive receptor-
binding ELISA (Fig. 3D). However, no difference in
VEGFR-2 binding was observed in the direct receptor-
binding ELISA (Fig. 3B). This latter assay relies on
immunodetection of the FLAG peptide fused to the
VEGF protein. Because the precise location of the
FLAG peptide, in relation to the VEGF homology
domain, varies between proteins, the accessibility of
the FLAG peptide within the VEGF ⁄ VEGFR complex
may also differ. This may influence the sensitivity of
the assay and mask the slight differences in VEGFR-2
observed in other assays. Interestingly, removal of the
Fig. 4. Removal of the C-terminal O-linked glycosylation from
ORFV
NZ2
VEGF increases binding to VEGFR-1 and VEGFR-2. (A)
Purified ORFV
NZ2
VEGF and ORFV

NZ2
VEGF-DOglyc were analyzed
before and after enzymatic removal of N- and O-linked sugars. The
proteins were resolved under reducing conditions following treat-
ment with the indicated combinations of enzymes as described in
Experimental procedures. Proteins were visualized by silver
staining. Molecular mass markers are indicated. The ability of
ORFV
NZ2
VEGF-DOglyc to bind and cross-link VEGFR-1 (B) or
VEGFR-2 (C) was tested using specific bioassay cell lines. Bioassay
cells were washed and resuspended in dilutions of VEGF-A,
ORFV
NZ2
VEGF, ORFV
NZ2
VEGF-DC and ORFV
NZ2
VEGF-DOglyc, or
with medium alone for 48 h at 37 °C. DNA synthesis was quanti-
fied by [
3
H]thymidine incorporation and b-counting. Values were
expressed as a proliferation index, defined as the mean increase in
cell proliferation ± SEM over the background (n = 2) and are repre-
sentative of two separate experiments. An asterisk indicates a sig-
nificant (P £ 0.05) difference from the background level recorded
when no growth factor was added. A cross indicates a significant
(P £ 0.05) difference in receptor binding between ORFV
NZ2

VEGF-
DC or ORFV
NZ2
VEGF-DOglyc and the equivalent concentration of
ORFV
NZ2
VEGF.
Role of viral VEGF’s C-terminus in VEGFR binding M. K. Inder et al.
212 FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS
O-linked glycosylation from ORFV
NZ2
VEGF also
slightly increased the response seen in the VEGFR-2
BaF3 assay, to the level seen with the deletion mutant
(Fig. 4C). This indicates that steric hindrance by the
O-linked sugars, and not the C-terminal residues, may
reduce the viral VEGF’s affinity for VEGFR-2.
Recently the crystal structure of ORFV
NZ2
VEGF
was solved revealing a high similarity to the known
structures of other VEGF family members [22,25]. The
C-terminal region, however, appeared to be highly flex-
ible and could not be resolved by crystallography. Its
location adjacent to the receptor-binding face, as illus-
trated in Fig. 6, suggests it is well placed to influence
the receptor-recognition profile of viral VEGF. The
C-terminal residues may therefore form a direct physi-
cal block, preventing access of the VEGFRs to the
receptor-binding face. Curiously, replacement of the

heparin-binding domain of VEGF-A with the C-termi-
nal residues of the viral VEGF did not significantly
alter the affinity of VEGF-A for VEGFR-1 or VEG-
FR-2. A simple explanation for this finding would be
that the C-terminal residues of the VEGF-A mutant,
due to the influence of adjacent residues or other struc-
tural features of VEGF-A, are not orientated towards
the receptor-binding face and are therefore unable
to influence receptor recognition. Alternatively, the
inhibitory effects of the C-terminal residues on
VEGFR binding may be dependent on their interac-
tions with other structural features of the viral VEGF.
Removal of the C-terminal region from ORFV
NZ2
-
VEGF did not elevate VEGFR binding to the level
seen for VEGF-A, which suggests that other structural
elements play a role in determining VEGFR specificity
of the viral VEGFs. It has been hypothesized that the
inability of viral VEGF to bind VEGFR-1 may be due
to the absence of a functional groove on the receptor-
binding face of the homodimer [10,22]. The lack of this
groove may prevent viral VEGFs effectively binding
the domain 2–3 linker region of VEGFR-1. In support
of this model, changing Arg46 to Iso within loop 1 of
the groove region of ORFV
NZ2
VEGF increased its
affinity for both VEGF receptors [22]. In addition,
replacement of both loop 1 and loop 3 of ORFV

