Báo cáo khoa học: Characterization of thermostable aminoacylase from hyperthermophilic archaeon Pyrococcus horikoshii pot

Characterization of thermostable aminoacylase from
hyperthermophilic archaeon Pyrococcus horikoshii
Koichi Tanimoto
1
, Noriko Higashi
1
, Motomu Nishioka
1
, Kazuhiko Ishikawa
2
and Masahito Taya
1
1 Division of Chemical Engineering, Graduate School of Engineering Science, Osaka University, Japan
2 Research Institute for Cell Engineering, National Institute of Advanced Industrial Science and Technology (AIST), Osaka, Japan
Today, many kinds of enzyme are used to manufac-
ture commercial products in various fields, such as
the food, chemical and pharmaceutical industries.
Compared with their chemically conducted counter-
parts, enzymatic reactions have several advantages in
selectivity and specificity, as well as environmental
load and operational safety [1]. However, enzymatic
reactions need to be practiced under mild conditions
of temperature and pH, because of instability of the
enzymes. In the past two decades, thermostable
enzymes found in many hyper- or extreme thermo-
philes have been studied intensively in an attempt to
overcome the limitation in application of enzymatic
reactions. Previous studies have demonstrated that
most hyperthermophile-originating enzymes show
high stability to extreme pH conditions and organic
solvents, in addition to durability against high

temperature [2]. In general, reactions performed at
relatively high temperature have certain advantages,
such as extended availability of less water-soluble
substrates, decreased viscosity of reaction solutions
and increased diffusibility of substrates or products.
Keywords
aminoacylase; hyperthermophilic archaeon;
metal ligand; Pyrococcus horikoshii;
substrate specificity
Correspondence
M. Taya, Division of Chemical Engineering,
Graduate School of Engineering Science,
Osaka University, 1–3 Machikaneyama-cho,
Toyonaka, Osaka 560-8531, Japan
Fax: +81 6 6850 6254
Tel: +81 6 6850 6251
E-mail:
(Received 6 November 2007, revised
5 January 2008, accepted 7 January 2008)
doi:10.1111/j.1742-4658.2008.06274.x
The gene encoding putative aminoacylase (ORF: PH0722) in the genome
sequence of a hyperthermophilic archaeon, Pyrococcus horikoshii, was
cloned and overexpressed in Escherichia coli. The recombinant enzyme was
determined to be thermostable aminoacylase (PhoACY), forming a
homotetramer. Purified PhoACY showed the ability to release amino acid
molecules from the substrates N-acetyl-l-Met, N-acetyl-l-Gln and
N-acetyl-l-Leu, but had a lower hydrolytic activity towards N-acetyl-l-Phe.
The kinetic parameters K
m
and k

cat
were determined to be 24.6 mm and
370 s
)1
, respectively, for N-acetyl-l-Met at 90 °C. Purified PhoACY con-
tained one zinc atom per subunit. EDTA treatment resulted in the loss of
PhoACY activity. Enzyme activity was fully recovered by the addition of
divalent metal ions (Zn
2+
,Mn
2+
and Ni
2+
), and Mn
2+
addition caused
an alteration in substrate specificity. Site-directed mutagenesis analysis and
structural modeling of PhoACY, based on Arabidopsis thaliana indole-3-
acetic acid amino acid hydrolase as a template, revealed that, amongst the
amino acid residues conserved in PhoACY, His106, Glu139, Glu140 and
His164 were related to the metal-binding sites critical for the expression of
enzyme activity. Other residues, His198 and Arg260, were also found to be
involved in the catalytic reaction, suggesting that PhoACY obeys a similar
reaction mechanism to that proposed for mammalian aminoacylases.
Abbreviations
AcMet, N-acetyl-
L-methionine; AcPhe, N-acetyl-L-phenylalanine; AfaACY, Alcaligenes faecalis strain DA1 D-aminoacylase; AthIAAH,
Arabidopsis thaliana indole-3-acetic acid amino acid hydrolase; BsbAH, Bacillus subtilis putative amidohydrolase; BstACY,
Bacillus stearothermophilus aminoacylase; hACY1, human aminoacylase-1; ICP-OES, inductively coupled plasma-optical emission
spectrometry; pACY1, porcine aminoacylase-1; PfuACY, Pyrococcus furiosus aminoacylase; PhoACY, Pyrococcus horikoshii aminoacylase;

PhoCP, Pyrococcus horikoshii carboxypeptidase; PseCP, Pseudomonas sp. strain RS-16 carboxypeptidase; PSSM, position-specific scoring
matrix; SsoCP, Sulfolobus solfataricus carboxypeptidase; TkoACY, Thermococcus kodakaraensis aminoacylase; TliACY, Thermococcus litralis
aminoacylase.
1140 FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS
Aminoacylase (EC 3.5.1.14) is one of the most
important enzymes for industrial applications and lib-
erates enantioselectively l-amino acid from a corre-
sponding N-acyl-amino acid racemate [3]. Methionine,
alanine and phenylalanine are produced using amino-
acylase on a commercial scale [4–7]. Aminoacylase is
an essential enzyme found in almost all organisms, and
many of these enzymes are classified into the M20
family of metallopeptidases [4,8–11]. In hyperthermo-
philes, several enzymes showing aminoacylase activity
have been identified [5,12,13], but, to our knowledge,
few reports have dealt with the amino acid residues
involved in metal binding. Information on the struc-
ture and catalytic mechanism of thermostable amino-
acylase will help in the development of valuable
enzymes and their modified variants for industrial utili-
zation.
The work reported here describes the successful
expression of active aminoacylase from a hyperthermo-
philic archaeon, Pyrococcus horikoshii [14], in Escheri-
chia coli to characterize the enzymatic properties in
terms of substrate specificity, stability and kinetics. In
addition, the amino acid residues for metal binding
were identified by site-directed mutagenesis, and the
metal-binding domain and catalytic mechanism of ami-
noacylase are discussed on the basis of a constructed

structural model.
Results
Identification of recombinant aminoacylase
from P. horikoshii
Amongst thermophilic microorganisms, several ther-
mostable enzymes exhibiting aminoacylase activity
have been identified and characterized [5,7,12,13]. A
hyperthermophilic archaeon, P. horikoshii, has been
reported to produce a bifunctional carboxypepti-
dase ⁄ aminoacylase (PhoCP ⁄ ACY), whereas Thermo-
coccus litralis and Pyrococcus furiosus have been
demonstrated to produce an aminoacylase [5,12]. In
the genome database of P. horikoshii (DDBJ, http://
www.ddbj.nig.ac.jp/, as of June 2007), an alternative
candidate for the aminoacylase gene (PH0722, Uni-
ProtKB O58453) has been annotated as a putative
amino acid amidohydrolase, as suggested in a previous
report [12].
Figure 1 shows the alignment of the amino acid
sequence of the gene (PH0722) from P. horikoshii,
together with those of P. furiosus aminoacylase
(PfuACY, 82% homology) [12], Thermococcus kodaka-
raensis aminoacylase ( TkoACY, 72% homology)
(UniProtKB Q5JD73), P. horikoshii carboxypepti-
dase ⁄ aminoacylase (PhoCP ⁄ ACY, 58% homology)
[13], Thermococcus litralis aminoacylase (TliACY, 55%
homology) [5], Sulfolobus solfataricus carboxypeptidase
(SsoCP, 40% homology) [15], Bacillus stearothermophi-
lus aminoacylase (BstACY, 34% homology) [7], Bacil-
lus subtilis putative amidohydrolase (BsbAH, 39%

homology) (UniProtKB P54955) and Arabidopsis
thaliana indole-3-acetic acid amino acid hydrolase
(AthIAAH, 45% homology) (UniProtKB P54970).
These enzymes are classified into the M20 family of
metallopeptidases, in which zinc is included as an
essential metal for the catalytic activity [16,17]. The
alignments clearly demonstrate that the sequences of
these enzymes share highly conserved regions, espe-
cially in the vicinity of Cys104, His106, Glu139,
Glu140, His164 and His361 (indicated by the positions
in the PhoACY sequence), which have been reported
to be the amino acid residues related to metal binding
from mutational analysis [18] and structural informa-
tion from BsbAH [Protein Data Bank (PDB) ID:
1YSJ]. With regard to functionally related enzymes
with available structural information, the carboxypep-
tidase from Pseudomonas sp. strain RS-16 (PseCP,
PDB ID: 1CG2) and the d-aminoacylase from Alcali-
genes faecalis strain DA1 (
AfaACY, PDB ID: 1V4Y)
exhibit 19% and 15% homology, respectively, to
PhoACY.
In this study, the gene (PH0722) was overexpressed
in E. coli cells using the pET-11a expression system to
confirm whether it encodes a protein with enzymatic
function. The recombinant protein was successfully
produced in a soluble form and the purified enzyme
showed a molecular mass of 42 kDa as a single poly-
peptide on SDS-PAGE, in accordance with the molec-
ular mass estimated from the amino acid sequence.

Amongst the aminoacylases and carboxypeptidases
that belong to the M20 family of metallopeptidases,
most enzymes are known to exist in a dimeric form
[9,19–22]. HPLC gel filtration demonstrated that the
molecular mass of PhoACY under native conditions
was approximately 165 kDa, indicating that PhoACY
forms a homotetrameric structure.
Catalytic properties of PhoACY
The enzyme encoded by the cloned gene was expected
to be a thermostable aminoacylase (PhoACY), and the
activity of recombinant PhoACY at various pH values
and temperatures was measured using N-acetyl-
l-methionine (AcMet) as a substrate. The pH depen-
dence of the activity was examined in the range
pH 6.0–8.5, and the maximum activity was observed at
pH 7.5 (Fig. 2A). The effect of temperature on the
K. Tanimoto et al. Characterization of thermostable aminoacylase
FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS 1141
activity was also determined in the range 60–100 °Cat
pH 7.5, and the optimum activity was observed in the
vicinity of 90 °C. The activity at 60 °C fell to less than
one-half of the activity at the optimum condition
(Fig. 2B). Figure 3 shows the thermostability of
PhoACY at 75, 85 and 90 °C for the indicated time
periods at pH 7.5. From the slopes of the lines, the
half-lives of the enzyme were estimated to be 217, 119
and 72 min at 75, 85 and 90 °C, respectively. It should
be noted that no substantial loss in activity was
observed during the examined period when zinc ions
(0.1 mm) were present in the enzyme solution.