NZ2
-
VEGF with those of VEGF-A partially restored bind-
ing to VEGFR-1 [22]. Neither mutation, however,
completely restored VEGFR-1 binding to the levels
seen for VEGF-A [22]. These findings in conjunction
with the results of our study suggest that the groove
region of the receptor binding face and the C-terminal
residues make separate but additive contributions to
the inability of viral VEGF to bind VEGFR-1. It
would therefore be interesting to construct a viral
Fig. 5. Removal of the C-terminal residues or O-linked glycosylation increases ORFV
NZ2
VEGF-induced VEGFR-1-dependent chemotaxis of
THP-1 monocytes. THP-1 monocytes (1 · 10
5
cells) were added to the upper chamber of a TranswellÒ insert. The indicated concentrations
of VEGF-A, VEGF-A-NZ2C, ORFV
NZ2
VEGF, ORFV
NZ2
VEGF-DC and ORFV
NZ2
VEGF-DOglyc, or medium alone were added to the lower com-
partments, the inserts were incubated for 6 h at 37 °C and migrated cells that remained attached to the insert membrane were stained and
counted as described in Experimental procedures. Where indicated, THP-1 monocytes were preincubated with a neutralizing antibody
against VEGFR-1 for 16 h and then assayed as described. Results were expressed as a migration index, defined as the mean increase in cell
migration, ± SEM, over background (n = 8) and are representative of three experiments. Migration indexes that were significantly above that
of medium only are indicated by an asterisk (P £ 0.05). A cross indicates a significant (P £ 0.05) difference between cell migration induced in
the presence and absence of antibody.

M. K. Inder et al. Role of viral VEGF’s C-terminus in VEGFR binding
FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS 213
VEGF mutant in which, loops 1 and 3 are replaced
with those from VEGF-A, and the C-terminal residues
are deleted, to ascertain whether these regions are the
determinants of VEGFR recognition or if additional
structural features are involved.
The C-terminal residues are conserved among all
members of the viral VEGF family. Recently, a variant
viral VEGF from BPSV has been reported that shows
greater recognition of VEGFR-1 and VEGFR-2 than
the other viral VEGFs [8]. BPSV
V660
VEGF varies from
the other viral VEGFs in its C-terminal residues, yet
conserves the O-linked glycosylation sites. This sup-
ports our finding that the specific amino acids within
the C-terminus influence the receptor-recognition pro-
file of viral VEGFs. It was also proposed that
BPSV
V660
VEGF residues adjacent to the receptor-bind-
ing face influence the orientation of loop 3 and the
width of the groove, thereby affecting its ability to bind
the VEGFRs [8]. The orientation of the receptor-bind-
ing face of BPSV
V660
VEGF may therefore be such that
the C-terminal residues have less interaction with the
loop regions. Alternatively, this region of the other viral

VEGFs, which differ from BPSV
V660
VEGF, maybe act
as a site of interaction with the C-terminal residues.
VEGFR-1 activation has been shown to mediate
VEGF-induced immunostimulatory activities such as
dendritic cell activation, monocyte migration, inflam-
matory cytokine induction and other important anti-
viral immune defenses [29,30,33,34]. Removal of either
the C-terminal residues or O-linked glycosylation from
the viral VEGF resulted in an increase in VEGFR-1-
mediated migration of THP-1 monocytes. Conserva-
tion of the C-terminal residues throughout the viral
VEGF family may therefore represent a means of viral
immune evasion. The viral VEGFs, however, retain
sufficient binding of VEGFR-2 to potently induce vas-
cular dilation, dermal edema and proliferation of
endothelial cells, thereby contributing to the prolifera-
tive and highly vascularized nature of parapoxvirus
lesions [15,35,36].
Experimental procedures
Expression vectors
Expression vectors for VEGF-A (murine VEGF iso-
form 164) and ORFV
NZ2
VEGF were derived from
pAPEX-3 and have been described previously [15]. A DNA
fragment containing nucleotides 4–368 of ORFV
NZ2
VEGF