The substrate specificity of PhoACY was examined
with respect to various N-acetyl-l-amino acid com-
pounds. As shown in Table 1, the order of favorite
substrates was Met > Leu > Gln > Glu > Arg >
Ala > Asn > Phe = Gly, indicating that PhoACY
has a tendency to exhibit a high activity for amino
acids with long side chains. PfuACY and PhoCP ⁄ ACY
also show hydrolase activity against N-acetyl-l-amino
acid compounds in the order of preferred l-amino acid
moieties of Met > Ala = Asn > Glu > Leu for Pfu-
ACY [12] and Met > Phe > Ala > Trp > Gly for
PhoCP ⁄ ACY [13], which is rather different from that
of PhoACY.
The dependence of the reaction rate on substrate
concentration was examined for AcMet in the
range 1–100 mm, and the kinetic parameters were
estimated according to Michaelis–Menten kinetics
(Fig. 4). The value of the Michaelis constant for
Fig. 1. Alignment of amino acid sequences of P. horikoshii aminoacylase with aminoacylases from various sources and carboxypeptidases
from Sulfolobus solfataricus and P . horikoshii, amidohydrolase from Bacillus subtilis and indole-3-acetic acid hydrolase from A. thaliana. Iden-
tical residues are indicated by asterisks, and the residues with strong and weak similarity are shown by colons and full points, respectively.
The residues mutated in this work are indicated by filled circles. The abbreviations are as follows and the entry names of the protein data-
base are given in parentheses: PhoACY, P. horikoshii aminoacylase (PH0722) (this study, UniProtKB O58453); PfuACY, P. furiosus amino-
acylase (UniProtKB Q8U375); TkoACY, Thermococcus kodakaraensis aminoacylase (UniProtKB Q5JD73); PhoCP ⁄ ACY, P. horikoshii
carboxypeptidase ⁄ aminoacylase (UniProtKB O58754); TliACY, Thermococcus litoralis aminoacylase [5]; SsoCP, S. solfataricus carboxypepti-
dase (UniProtKB P80092); BstACY, Bacillus stearothermophilus aminoacylase (UniProtKB P37112); BsbAH, B. subtilis putative amidohydro-
lase (UniProtKB P54955); AthIAAH, A. thaliana indole-3-acetic acid amino acid hydrolase (UniProtKB P54970).
Characterization of thermostable aminoacylase K. Tanimoto et al.
1142 FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS
AcMet was high (K

m
= 24.6 mm) compared with that
of PhoCP ⁄ ACY, and the turnover number of PhoACY
(k
cat
= 370 s
)1
) was 10 times larger than that of
PhoCP ⁄ ACY, indicating that these two enzymes have
different kinetic characteristics as well as substrate
specificity. Substrate inhibition for PhoACY was
observed at an AcMet concentration above 40 mm,as
often reported for other aminoacylases [11,13].
Some aminoacylases are capable of cleaving dipep-
tide or tripeptide. TliACY can cleave the dipeptide
N-benzyloxycarbonyl-Phe-Gly, and PhoCP ⁄ ACY can
release the carboxyl-terminus amino acid residue from
di-, tri- and tetrapeptides, whereas PfuACY is not able
to hydrolyze N-formyl-Met-Phe, N-acetyl-Met-Ala and
N-acetyl-Met-Leu-Phe [12]. PhoACY can cleave the
examined dipeptides Ala-Ala and Phe-Ala, but cannot
release any amino acid monomer from the tripeptides
Ala-Ala-Ala and N-acetyl-Ala-Ala-Ala (data not
shown).
Effect of metal ions on PhoACY activity and
amino acid residues related to metal binding
and catalysis
Inductively coupled plasma-optical emission spectro-
metry (ICP-OES) demonstrated that PhoACY contained
6 6.5 7 7.5 8 8.5

0
20
40
60
80
100
A
B
60 70 80 90 100
20
40
60
80
100
pH
Relative enzyme activityRelative enzyme activity
pH: 7.5
Temperature: 90 °C
Temperature (°C)
Fig. 2. Effects of pH (A) and temperature (B) on the activity of
PhoACY.
Incubation time (min)
Residual activity
pH = 7.5
0 30 60 90 120 150 180
0.2
0.4
0.6
0.8
1

Fig. 3. Thermostability of PhoACY. The enzyme was incubated at
75 (
), 85 ( ) and 90 °C(d) in the absence of Zn
2+
and 90 °Cin
the presence of 0.1 m
M Zn
2+
(s).
Table 1. Substrate specificity of PhoACY. The substrate concentra-
tion was 30 m
M. Mn-PhoACY was prepared by EDTA treatment
and subsequent addition of 1 m
M Mn
2+
.
Substrate
Specific activity (UÆmg
)1
)
Untreated PhoACY Mn-PhoACY
N-acetyl-
L-Met 256 239
N-acetyl-
L-Leu 133 134
N-acetyl-
L-Gln 131 208
N-acetyl-
L-Glu 92 56
N-acetyl-

L-Arg 61 116
N-acetyl-
L-Ala 38 47
N-acetyl-
L-Asn 18 68
N-acetyl-
L-Phe 13 69
N-acetyl-
L-Gly 13 19
10 0 0.1 0.2 0.3
0.01
0.02
0.03
0.09
0.1
1/v (min·nmol
–1
)
1/s (mM
–1
)
Fig. 4. Double reciprocal plots of enzyme reaction rate (v) versus
AcMet concentration (s) for untreated PhoACY (d) and Mn-PhoACY
(
). Mn-PhoACY was prepared by EDTA treatment and subsequent
addition of 1 m
M Mn
2+
.
K. Tanimoto et al. Characterization of thermostable aminoacylase

FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS 1143
one zinc atom per subunit. The effect of metal chela-
tion on PhoACY activity was examined. The dialyzing
treatment of PhoACY with EDTA ⁄ Tris ⁄ HCl buffer
resulted in the loss of activity, as shown in Table 2.
The activity was fully restored by the addition of
10 mm of Zn
2+
,Mn
2+
or Ni
2+
to the reaction
mixture. The presence of Cu
2+
or Co
2+
was less
effective on the recovery of the activity, and Mg
2+
exerted no effect on the recovery. On addition of
Mn
2+
, the substrate specificity of EDTA-treated Pho-
ACY was altered, the order of favorite substrates
being Met > Gln > Leu > Arg > Phe = Asn >
Glu > Ala > Gly (Table 1). Moreover, under this
condition, the values of the Michaelis constant and
turnover number for AcMet were K
m

= 15.0 mm and
k
cat
= 381 s
)1
, respectively (Fig. 4), indicating that
Mn
2+
addition causes a change in affinity of PhoACY
to the substrate.
In zinc-containing SsoCP, with similarity to Pho-
ACY (40% homology), site-directed mutagenesis
revealed that residues His108, Asp109 and His168 were
zinc-binding ligands, and Glu142 interacted with a
water molecule as an acidic residue [18]. The corre-
sponding amino acid residues in PhoACY are His106,
Asp107, Glu139, Glu140 and His164. For Glu142 in
SsoCP, there are two possible corresponding amino
acid residues, Glu139 and Glu140, in PhoACY by
comparison of their amino acid sequences. As shown
in Table 3, the aminoacylase activities of mutants
H106A, E139Q, E140Q and H164A were decreased
below the limit of detection, and the zinc atom content
was approximately 1.5–2.0 times that of wild-type Pho-
ACY. By contrast, mutant D107N retained approxi-
mately 20% of the activity of wild-type PhoACY, and
the zinc content was equivalent to that in the wild-type
enzyme.
Some aminoacylases share other highly conserved
amino acid residues in addition to those for the zinc

ligands. Of these, we examined the contribution of
His198 and Arg260 to the enzyme activity of PhoACY.
The residues His206 in human aminoacylase-1
(hACY1) and His205 in porcine aminoacylase-1
(pACY1) are involved in enzyme activity through
interaction with an active site of the counter-subunit in
dimer formation [16,17,23]. When His198, a corre-
sponding residue in PhoACY, was substituted for ala-
nine, the activity of mutant H198A was completely
lost (Table 3). Arg260 in PhoACY is also a conserved
residue that is expected to be associated with substrate
binding to an active site through conformational
change, as proposed in hACY1 [23]. Mutant R260A of
PhoACY lost its enzyme activity (Table 3), as did the
mutant of hACY1.
Discussion
This work reports a novel thermostable aminoacylase,
PhoACY, identified in the hyperthermophilic archaeon
P. horikoshii. Recombinant PhoACY was obtained as
a soluble and active form.
Substrate specificity is an interesting property of
aminoacylases, and has been characterized extensively
in several aminoacylases, including those from thermo-
philic microorganisms. Aminoacylases from different
sources show a wide variety of substrate specificity for
amino acid moieties and acyl groups [5,12,13,24]. With
regard to the aminoacylases from hyperthermophiles,
the substrate specificities of PfuACY, TliACY and
PhoCP ⁄ ACY have been examined in detail. As in the
case of PhoACY, these three enzymes tend to prefer

AcMet, but the preference for other N-acetyl-l-amino
acids is different in spite of the high homology of their
amino acid sequences. For instance, N-acetyl-l-Phe
(AcPhe) is the most favorable substrate with an acetyl
group for TliACY, but PhoCP ⁄ ACY, which shows
Table 2. Effect of metal ions on the activity of PhoACY treated
with EDTA. The concentration of metal ion added was 1 m
M. ND,
not detectable.
Metal ion
Relative enzyme
activity (%)
Without treatment 100 (103
a
)
With treatment
No addition ND
Mg
2+
9
Cu
2+
9
Co
2+
34
Zn
2+
91
Mn

2+
154
Ni
2+
221
a
The activity was measured in the reaction mixture with the addi-
tion of 1 m
M Zn
2+
.
Table 3. Relative enzyme activities and zinc contents of various
mutants. ND, not detectable.
Enzyme
Relative enzyme
activity (%)
Zn
2+
content
Predicted role
in PhoACY
Wild-type 100 1.0 Zn
2+
ligand
H106A ND 1.3 Zn
2+
ligand
D107N 19 1.0 Zn
2+
ligand

E139Q ND 2.3 Zn
2+
ligand
E140Q ND 1.5 Zn
2+
ligand
H164A ND 1.9 Zn
2+
ligand
H198A ND – Catalysis
R260A ND – Catalysis
Characterization of thermostable aminoacylase K. Tanimoto et al.
1144 FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS
82% homology to TliACY, hydrolyzes AcPhe with
half of the activity obtained for AcMet. As shown in
Table 1, PhoACY shows a much lower activity for
AcPhe, which cannot be hydrolyzed by PfuACY.
In addition, some aminoacylases show an ability to
cleave dipeptides. PhoCP ⁄ ACY is a dipeptidase with a
higher specificity for the C-terminal carboxyl group
and a lower specificity for the acyl group. PhoACY
seems to be primarily an aminoacylase, but exhibits
peptidase activity towards a dipeptide substrate,
whereas TliACY and PfuACY show no peptidase
activity [5,12]. These observations suggest that amino
acid residues close to substrate binding and catalytic
sites make a great contribution to substrate specific-
ity, and that modification of amino acid residues in
these local sites may be useful to improve enzymatic
properties.

PhoACY belongs to the M20 family of metallopep-
tidases which contain one or two divalent metal ions,
usually Zn
2+
, in their subunits. The role of zinc ions is
still uncertain, although treatment with metal chelating
reagents results in the complete loss of activity of most
aminoacylases. It is known that TliACY activity is
inhibited by approximately 50% by treatment with
EDTA, but that metal-free TliACY still shows some
activity [5]. PhoACY treated with EDTA shows no
activity, but the activity can be entirely recovered in
the presence of Zn
2+
,Mn
2+
,Ni
2+
and, to a lesser
extent, Co
2+
. Although the activity of PfuACY treated
with EDTA can be restored by the addition of Zn
2+
or Co
2+
,Mn
2+
and Ni
2+

are inert additives, suggest-
ing that the coordination of the metal-binding sites in
these two enzymes may be different in spite of their
great similarity.
Although zinc involvement in the PhoACY molecule
is essential for its expression of aminoacylase activity,
the external addition of Zn
2+
to the reaction mixture
(1 mm) does not lead to elevated activity (Table 2). In
the presence of excess Zn
2+
, however, the thermosta-
bility of PhoACY is strongly enhanced (Fig. 3), sug-
gesting that additional Zn
2+
binding to PhoACY,
which may occur in a second metal-binding site,
induces a possible alteration in enzyme conformation
to improve the thermostability. Future research will
focus on the effect of external metal ions on the ther-
mal durability of PhoACY from an enzymological and
biotechnological aspect.
PhoACY whose Zn
2+
was exchanged for Mn
2+
(Mn-PhoACY) showed an altered substrate specificity.
A significant increase in activity for N-acetyl-l-Asn
and AcPhe substrates was observed for Mn-PhoACY,