was amplified by PCR from viral DNA with the following
primers: NZ2-DC5¢ (5¢-AGCGCCC
GGCGCGCCAGA
AGTTGCTCGTCGGCATAC-3¢, AscI site underlined)
and NZ2-DC3¢ (5¢-ACTCGA
ACGCGTTCGTGGTCTA
CAATCGCA-3¢, MluI site underlined). A DNA fragment
containing nucleotides 4–458 of VEGF-A and 55 nucleo-
tides from the C-terminus of ORFV
NZ2
VEGF was ampli-
fied from pAPEX–mVEGF-A [15] with the following
primers: mV-for 5¢ (5¢-CAT
GGCGCGCCTGATGAAC
TTTCTGCTGTCTTGG-3¢) and mV-NZ2C 3 ¢ (5¢-CTG
AC
GCGTGCGGCGTCTTCTGGGCGGCCTTGTGGT CGT
CG GTGGCGTGGTTGTGAACTTTGGTCTGCATTCA
CATCGGCT-3¢). The PCR products were digested with
AscI and MluI and ligated to pAPEX–mVEGF-A [15],
from which the DNA sequence encoding VEGF-A but not
the FLAG octapeptide (IBI ⁄ Kodak, Rochester, NY, USA)
had been removed by digestion with AscI.
A
B
Fig. 6. Structural elements of ORFV
NZ2
VEGF involved in VEGFR
binding. Ribbon representation of the structure of (A) VEGF-A:Flt-
1-D2 (VEGFR-1 domain 2) (PDB identifier 1QTY) [32] and (B)

ORFV
NZ2
VEGF (PDB identifier 2GNN) [22]. The VEGF dimers are
shaded gray with one monomer in a darker shade, and with
loops 1, 2 and 3, shaded blue, green and red, respectively. VEGFR-
1 domain 2 is shaded purple. Residues Ser94–Asn99 within loop 3
of one of the ORFV
NZ2
VEGF monomers are missing, as they were
disordered due to their intrinsic flexibility. The residues of VEGF-A
that form the groove implicated in VEGFR-1 binding, and the resi-
dues of ORFV
NZ2
VEGF in the equivalent positions, are shaded
black. The flexible C-terminus of each ORFV
NZ2
VEGF monomer is
labeled and shaded orange, with the disordered residues Thr120–
Arg133 drawn schematically as dashes. The putative O-linked
glycosylation sites within the C-termini are shaded yellow.
Role of viral VEGF’s C-terminus in VEGFR binding M. K. Inder et al.
214 FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS
Protein synthesis from the expression vectors described
above gave rise to secreted polypeptides tagged with the
FLAG octapeptide at their C-termini. The C-terminal
deletion mutant of ORFV
NZ2
VEGF was designated
ORFV
NZ2

VEGF-DC, and the domain exchange mutant of
VEGF-A with the ORFV
NZ2
VEGF O-glycosylated C-ter-
minus was designated VEGF-A-NZ2C.
Recombinant protein production
Recombinant FLAG-tagged proteins were expressed in
293-EBNA cells, purified and quantitated as previously
described [15]. A mock elution sample was obtained from
conditioned medium of pAPEX-3-transfected 293-EBNA
cells that underwent the same purification process.
Protein deglycosylation
Proteins were treated with N-glycosidase F (Roche, Mann-
heim, Germany), sialidase (neuraminidase, Roche), and
O-glycosidase (Roche), and resolved by SDS ⁄ PAGE and
visualized by silver staining or western blotting, as previ-
ously described [14].
ELISA receptor-binding assay
Maxisorp 96-well immunoplates (Nunc, Roskilde, Den-
mark) were coated with 500 ngÆmL
)1
VEGFR-1–Ig or
VEGFR-2–Ig fusion proteins (R&D Systems, Minneapolis,
MN, USA) in coating buffer (15 mm Na
2
CO
3
,35mm
NaHCO
3

, pH 9.6) at 4 °C for 16 h and blocked with
0.5% BSA and 0.02% Tween 20 at room temperature for
1 h. Plates were washed between steps with wash buffer
(NaCl ⁄ P
i
and 0.02% Tween 20). Immobilized VEGFR–Igs
were then incubated with a titration of purified VEGFs at
room temperature for 2 h. Captured VEGF was detected
by horseradish peroxidase-conjugated M2 anti-FLAG Ig
(Sigma, St Louis, MO, USA) and developed with tetra-
methylbenzidine substrate reagent (B&D Biosciences, San
Diego, CA, USA) and quantified by measuring absorbance
at 450 nm.
ELISA competitive displacement receptor
binding assay
Maxisorp 96-well immunoplates were incubated with
400 ngÆmL
)1
VEGF-A in coating buffer at 4 °C for 16 h
and blocked with 1% BSA and 0.02% Tween 20 at 37 °C
for 45 min. Plates were washed between steps with wash
buffer. Samples of purified growth factors, serially diluted
in binding buffer (NaCl ⁄ P
i
with 0.4% BSA, 0.02%
Tween 20 and 2 lgÆmL
)1
heparin in VEGFR-2 assays
only), were incubated with 300 ngÆmL
)1