whereas the activity for N-acetyl-l-Glu was reduced by
half, compared with untreated PhoACY, indicating
that the catalytic metal ions associated with the
enzyme have an effect on the affinity between enzyme
and substrate. This is also supported by the increase in
the K
m
value for AcMet in Mn-PhoACY despite a
small change in the k
cat
value. These findings suggest
that the substrate recognition of l-aminoacylases,
including PhoACY, is largely influenced by local dis-
tortion in the structures of the enzymes. Further
detailed examinations are needed to understand the
mechanisms which can dominate substrate specificities
in l-aminoacylases.
With regard to the amino acid residues related to
metal binding in SsoCP, His108, Asp109, Glu142 and
His168 have been identified as Zn
2+
ligands on the
basis of site-directed mutagenesis and computational
modeling [18]. In the case of PhoACY with mutation
in the corresponding residues, mutants H106A,
E139Q, E140Q and H164A lost their activities and
mutant D107N retained 20% of the activity of wild-
type PhoACY, whereas the zinc content of all
mutants did not decrease. In order to determine
whether these amino acid residues are close to a

putative metal-binding site, a molecular model of
PhoACY was predicted using the 3d-jigsaw program.
The model showed that the overall structure (Fig. 5A)
was very similar to the structure of BsbAH (PDB ID:
1YSJ), which has 39% homology to PhoACY and
two atoms of nickel in one subunit, and that the spa-
tial configuration of the amino acid residues related
to zinc binding (Fig. 5B) also resembled that of
BsbAH, pACY1 [17] and the zinc-binding domain of
the T347G mutant from hACY1 (PDB ID: 1Q7L)
[23], although His164 was replaced by a glutamic acid
residue in pACY1 and hACY1. In this model, the
residues His106, Glu139, Glu140 and His164 were
located close to each other and formed a metal-bind-
ing pocket, as found in the other aminoacylases, lead-
ing to the conclusion that these four residues are zinc
ligands. It is expected that, in PhoACY, the mutation
of one zinc ligand allows the local loosening of Zn
2+
and the intervention of another Zn
2+
in the metal-
binding pocket, resulting in the incorrect coordination
of Zn
2+
and a lack of aminoacylase activity. With
regard to the mutant D107N, the model showed that
Asp107 was not located in the metal-binding site.
Therefore, it is probable that Asp107 is not a zinc
ligand in PhoACY.

The molecular model of PhoACY and the three-
dimensional structural information of BsbAH also
predict a role of the cysteine residue at position 104,
which is one of the most conserved residues in vari-
ous aminoacylases. It has been reported that this cys-
teine residue is one of the key amino acids for
K. Tanimoto et al. Characterization of thermostable aminoacylase
FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS 1145
aminoacylase activity by site-directed mutagenesis and
chemical modification analyses, although its role in
activity is still unclear [13]. In the structure of
BsbAH, the distance between the cysteine residue and
the metal ions is approximately 2.4–2.6 A
˚
, which per-
mits a direct interaction. Likewise, in the structural
model of PhoACY, the cysteine residue occupies a
similar coordination position, suggesting that cysteine
at position 104 is an alternative Zn
2+
-associating
residue.
When PseCP, which is included in the M20 family
of metallopeptidases, was compared with PhoACY, the
structure of PseCP resembled that of PhoACY in the
overall shape and active site conformation in spite of
the low homology between the amino acid sequences.
The active site of PseCP contains two zinc atoms
bridged by a water molecule (which acts as an attack-
ing hydroxyl ion nucleophile), together with a glutamic

acid residue (Glu175 of PseCP) (which plays a role as
a general base in hydrolytic catalysis) [25]. The hydro-
lytic catalysis of l-aminoacylases, including PhoACY,
seems to obey a mechanism similar to that proposed in
pACY1, where the water molecule binding the zinc
metal and glutamic acid residue act as a nucleophile
and general base, respectively [17].
By contrast, in the case of d-aminoacylase, AfaACY
from Al. faecalis strain DA1 is quite different from
PhoACY in its overall structure. AfaACY includes one
catalytically essential Zn
2+
in its active site, but an
additional metal ion can be kept at a second metal-
binding site. According to the proposed catalytic
mechanism for d-aminoacylase, Asp366 of AfaACY
abstracts a proton from the water molecule; then, the
catalytically essential Zn
2+
polarizes the carbonyl–oxy-
gen bond to facilitate nucleophilic attack on the amide
carbon atom, leading to the formation of a tetrahedral
intermediate [26]. In the predicted mechanism for
l-aminoacylase, Glu146 accepts a proton from the
zinc-binding water and a hydroxide group attacks the
carbonyl–oxygen bond in a substrate polarized by
Arg348 to form the tetrahedral intermediate in pACY1
[17]. In this context, the hydrolysis of the amide bond
of the substrate occurs in a similar manner, but the
contribution of catalytically essential Zn