human VEGFR-1–
Ig or VEGFR-2–Ig in non-absorbent plates at 25 °C for
1 h. The mixture was then transferred to plates coated with
VEGF-A and incubated at 25 °C for 1 h to capture the
unbound VEGFR–Ig fusion protein. The captured
VEGFR–Ig fusion protein was detected by biotinylated
anti-human Ig (Dako, Glostrup, Denmark) and streptavi-
din-peroxidase (SA-HRP; Sigma) and tetramethylbenzidine
substrate reagent and quantified by measuring the absor-
bance at 450 nm.
Bioassays for the binding and cross-linking of the
extracellular domains of VEGFR-1 and VEGFR-2
Bioassays for monitoring the binding and cross-linking of
VEGFR-1 and VEGFR-2, using BaF3-derived cell lines
expressing chimeric receptors consisting of the extracellular,
ligand-binding domains of human VEGFR-1 or mouse
VEGFR-2 and the transmembrane and cytoplasmic
domains of the erythropoietin receptor, were carried out as
previously described [26,27]. Briefly, the bioassay cell lines
were incubated with various concentrations of purified
growth factors for 48 h at 37 °C. DNA synthesis was quan-
tified by measuring [
3
H]thymidine incorporation during a
further 16 h incubation.
Chemotaxis assay
Chemotaxis assays using THP-1 monocytes were carried
out in 24-well plates containing TranswellÒ inserts of 5 lm
pore size (Corning Costar, Corning, NY, USA), as previ-
ously described [8]. Briefly, monocytes were loaded into

inserts with various concentrations of purified growth fac-
tor in the bottom compartment and then incubated for 6 h
at 37 °C. Nonmigrated cells were removed from the upper
side of the filter membrane and the adherent cells on the
lower side were fixed in gluteraldehyde then stained using
Gill’s hemotoxylin. For a quantitative assessment of
migrated cells, a total of four fields of ·40 magnification
from two different wells was counted.
Enzymatic removal of O-linked glycosylation
from ORFV
NZ2
VEGF
Purified protein (150 lg) was diluted in 0.05 m sodium
phosphate buffer (pH 7) containing 0.1% SDS. Twenty mU
of sialidase and 25 mU of O-glycosidase was added and the
mixture was incubated at 37 °C for 3 h. The protein was
then re-purified and quantitated, as previously described
[15].
Statistical analysis
Statistical analysis was performed using analysis of variance
(single factor anova) with significant points of difference
(P £ 0.05) determined using Tukey’s test.
M. K. Inder et al. Role of viral VEGF’s C-terminus in VEGFR binding
FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS 215
Acknowledgements
This study was partially supported by the Health
Research Council of New Zealand. Lyn Wise was sup-
ported in part by the University of Otago Health
Sciences Career Development Program Postdoctoral
Fellowship Award. We thank Nicola Real for expert

technical assistance.
References
1 Carmeliet P (2005) VEGF as a key mediator of angio-
genesis in cancer. Oncology 69(Suppl. 3), 4–10.
2 Ferrara N (2004) Vascular endothelial growth factor:
basic science and clinical progress. Endocrin Rev 25,
581–611.
3 McColl BK, Stacker SA & Achen MG (2004) Molecu-
lar regulation of the VEGF family – inducers of angio-
genesis and lymphangiogenesis. APMIS 112, 463–480.
4 Olsson AK, Dimberg A, Kreuger J & Claesson-Welsh L
(2006) VEGF receptor signalling – in control of vascu-
lar function. Nat Rev Mol Cell Biol 7, 359–371.
5 Shibuya M & Claesson-Welsh L (2006) Signal transduc-
tion by VEGF receptors in regulation of angiogenesis
and lymphangiogenesis. Exp Cell Res 312, 549–560.
6 Zachary I (2003) VEGF signalling: integration and
multi-tasking in endothelial cell biology. Biochem Soc
Trans 31, 1171–1177.
7 Delhon G, Tulman ER, Afonso CL, Lu Z, delaConcha-
Bermejillo A, Lehmkuhl HD, Piccone ME, Kutish GF
& Rock DL (2004) Genomes of the parapoxvirus orf
virus and bovine papular stomatitis virus. J Virol 78,
168–177.
8 Inder MK, Ueda N, Mercer AA, Fleming SB & Wise
LM (2007) Bovine papular stomatitis virus encodes a
functionally distinct VEGF that binds both VEGFR-1
and VEGFR-2. J Gen Virol 88, 781–791.
9 Lyttle DJ, Fraser KM, Fleming SB, Mercer AA & Rob-
inson AJ (1994) Homologs of vascular endothelial

growth factor are encoded by the poxvirus orf virus.
J Virol 68, 84–92.
10 Mercer AA, Wise LM, Scagliarini A, McInnes CJ,
Buettner M, Rhiza HJ, McCaughan CA, Fleming SB,
Ueda N & Nettleton PF (2002) Vascular endothelial
growth factors encoded by Orf virus show surprising
sequence variation but have a conserved, functionally
relevant structure. J Gen Virol 83, 2845–2855.
11 Meyer M, Clauss M, Lepple-Wienhues A, Waltenberger
J, Augustin HG, Ziche M, Lanz C, Buttner M, Rziha
HJ & Dehio C (1999) A novel vascular endothelial
growth factor encoded by Orf virus, VEGF-E, mediates
angiogenesis via signalling through VEGFR-2 (KDR)
but not VEGFR-1 (Flt-1) receptor tyrosine kinases.
EMBO J 18, 363–374.
12 Ogawa S, Oku A, Sawano A, Yamaguchi S, Yazaki Y
& Shibuya M (1998) A novel type of vascular endothe-
lial growth factor, VEGF-E (NZ-7 VEGF), preferen-
tially utilizes KDR ⁄ Flk-1 receptor and carries a potent
mitotic activity without heparin-binding domain. J Biol
Chem 273, 31273–31282.
13 Ueda N, Inder MK, Wise LM, Fleming SB & Mercer
AA (2007) Parapoxvirus of red deer in New Zealand
encodes a variant of viral vascular endothelial growth
factor. Virus Res 124, 50–58.
14 Ueda N, Wise LM, Stacker SA, Fleming SB & Mercer
AA (2003) Pseudocowpox virus encodes a homolog of
vascular endothelial growth factor. Virology 305, 298–
309.
15 Wise LM, Ueda N, Dryden NH, Fleming SB, Caesar

C, Roufail S, Achen MG, Stacker SA & Mercer AA
(2003) Viral vascular endothelial growth factors vary
extensively in amino acid sequence, receptor-binding
specificities and the ability to induce vascular permeabil-
ity yet are uniformLy active mitogens. J Biol Chem 278,
38004–38024.
16 Wise LM, Veikkola T, Mercer AA, Savory LJ, Fleming
SB, Caesar C, Vitali A, Makinen T, Alitalo K &
Stacker SA (1999) Vascular endothelial growth factor
(VEGF)-like protein from orf virus NZ2 binds to
VEGFR2 and neuropilin-1. Proc Natl Acad Sci USA
96, 3071–3076.
17 Haig DM & Mercer AA (1998) Ovine diseases. Orf. Vet
Res 29, 311–326.
18 Mercer A, Fleming S, Robinson A, Nettleton P & Reid
H (1997) Molecular genetic analyses of parapoxviruses
pathogenic for humans. Arch Virol Suppl 13, 25–34.
19 Groves RW, Wilson-Jones E & MacDonald DM (1991)
Human orf and milkers’ nodule: a clinicopathologic
study. J Am Acad Dermatol 25, 706–711.
20 Horner GW, Robinson AJ, Hunter R, Cox BT & Smith
R (1987) Parapoxvirus infections in New Zealand
farmed red deer (Cervus elaphus). NZ Vet J 35, 41–45.
21 Nagington J, Lauder IM & Smith JS (1967) Bovine
papular stomatitis, pseudocowpox and milker’s nodules.
Vet Rec 81, 306–313.
22 Pieren M, Prota A, Ruch C, Kostrewa D, Wagner A,
Biedermann K, Winkler F & Ballmer-Hofer K (2006)
Crystal structure of the Orf virus NZ2 variant of vascu-
lar endothelial growth factor-E. J Biol Chem 281,