2+
to the reac-
tion is different between l- and d-aminoacylases. In
addition, the metal ion at the second position also
seems to have a different role in the two types of
aminoacylase. The presence of excess Zn
2+
causes no
inhibition of the activity in the case of PhoACY
(Table 2), but additional Zn
2+
can inhibit the enzyme
activity of AfaACY [27].
With regard to hACY1, Lindner et al. [23] have
proposed that Arg276 interacts with the substrate
accompanying a conformational change of the enzyme.
Arg276 corresponds to Arg260 in PhoACY, and this
residue is located in a similar manner to Arg276 in
hACY1, being apart from the active site in PhoACY.
The mutant R260A loses its enzyme activity, suggesting
AB
Fig. 5. Molecular model presentation of PhoACY and BsbAH. (A) Superimposition of PhoACY (blue) on BsbAH (PDB ID: 1YSJ) (yellow). The
model of PhoACY was based on the structure of AthIAAH (PDB ID: 1XMB). The nickel ions binding to BsbAH are shown by a pink sphere.
(B) Speculated zinc-binding domain of PhoACY. Zinc ion is shown by a pink sphere. The residues related to zinc binding are shown by the
balls and sticks.
Characterization of thermostable aminoacylase K. Tanimoto et al.
1146 FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS
that the same reaction mechanism exists in PhoACY
and hACY1. The mutant H198A also loses its enzyme
activity. The corresponding residues His206 in hACY1

and His205 in pACY1 are presumed to interact with
an active site of the counter-subunit of a dimeric struc-
ture [16,17,23]. The molecular model showed that
His198 is located in the vicinity of Arg260 in the coun-
ter-subunit (data not shown), suggesting that His198
can interact with an active site of the counter-subunit
with conformational change of the enzyme. The molec-
ular model prediction and mutagenesis experiments
support the view that PhoACY catalyzes the hydrolysis
of a carbon–nitrogen bond, according to a mechanism
similar to that proposed for hACY1 and pACY1,
although further work is needed to clarify the detailed
catalytic mechanism.
In conclusion, we have identified and characterized a
new thermostable aminoacylase from the hyperthermo-
philic archaeon P. horikoshii (PhoACY). Differences in
the substrate specificity between thermostable amino-
acylases were found in spite of the high similarity in
their amino acid sequences. The substrate specificity
could be altered by the replacement of Zn
2+
with
Mn
2+
. The site-directed mutagenesis and molecular
model predicted that four amino acid residues were
critical as zinc-binding ligands of PhoACY, and also
suggested that a common catalytic mechanism may
occur in archaeal and mammalian aminoacylases.
Experimental procedures

Bacteria, plasmids, medium and chemicals
E. coli JM109 and E. coli Rosetta (DE3) pLysS cells (Nov-
agen, Madison, WI, USA) were used as hosts for DNA
manipulation and overexpression of the cloned genes,
respectively. The plasmid carrying the DNA fragment con-
taining the PhoACY gene, PH0722 (NBRC G01-001-282),
was purchased from the Biological Resource Center
(NBRC) at the National Institute of Technology and Eval-
uation (NITE) (Kisarazu, Japan). Luria–Bertani (LB) med-
ium was used for the cultures of E. coli strains.
Substrates for the enzymatic reaction were obtained from
Sigma-Aldrich Inc. (St Louis, MO, USA), Wako Pure
Chemical Industries, Ltd. (Osaka, Japan) and Peptide Insti-
tute Inc. (Minoh, Japan). All of the other chemicals were
of analytical grade.
Cloning and overexpression of the PhoACY gene
The gene of PhoACY was amplified using the following
two primers (forward primer, 5¢-GCGGAATTCCA
TATGTTGGTGGAAGTCCA-3¢; reverse primer, 5¢-GAA
GATCTAACCTTTGAAGTTGAAAGC-3¢; NdeI and BglII
sites in italic type) from template DNA. Amplification by
PCR was carried out using KOD Plus DNA polymerase
(Toyobo Co. Ltd, Osaka, Japan) according to the manufac-
turer’s instructions with minor modifications. The amplified
DNA fragment was digested by the restriction enzymes and
inserted into a pET-11a vector (Merck KGaA, Darmstadt,
Germany) digested by NdeI and BamHI. The DNA
sequence was confirmed using a DNA autosequencer (ABI
PRISM 310 genetic analyzer; Applied Biosystems, Foster
City, CA, USA).

The transformants were grown in LB medium containing
1mm ZnCl
2
and 50 lgÆmL
)1
ampicillin at 37 °C. After
incubation with shaking at 37 °C until the absorbance at
600 nm reached around 0.6, an inducer (isopropyl thio-b-
d-galactopyranoside) was added to the culture at a final
concentration of 1 mm, and the culture lasted for 6 h. The
cells were harvested by centrifugation (8000 g for 20 min)
and frozen at ) 30 °C.
Purification of the recombinant enzyme
The cells were resuspended in 50 mm Tris ⁄ HCl buffer
(pH 8.0) and disrupted by ultrasonication. The crude
extract was heated at 85 °C for 30 min and the supernatant
was recovered by centrifugation (20 000 g for 10 min).
After dialysis against 50 mm Tris ⁄ HCl buffer (pH 8.0), the
crude enzyme was loaded on to a HiTrap Q column (GE
Healthcare UK Ltd., Little Chalfont, UK). The column
was washed with the same buffer and eluted with a linear
NaCl gradient. The fractions containing protein with a
molecular mass expected from the amino acid sequence of
the enzyme were pooled and loaded again on to a HiTrap
Phenyl HP column (GE Healthcare UK Ltd.), followed by
elution with 50 mm Tris ⁄ HCl buffer (pH 8.0) with a linear
Na
2
SO
4

gradient. The fractions exhibiting a single band,
with a molecular mass of 42 kDa determined by SDS-
PAGE, were collected. The concentration of protein was
determined using a protein assay kit (BioRad Laboratories,
Inc., Hercules, CA, USA) with bovine serum albumin as a
standard.
The molecular mass of the enzyme was determined using
SDS-PAGE. The molecular mass of the enzyme in a native
form was also determined by HPLC, employing a TSK Gel
G3000SWXL column (Tosoh Corp., Tokyo, Japan), with
elution using 50 mm Tris ⁄ HCl buffer containing 0.4 m NaCl.
Enzyme assay
Aminoacylase activity was measured by detecting l-amino
acid cleaved from N-acyl-l-amino acid using the colorimet-
ric ninhydrin method [28]. In a routine assay, unless other-
wise noted, the reaction mixture (990 lL) containing
10 mm AcMet in 50 mm sodium phosphate buffer (pH 7.5)
K. Tanimoto et al. Characterization of thermostable aminoacylase
FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS 1147
was heated in advance at 90 °C for 5 min, and then the
enzyme solution (10 lL) was added to the mixture just
before starting the reaction at 90 °C for 5 min. The reac-
tion mixture was cooled on ice, and 200 l L ninhydrin
reagent was added to 400 lL of the reaction mixture, fol-
lowed by heating at 100 °C for 15 min. After cooling the
solution on ice, 1 mL of 70% ethanol was added to the
solution and the absorbance at 570 nm was measured.
The amount of methionine produced was determined from
a calibration line drawn with the authentic amino acid. A
blank test was also performed in the absence of the enzyme.