19578–19587.
23 Keyt B, Nguyen H, Berleau L, Duarte C, Park J, Chen
H & Ferrara N (1996) Identification of vascular endo-
thelial growth factor determinants for binding KDR
and Flt-1 receptors. J Biol Chem 271, 5638–5646.
24 Li B, Fuh G, Meng G, Xin X, Gerritsen M, Cunning-
ham B & deVos A (2000) Receptor-selective variants of
human vascular endothelial growth factor. J Biol Chem
275, 29823–29828.
Role of viral VEGF’s C-terminus in VEGFR binding M. K. Inder et al.
216 FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS
25 Kiba A, Yabana N & Shibuya M (2003) A set of Loop-
1 and -3 structures in the novel vascular endothelial
growth factor (VEGF) family member, VEGF-E NZ7,
is essential for the activation of VEGFR-2 signalling.
J Biol Chem 278, 13453–13461.
26 Makinen T, Veikkola T, Mustjoki S, Karpanen T, Cati-
mel B, Nice EC, Wise LM, Mercer A, Kowalski J, Ker-
ajaschki D et al. (2001) Isolated, lymphatic endothelial
cells transduce growth, survival and migratory signals
via the VEGF-C ⁄ D receptor VEGFR-3. EMBO J 20,
4762–4773.
27 Stacker SA, Vitali A, Caesar C, Domagala T, Groenen
LC, Nice E, Achen MG & Wilks AF (1999) A mutant
form of vascular endothelial growth factor (VEGF) that
lacks VEGF receptor-2 activation retains the ability to
induce vascular permeability. J Biol Chem 274, 34884–
34892.
28 Clauss M, Weich H, Breier G, Knies U, Rockl W,
Waltenberger J & Risau W (1996) The vascular endo-

thelial growth factor receptor Flt-1 mediates biological
activities. Implications for a functional role of placenta
growth factor in monocyte activation and chemotaxis.
J Biol Chem 271, 17629–17634.
29 Selvaraj SK, Giri RK, Perelman N, Johnson C, Malik
P & Kalra VK (2003) Mechanism of monocyte activa-
tion and expression of proinflammatory cytochemokines
by placenta growth factor. Blood 102, 1515–1524.
30 Shibuya M (2001) Structure and dual function of vascu-
lar endothelial growth factor receptor-1 (Flt-1). Int J
Biochem Cell Biol 33, 409–420.
31 Muller YA, Li B, Christinger HW, Wells JA, Cunning-
ham BC & de Vos AM (1997) Vascular endothelial
growth factor: crystal structure and functional mapping
of the kinase domain receptor binding site. Proc Natl
Acad Sci USA 94, 7192–7197.
32 Wiesmann C, Fuh G, Christinger HW, Eigenbrot C,
Wells JA & de Vos AM (1997) Crystal structure at
17 A
˚
resolution of VEGF in complex with domain 2 of
the Flt-1 receptor. Cell 91, 695–704.
33 Autiero M, Luttun A, Tjwa M & Carmeliet P (2003)
Placental growth factor and its receptor, vascular endo-
thelial growth factor receptor-1: novel targets for stimu-
lation of ischemic tissue revascularization and inhibition
of angiogenic and inflammatory disorders. J Thromb
Haemost 1, 1356–1370.
34 Gabrilovich D, Ishida T, Oyama T, Ran S, Kravtsov V,
Nadaf S & Carbone DP (1998) Vascular endothelial

growth factor inhibits the development of dendritic cells
and dramatically affects the differentiation of multiple
hematopoietic lineages in vivo. Blood 92, 4150–4166.
35 Kiba A, Sagara H, Hara T & Shibuya M (2003) VEG-
FR-2-specific ligand VEGF-E induces non-edematous
hyper-vascularization in mice. Biochem Biophys Res
Commun 301, 371–377.
36 Savory LJ, Stacker SA, Fleming SB, Niven BE & Mer-
cer AA (2000) Viral vascular endothelial growth factor
plays a critical role in orf virus infection. J Virol 74,
10699–10706.
37 Julenius K, Molgaard A, Gupta R & Brunak S (2005)
Prediction, conservation analysis and structural charac-
terization of mammalian mucin-type O-glycosylation
sites. Glycobiology 15, 153–164.
M. K. Inder et al. Role of viral VEGF’s C-terminus in VEGFR binding
FEBS Journal 275 (2008) 207–217 ª 2007 The Authors Journal compilation ª 2007 FEBS 217