In the enzyme reactions with other substrates, the l-amino
acids released were likewise quantified from their respective
calibration lines using the corresponding amino acids. One
unit of aminoacylase activity (U) was defined as the
amount of enzyme which hydrolyzed 1 lmol of l-amino
acid per minute.
The thermostability of the enzyme was examined by
keeping the enzyme in 50 mm Tris ⁄ HCl buffer (pH 8.0) at
the indicated temperature. An aliquot of the enzyme solu-
tion was withdrawn at the prescribed time and cooled
immediately on ice. The residual activity of the enzyme was
measured according to the routine assay, as mentioned
above.
Effect of metal ions on PhoACY activity
The enzyme solution was dialyzed against an approximate
300-fold volume of 50 mm Tris ⁄ HCl buffer (pH 8.0) con-
taining 20 mm EDTA (disodium salt) for 6 h at 4 °Cto
prepare the metal-free enzyme, followed by further dialysis
against 50 mm Tris ⁄ HCl buffer (pH 8.0) for 6 h at 4 °Cto
remove EDTA from the solution. The enzyme activity was
measured by the routine assay in the presence of the indi-
cated metal ions. The bound metal ions in the purified
enzymes were analyzed by ICP-OES (ULTIMA2, Horiba
Jobin Yvon Inc., Edison, NJ, USA) at Tsukuba Technical
Center at the National Institute of Advanced Industrial Sci-
ence and Technology (AIST).
Preparation of mutants
Site-directed mutation was introduced to the enzyme by an
overlap extension PCR method [29] using the primers listed
in Table 4. The overexpression and purification of the

mutant enzymes were performed using the same methods as
employed for the wild-type enzyme.
Homology modeling of PhoACY
The optimized homology model of PhoACY was constructed
using the automated homology modeling program 3d-jig-
saw ( [30]. This
program searched parent sequences from the Protein Data
Bank using the program psi-blast, and then AthIAAH
(46% identity, PDB ID: 1XMB) was selected as a template
for PhoACY. Next, the position-specific scoring matrix
(PSSM) of PhoACY and AthIAAH sequences was calculated
from the psi-blast analysis, and the PSSM obtained was
used for the prediction of secondary structure by the
program psipred. After picturing the alignments of target
(PhoACY) to parent (AthIAAH) structures, the selection of
loops, complete backbone and side-chain rotamers and the
energy refinement of the modeling structure were performed
in series by the program modules installed in 3d-jigsaw.
Acknowledgements
The authors wish to thank Dr Noritake Yasuoka
(Emeritus Professor of Himeji Institute of Technology)
for helpful advice in building the homology model,
and Dr Kim Han-Woo (AIST) for technical support in
the HPLC analysis.
References
1 Schulze B & Wubbolts MG (1999) Biocatalysis for
industrial production of fine chemicals. Curr Opin
Biotechnol 10, 609–615.
2 Huber H & Stetter KO (1998) Hyperthermophiles and
their possible potential in biotechnology. J Biotechnol

64, 39–52.
3 Birnbaum SM, Levintow L, Kingsley RB & Greenstein
JP (1952) Specificity of amino acid acylases. J Biol
Chem 194, 455–470.
4 Koreishi M, Asayama F, Imanaka H, Imamura K,
Kadota M, Tsuno T & Nakanishi K (2005) Purification
and characterization of a novel aminoacylase from
Streptomyces mobaraensis. Biosci Biotechnol Biochem
69, 1914–1922.
5 Toogood HS, Hollingsworth EJ, Brown RC, Taylor IN,
Taylor SJ, McCague R & Littlechild JA (2002) A thermo-
stable l-aminoacylase from Thermococcus litoralis : clon-
ing, overexpression, characterization, and applications in
biotransformations. Extremophiles 6, 111–122.
Table 4. Forward primers for the mutagenesis of the PhoACY
gene. The italic type shows the nucleotides that were altered to
introduce the desired mutations.
Mutant Oligonucleotide sequence (5¢-to3¢)
H106A CATGCTTGTGGTGCCGACGCCCACACA
D107N GCTTGTGGTCACAACGCCCACACAGCA
E139Q TTCCAGCCTGCTCAAGAGGGAGGAAAT
E140Q CAGCCTGCTGAACAGGGAGGAAATGGA
H164A ATCTTTGGGATCGCCGTGTGGGCCGAG
H198A GGGAAGGGAGGTGCCGGAGCAGCACCT
R260A GAAGGGACATTCGCATTCTTTACCCAG
Characterization of thermostable aminoacylase K. Tanimoto et al.
1148 FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS
6 Tewari YB (1990) Thermodynamics of industrially-
important, enzyme-catalyzed reactions. Appl Biochem
Biotechnol 23, 187–203.

7 Sakanyan V, Desmarez L, Legrain C, Charlier D, Mett
I, Kochikyan A, Savchenko A, Boyen A, Falmagne P,
Pierard A, et al. (1993) Gene cloning, sequence analysis,
purification, and characterization of a thermostable
aminoacylase from Bacillus stearothermophilus. Appl
Environ Microbiol 59, 3878–3888.
8 Curley P, Does C, Driessen AJM, Kok J & Sinderen D
(2003) Purification and characterization of a lactococcal
aminoacylase. Arch Microbiol 179, 402–408.
9 Yang YB, Hu HL, Chang MC, Li H & Tsai YC (1994)
Purification and characterization of l-aminoacylase
from Alcaligenes denitrificans DA181. Biosci Biotechnol
Biochem 58, 204–205.
10 Lin LL, Chen MH, Chen HCR, Kan SC, Chen CC,
Hu HY & Hsu WH (2007) Characterization of a
bifunctional aminoacylase ⁄ carboxypeptidase from
radioresistant bacterium Deinococcus radiodurans R1.
J Biotechnol 128, 322–334.
11 Javid-Majd F & Blanchard JS (2000) Mechanistic anal-
ysis of the argE-encoded N-acetylornithine deacetylase.
Biochemistry 39, 1285–1293.
12 Story SV, Grunden AM & Adams MWW (2001) Char-
acterization of an aminoacylase from the hyperthermo-
philic archaeon Pyrococcus furiosus. J Bacteriol 183,
4259–4268.
13 Ishikawa K, Ishida H, Matsui I, Kawarabayasi Y &
Kikuchi H (2001) Novel bifunctional hyperthermostable
carboxypeptidase ⁄ aminoacylase from Pyrococcus hori-
koshii OT3. Appl Environ Microbiol 67, 673–679.
14 Gonzalez JM, Masuchi Y, Robb FT, Ammerman JW,

Maeder DL, Yanagibayashi M, Tamaoka J & Kato C
(1998) Pyrococcus horikoshii sp. nov., a hyperthermo-
philic archaeon isolated from a hydrothermal vent at
the Okinawa Trough. Extremophiles 2, 123–130.
15 Colombo S, Toietta G, Zecca L, Vanoni M & Tortora P
(1995) Molecular cloning, nucleotide sequence, and
expression of a carboxypeptidase-encoding gene from
the archaebacterium Sulfolobus solfataricus. J Bacteriol
177, 5561–5566.
16 Lindner HA, Lunin VV, Alary A, Hecker R, Cygler M
&Me
´
nard R (2003) Essential roles of zinc ligation and
enzyme dimerization for catalysis in the aminoacylase-
1 ⁄ M20 family. J Biol Chem 278, 44496–44504.
17 Liu Z, Zhen Z, Zuo Z, Wu Y, Liu A, Yi Q & Li W
(2006) Probing the catalytic center of porcine
aminoacylase 1 by site-directed mutagenesis, homology
modeling and substrate docking. J Biochem
139, 421–
430.
18 Occhipinti E, Martelli PL, Spinozzi F, Corsi F, Form-
antici C, Molteni L, Amenitsch H, Mariani P, Tortora
P & Casadio R (2003) 3D structure of Sulfolobus solfa-
taricus carboxypeptidase developed by molecular model-
ing is confirmed by site-directed mutagenesis and small
angle X-ray scattering. Biophys J 85, 1165–1175.
19 Gentzen I, Loffler HG & Schneider F (1980) Aminoacy-
lase from Aspergillus oryzae. Comparison with the pig
kidney enzyme. Z Naturforsch [C] 35, 544–550.

20 Palm GJ & Rohm KH (1995) Aminoacylase 1 from por-
cine kidney: identification and characterization of two
major protein domains. J Protein Chem 14, 233–240.
21 Wakayama M, Shiiba E, Sakai K & Moriguchi M
(1998) Purification and characterization of l-aminoacy-
lase from Pseudomonas maltophila B1. J Ferment Bioeng
85, 278–282.
22 Weiss HM, Palm GJ & Rohm KH (1995) Thermostable
aminoacylase from Bacillus stearothermophilus: signifi-
cance of the metal center for catalysis and protein sta-
bility. Biol Chem Hoppe Seyler 376, 643–649.
23 Lindner HA, Alary A, Boju LI, Sulea T & Me
´
nard R
(2005) Roles of dimerization domain residues in binding
and catalysis by aminoacylase-1. Biochemistry 44,
15645–15651.
24 Anders MW & Dekant W (1994) Aminoacylases. Adv
Pharmacol 27, 431–448.
25 Rowsell S, Pauptit RA, Tucker AD, Melton RG,
Blow DM & Brick P (1997) Crystal structure of
carboxypeptidase G2, a bacterial enzyme with
applications in cancer therapy. Structure 5, 337–347.
26 Liaw SH, Chen SJ, Ko TP, Hsu CS, Chen CJ, Wang
AH & Tsai YC (2003) Crystal structure of d-aminoacy-
lase from Alcaligenes faecalis DA1: a novel subset of
amidohydrolases and insights into the enzyme mecha-
nism. J Biol Chem 278, 4957–4962.
27 Lai WL, Chou LY, Ting CY, Kirby R, Tsai YC,
Wang AH & Liaw SH (2004) The functional role of the

binuclear metal center in d-aminoacylase: one-metal
activation and second-metal attenuation. J Biol Chem
279, 13962–13967.
28 Yokoyama S & Hiramatsu J (2003) A modified ninhy-
drin reagent using ascorbic acid instead of potassium
cyanide. J Biosci Bioeng 95, 204–205.
29 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR
(1989) Site-directed mutagenesis by overlap extension
using the polymerase chain reaction. Gene 77, 51–59.
30 Bates PA, Kelley LA, MacCallum RM & Sternberg
MJE (2001) Enhancement of protein modeling by
human intervention in applying the automatic
programs 3D-JIGSAW and 3D-PSSM. Proteins 45,
Suppl. 5, 39–46.
K. Tanimoto et al. Characterization of thermostable aminoacylase
FEBS Journal 275 (2008) 1140–1149 ª 2008 The Authors Journal compilation ª 2008 FEBS 1149